Open Access Article
Youdong Lia,
Jinwei Liab,
Peirang Cao*ab and
Yuanfa Liu
*ab
aSchool of Food Science and Technology, Jiangnan University, 1800 Lihu Road, Wuxi 214122, Jiangsu, People's Republic of China. E-mail: yfliu@jiangnan.edu.cn; prcao@jiangnan.edu.cn; Fax: +86-510-85876799; Fax: +86-510-85329081; Tel: +86-510-85876799 Tel: +86-510-85329081
bState Key Laboratory of Food Science and Technology, National Engineering Laboratory for Cereal Fermentation Technology, National Engineering Research Centre for Functional Food, Jiangnan University, 1800 Lihu Road, Wuxi 214122, Jiangsu, People's Republic of China
First published on 3rd June 2020
Oil enrichment with trace amounts of components has significant effects on animal nutrition and health. In this work, the potential impact of sinapine, a trace amount of polyphenol naturally present in rapeseeds, was investigated in high-fat diet (HF)-fed C57BL/6J mice. The mice were fed with different diets including chow diet (LF), HF diet, rapeseed oil-containing HF diet (RO), and rapeseed oils enriched with sinapine (500 mg kg−1 oil, high-fat diet, RP) for 12 weeks. Here, it was demonstrated that sinapine supplementation significantly reduced (P < 0.05) body weight increase, fat accumulation, and fatty liver formation in mice when compared with those fed with a high-fat diet. The TG, LDL-C, ALT and AST levels in the RP group were significantly reduced (P < 0.05) by 15.67%, 73.62%, 20.67%, and 31.58%, respectively, compared with that in the HF group. Besides, the addition of sinapine prevented the degeneration of mouse adipocytes and lipid accumulation in the liver. Moreover, this change was achieved by downregulating SREBP-1c and FAS and upregulating PPAR-α and ACOX1 gene expression levels. Our results indicate that sinapine can be used as a prebiotic to enhance the nutritional function of vegetable oils to prevent obesity-related chronic diseases such as NAFLD.
Edible oil is an essential source of energy and fatty acids for the body, and the quality of the edible oil may be related to human health. The type of the vegetable oil used affects the health of the population, and specific oil selection in the food industry is one of the most important steps for a healthy diet. The commonly used edible vegetable oils available in the market include peanut oil, rapeseed oil, palm oil, soybean oil, and sunflower oil. Different oils have different effects on the quality of the edible oil, and the functional properties of edible oils are related to the amount of active substances; the active substances in vegetable oils mainly include polyphenols, phytosterols, and tocopherols.7 Rapeseed has a high crude-oil content (36–43%) and is one of the most important oil crops in the world.8 Rapeseed oil is rich in nutrients with high contents of total phenolics, phytosterols, tocopherols, and β-carotene, which enhance the value of the rapeseed oil.9
The relationship between minor components and chronic diseases such as obesity, NAFLD, and cardiovascular diseases has been reported. Micronutrients in rapeseeds such as polyphenols, tocopherols, phytosterols, and phospholipids have potential benefits for preventing atherosclerosis.10 Moreover, the lack of tocopherol leads to hepatic lipid accumulation and obesity.11,12 Polyphenol is a critical component in food. It has several effects on nutrition and metabolism and antioxidative effects on health and metabolism. Lipid metabolism in the liver is mainly related to lipid synthesis and fatty acid β-oxidation. Excessive free fatty acids can cause β-oxidative damage, leading to oxidative stress. In addition, SREBP-1 is the key transcriptional factor involved in lipogenesis, whereas PPAR-α plays a key role in the catabolism of fatty acids.13 Studies suggested that tea polyphenols can promote the expression of PPAR-α in the rat liver to regulate β-oxidation.14
Rapeseeds are 10 to 30 times richer in polyphenols than other oil seeds. Rapeseed polyphenols are classified into phenolic acids (such as sinapic acid and sinapine) and condensed tannins. The sinapine content in rapeseed polyphenols is 70–80%, with the free sinapic acid content being 6–14%.15 Sinapine is an acetylcholinesterase inhibitor shown to exert therapeutic effects in Alzheimer's disease, ataxia, myasthenia gravis, and Parkinson's disease.16 In recent years, researchers have been paying more attention to the antioxidant and anti-cancer effects of sinapine.17,18 The impact on the liver has also been reported. Sinapine is mainly present in the form of thiocyanates in nature. Fu et al.19 evaluated the hepatoprotective effects of sinapine using a mouse model of liver injury induced by CCl4. In addition, they found that sinapine can improve the antioxidant defense system and inhibit liver damage. However, the effects of sinapine on high-fat diet-induced obesity and liver damage have not previously been evaluated in a systematic study. Whether this effect is related to antioxidant activity needs further confirmation.
Sinapine is mainly present in rapeseed meal, and its nutritional function as a natural active substance has not attracted enough attention from researchers. The objective of this study is to assess the effects of sinapine on lipid metabolism and hepatoprotection in mice. The fatty acid composition and minor components of the market rapeseed oil were measured, and the results were compared with various indexes in mice. Besides, the relationship between sinapine and lipid metabolism in mice was investigated. Thus, this study may provide a theoretical basis for the development of functional edible oils and healthy diets.
:
chloroform (2
:
1, v/v) and a solvent system consisting of methanol
:
water (95
:
5, v/v) at a flow rate of 0.3 mL min−1. The sample was detected by fluorescence and identified by retention time relative to the tocopherol standard.
:
30, flow rate of 1.0 mL min−1 and detection wavelength of 450 nm.To explore the cytotoxicity of sinapine to HepG2 cells, a cell counting kit-8 (CCK-8) solution was used. The cells (1 × 104) were seeded into 96-well plates and incubated for 24 h. Then, they were treated with various amounts of sinapine. After 24 h of incubation, 10 μL of CCK-8 solution was added to each well for further 2 h, and the corresponding absorbance (A value) was measured at 450 nm using a microplate reader. For the quantitative measurement of intracellular lipid accumulation, a procedure described by Nasrin et al.28 was followed with slight modification. The cells (2 × 104) were seeded into 24-well plates and treated with OA and various amounts of sinapine simultaneously and incubated for further 24 h. Then, the cells were fixed with 10% formalin and stained with freshly diluted 0.5% oil red O solution for 15 min (60% isopropanol, Sigma-Aldrich, USA). After washing thoroughly with tap water, the stain was extracted with isopropanol, and the OD was measured at 510 nm wavelength using a plate reader (SpectraMax 2, molecular device, CA, USA). The sinapine inhibition rate was calculated relative to that of OA-induced lipid accumulation, and the medium without FAA was used as the control. All the tests were performed in triplicate, and the means were calculated.
Bodyweight and food consumption were monitored weekly and every other day, respectively. At the end of 12 weeks of feeding, the mice were killed, and blood and tissue samples were collected. The collected tissues were either fixed with formalin for H&E staining or frozen immediately in liquid nitrogen and stored at −80 °C according to standard procedures. The images were taken using a DP73 Olympus microscope (Tokyo, Japan).
The MDA content and antioxidase activity were detected using the corresponding kit. After collection, the cells were lysed and centrifuged (12
000 × g, 5 min). Then the supernatant was taken for subsequent experiments. The protein concentration was determined using the BCA protein assay kit.
| Species | Gene | Forward | Reverse | Accession no. |
|---|---|---|---|---|
| a PPARα: peroxisome proliferator activated receptor α; ACOX2: acyl-CoA oxidase 2; ACOX1: acyl-CoA oxidase 1; SREBP-1c: sterol regulatory element-binding protein-1c; FAS: fatty acid synthase; Dgat2: diacylglycerol acyltransferase 2. | ||||
| Human | β-Actin | AAGGAGCCCCACGAGAAAAAT | ACCGAACTTGCATTGATTCCAG | NM_004882 |
| PPAR-α | GATGCCAGCGACTTTGACTC | ACCCACGTCATCTTCAGGGA | NM_001172698 | |
| ACOX2 | GCACCCCGACATAGAGAGC | CTGCGGAGTGCAGTGTTCT | NM_003500 | |
| SREBP-1c | TGCATTTTCTGACACGCTTC | CCAAGCTGTACAGGCTCTCC | NM_001005291.3 | |
| FAS | GTTGAGGGTCTGCGTGTCTTT | ACCCAGGGTGGCTAGAACA | NM_079422 | |
| Mouse | β-Actin | GCTACAGCTTCACCACCACA | AAGGAAGGCTGGAAAAGAGC | NM_027493 |
| PPAR-α | GCAGCTCGTACAGGTCATCA | ACTGCCGTTGTCTGTCACTG | NM_133947 | |
| ACOX1 | GTCTCGTCTTCGGCCTAGTG | TCGCTTGAGTGACCAGTGTC | NM_030721 | |
| SREBP-1c | CAGCTATTGGCCTTCCTCAG | GGTTACTGGCGGTCACTGTC | NM_011252.4 | |
| FAS | ATGCACACTCTGCGATGAAG | TTCAGGGTCATCCTGTCTCC | NM_019569 | |
| Dgat2 | TCGCGAGTACCTGATGTCTG | AGGGGGCGAAACCAATATAC | NM_026384 | |
| Type of fatty acid (%) | |
|---|---|
| a SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; UFA: unsaturated fatty acid. | |
| C16:0 | 3.85 ± 0.03 |
| C16:1 | 0.20 ± 0.01 |
| C18:0 | 1.91 ± 0.02 |
| C18:1 | 65.39 ± 0.15 |
| C18:2 | 17.65 ± 0.09 |
| C18:3ω6 | 0.05 ± 0.01 |
| C18:3ω3 | 8.07 ± 0.06 |
| C20:0 | 0.65 ± 0.02 |
| C20:1 | 1.25 ± 0.05 |
| C20:4 | 0.36 ± 0.01 |
| C22:5ω6 | 0.18 ± 0.02 |
| C24:0 | 0.20 ± 0.02 |
| Total SFA | 6.74 ± 0.13 |
| Total MUFA | 66.95 ± 0.41 |
| Total PUFA | 26.31 ± 0.30 |
| Total UFA | 93.26 ± 0.45 |
| Tocopherol (mg kg−1) | |
| α | 159.52 ± 10.83 |
| β | 16.62 ± 0.81 |
| γ | 485.84 ± 14.27 |
| δ | 16.95 ± 2.11 |
| Total VE | 678.93 ± 14.32 |
![]() |
|
| Phytosterol (mg kg−1) | |
| Brassicasterol | 736.29 ± 28.22 |
| Campesterol | 2081.07 ± 80.56 |
| β-Sitosterol | 2874.03 ± 75.22 |
| Total | 5691.39 ± 90.21 |
![]() |
|
| Polyphenols (mg GAE per kg) | 71.65 ± 4.83 |
| Oxidation induction time, h | DPPH radical scavenging activity, μmol TE/100 g oil | |
|---|---|---|
| a SP rapeseed oil: rapeseed oil with sinapine addition. | ||
| Rapeseed oil | 4.84 ± 0.37a | 232.21 ± 6.23a |
| SP rapeseed oil | 6.30 ± 0.21b | 259.75 ± 7.82b |
Gene expression related to lipid metabolism in cells was measured by qPCR. As shown in Fig. 1D, the mRNA levels for genes encoding sterol regulatory element-binding protein-1c (SREBP-1c), the upstream activator of lipogenic regulator, were enhanced in the OA group. However, it was inhibited by sinapine supplementation. FAS, a desaturase essential for fatty acid synthesis, was reduced accordingly in sinapine supplementation groups (Fig. 1D), indicating that fatty acid synthesis diminished. Moreover, the mRNA levels for peroxisome proliferator-activated receptor α (PPARα), the master regulator of fatty acid oxidation in the liver, were clearly enhanced with the increase in sinapine ingestion in contrast to the OA treatment group (Fig. 1D). As one of its downstream targets for fatty acid oxidation on peroxisomes, acyl-CoA oxidase 2 (ACOX2) was inhibited in the OA group, and no significant difference was observed at a concentration of 0.4 mM sinapine compared to the control ones. These data might indicate a significant increase in the expression of genes regulating fatty acid oxidation on peroxisomes.
![]() | ||
| Fig. 2 The growth curve of mice fed with various diets for 12 weeks. The body weight change (A), final body weight gain (B), average food intake (C), change in adipose tissue weight including epididymal fat weight (D), perirenal fat weight (E) and liver weight (F) of mice with different diets were included (ref. 29). Data are expressed as mean ± SEM (n = 10). Different letters indicate significant differences (P < 0.05) between groups; the one-way ANOVA test followed by the Tukey test. Note: LF: low-fat diet; HF: high-fat diet; RO: rapeseed oil diet; RP: rapeseed polyphenol diet. | ||
![]() | ||
| Fig. 3 Effects of sinapine on liver and adipose tissue morphology (H&E) and liver lipid accumulation (ORO) in HFD-fed mice (200× magnification) (ref. 29). HE: hematoxylin and eosin; ORO: oil red O; LF: low-fat diet; HF: high-fat diet; RO: high-fat diet with common rapeseed oil; RP: high-fat diet with sinapine in rapeseed oils. | ||
A further comparison was made on the overall animal health using blood biochemical parameters, very important indicators of general animal health. As expected, high-fat diet feeding led to hyperlipidemia. The total plasma cholesterol and triacylglycerol contents of the HF and RO groups were significantly higher than those of the low-fat diet chow group. With sinapine supplementation to the high-fat diet, both total cholesterol and triacylglycerol contents were significantly reduced (Table 4). The LDL-C, the bad cholesterol, was also dramatically decreased to 1.3 ± 0.2 mmol L−1, even as low as 1.4 ± 0.1 mmol L−1 in chow-fed mice (Table 4), in contrast to 5.1 ± 0.2 mmol L−1 in HF-fed mice. There was not much difference in HDL-C among all groups. These results indicated that sinapine can inhibit blood lipid metabolism disorders.
| TC, mmol L−1 | TG, mmol L−1 | LDL-C, mmol L−1 | HDL-C, mmol L−1 | ALT, U L−1 | AST, U L−1 | |
|---|---|---|---|---|---|---|
| a LF: low-fat diet; HF: high-fat diet; RO: rapeseed oil diet; RP: rapeseed polyphenol diet; TC: total cholesterol; TG: total triglyceride; LDL-C: low-density lipoprotein cholesterol; HDL-C: high-density lipoprotein cholesterol; ALT: alanine aminotransferase; AST: aspartate transaminase. | ||||||
| LF | 4.01 ± 0.25a | 0.53 ± 0.04a | 1.38 ± 0.11a | 2.32 ± 0.10a | 46.75 ± 6.56a | 127.61 ± 10.19a |
| HF | 6.03 ± 0.32b | 0.70 ± 0.03bc | 5.05 ± 0.16b | 2.39 ± 0.35a | 60.82 ± 5.98b | 171.22 ± 12.72b |
| RO | 4.88 ± 0.21c | 0.74 ± 0.03c | 3.51 ± 0.15c | 2.40 ± 0.28a | 50.40 ± 4.35a | 162.83 ± 8.67b |
| RP | 4.56 ± 0.18ac | 0.59 ± 0.03ab | 1.33 ± 0.16a | 2.09 ± 0.10a | 47.67 ± 7.76a | 117.45 ± 14.94a |
The mRNA level of PPARα was down-regulated by a high-fat diet (HF and RO) and stimulated by sinapine supplementation (Fig. 4D). One of its downstream targets, ACOX1 for fatty acid oxidation, showed a very similar trend. From all these data, this work showed that under high-fat diet feeding conditions, sinapine could stimulate fat oxidation and inhibit lipid biosynthesis, leading to significant improvement in lipid metabolism and preventing fatty liver formation.
Our results indicated that the rapeseed oil is rich in omega-3 essential fatty acids and some trace components such as phytosterols, tocopherols and polyphenols. These ingredients have beneficial effects on human health. Polyphenols have various activities, including anti-oxidative, anti-inflammatory, anti-tumor and prevention of cardiovascular diseases. Sun et al.33 studied the antioxidant properties and stability of polyphenols. They found that polyphenols can significantly increase 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activity and ferric reducing antioxidant power (FRAP). The results of our determination of the anti-oxidant capacity of polyphenols are consistent with the above-mentioned results. The polyphenols in rapeseeds are high in content and contain mainly sinapic acid and its derivatives such as sinapine and choline derivatives of sinapine.34 However, the polyphenol content of rapeseed oils from food markets is significantly lower than that from the rapeseed and its meal, in which it is about 1–3% of the total weight. The significant loss of polyphenols as well as other trace components such as phytosterols and tocopherols in rapeseed oils is due to the processing methods and raw materials of vegetable oils. In food science, polyphenols have anti-oxidative and nutritive effects on metabolism, fortifying the rapeseed oil. Sinapine was selected and added to 500 mg kg−1 of oil, which was in the range of extra virgin oil phenolic contents (200–500 mg kg−1).35,36
In order to explore the nutritional function of sinapine, we conducted in vitro experiments. The results indicated that oleic acid treatment caused accumulation of cellular lipids, and sinapine supplementation prevented this phenomenon. HepG2 cells can efficiently accumulate intracellular phospholipids in the presence of oleic acid. Excessive fatty acids can lead to increased lipid accumulation in hepatocytes. The lipids are combined with apolipoprotein B (ApoB) and exported from the liver in the form of very low density lipoprotein (VLDL). An increase in the amount of TG and its clearance reduces the incidence of lipid metabolism disorders.37
Sinapine significantly inhibited hepatocyte cell intracellular lipid accumulation in a concentration-dependent manner. In HepG2 hepatocytes, polyphenols increase the phosphorylation of AMP-activated protein kinase (AMPK) and its downstream target acetyl-CoA carboxylase (ACC), increase AMPK activity and reduce liver lipid accumulation.38 Gene expression related to lipid metabolism further supported the changes induced by sinapine. An increase in the level of mRNAs encoding PPARα, which is involved in β-oxidation, was observed in the sinapine groups compared to the OA group. Interestingly, the same trend was also observed as to mRNAs encoding Acox2, a downstream target of PPARα, which regulates the fatty acid oxidation on peroxisomes. SREBP-1c and FAS increase hepatic lipogenesis and contribute to lipid deposition in the liver. As the concentration of sinapine increased, the expressions of SREBP-1c and FAS were down-regulated, indicating that sinapine inhibited lipid synthesis in hepatocytes. Our results were in line with others' work with lipid metabolism.39,40 As fatty liver is the consequence of excess amounts of lipid deposition in the hepatocyte, this result strongly indicated that direct inhibition of polyphenols from rapeseed oils might be an important mechanism in preventing fatty liver formation via nutrient changes.
Long-term high-fat diet intervention leads to the accumulation of subcutaneous and organ fat in mice, which increases body and organ weights. Sinapine supplementation reduced the body weight of mice in the RP group by 11.24% compared with the HF group, and the weight of the organs also decreased significantly. This shows that sinapine is involved in the regulation of lipid metabolism. These results were consistent with other reports that (1) high contents of unsaturated fatty acids in vegetable oils are less obesogenic than those of saturated fatty acid riches in fat-like lard41 and (2) polyphenol addition to the diet reduces animal body weight gains and improves metabolism.42 In addition, sinapine also improved lipid metabolism in mice. These results were consistent with the notion that the addition of polyphenols to a high-fat diet would significantly improve animal health and improve its hyperlipidemia.43,44
Excess energy leads to fatty acid degeneration and lipid accumulation in the liver. The cause of NAFLD is related to oxidative stress. The intake of sinapine reduced the degree of NAFLD and improved the integrity of fat cells. As polyphenolics play an important role in anti-oxidative capacities in vitro and in vivo as well,43,45 these results indicated that rapeseed polyphenols could not only reduce hepatic steatosis but also improve liver functions induced by the high-fat diet. High-fat diets induced fatty liver formation and led to lipid accumulation, oxidative stress, and chronic inflammation.46 Whether sinapine significantly prevents fatty liver formation in RP-treated mice may be related to oxidative environments, and the liver redox status and its oxidative products were examined. Malondialdehyde (MDA), an accumulated product of membrane peroxidation, was reduced from 22 and 19 nmol mg−1 of HR and RO, respectively, to 14 nmol mg−1 of RP, which was very close to the MDA level of chow-fed mice (Fig. 4A). Superoxide dismutase (SOD), the major component of anti-oxidation in liver tissues, also decreased inversely; namely, sinapine-containing high-fat diet-fed mice have almost restored their SOD activities in contrast to other high-fat diet-fed groups. These results indicated that sinapine from rapeseed oils could reduce fatty liver formation by reduced anti-oxidation and were consistent with other reports.47
Gene expression related to lipid metabolism in the mouse liver was determined by qPCR. Fatty acid synthase is a key lipogenic enzyme, and Dgat2 enzyme is important for triglyceride biosynthesis,48–50 both of which down-regulate gene mRNA expression. Moreover, the intake of sinapine up-regulated the expression levels of PPARα and ACOX2. These results are consistent with the results of in vitro experiments. In addition, our results are also supported by other works: Shimoda et al.51 demonstrated that polyphenols from walnuts have a hypolipidemic effect in the high-fat diet-fed mice via down-regulation of both hepatic PPARα and ACOX-1. The above-mentioned results indicated that sinapine can regulate lipid metabolism and maintain liver health by reducing lipid synthesis and promoting lipid β-oxidation. In addition, this function is related to the antioxidant properties of polyphenols.
In conclusion, our results clearly indicated that sinapine has beneficial effects on cardiovascular health. Sinapine can inhibit the accumulation of triglycerides in human HepG2 cells. Interestingly, the sinapine-supplemented rapeseed oil enriches the content of polyphenols to enhance its nutritional value, which was evaluated in an animal model, and shows its high efficacy in improving its effect on the fatty liver formation and lipid metabolism. Sinapine supplementation could significantly inhibit animal body weight increase, fat deposition, and fatty liver formation. This work showed that sinapine supplementation could inhibit fatty liver damage via up-regulating gene expression for lipid metabolism and down-regulating gene expression for lipid synthesis. This result might indicate that the beneficial effect of using sinapine as a food additive, as well as highlight the role of the rapeseed polyphenol in health, nutrition, and pharmacology and provide a theoretical basis for the development of a healthy diet and edible vegetable oil.
| LF | Low fat diet |
| HF | High fat diet |
| RO | Rapeseed oil diet |
| RP | Rapeseed polyphenol diet |
| TFFA | Total free fatty acid |
| SFA | Saturated fatty acid |
| UFA | Unsaturated fatty acid |
| MUFA | Monounsaturated fatty acid |
| PUFA | Polyunsaturated fatty acid |
| HE | Hematoxylin and eosin |
| ORO | Oil red O |
| TC | Total cholesterol |
| TG | Total triglyceride |
| LDL-C | Low density lipoprotein cholesterol |
| HDL-C | High density lipoprotein cholesterol |
| ALT | Alanine aminotransferase |
| AST | Aspartate transaminase |
| SOD | Superoxide dismutase |
| MDA | Malondialdehyde |
| SREBP-1c | Sterol regulatory element binding protein-1c |
| FAS | Fatty acid synthase |
| DGAT2 | Diacylglycerol acyltransferase 2 |
| PPAR-α | Peroxisome proliferator-activated receptor alpha |
| ACOX2 | Acyl-coA oxidase 2 |
Footnote |
| † Electronic supplementary information (ESI) available. See DOI: 10.1039/d0ra00215a |
| This journal is © The Royal Society of Chemistry 2020 |