Anna Kaczmarkiewicz,
Judyta Zielak,
Łukasz Nuckowski
and
Sylwia Studzińska
*
Chair of Environmental Chemistry and Bioanalytics, Faculty of Chemistry, Nicolaus Copernicus University, 7 Gagarin Str., PL-87-100 Toruń, Poland. E-mail: kowalska@chem.umk.pl; Fax: +48-56-6114837; Tel: +48-56-6114308
First published on 28th November 2019
The main goal of this study was the investigation of the impact of several ionic liquids, commonly used as free silanol suppressors, on the retention and separation of phosphorothioate oligonucleotides. Three various stationary phases (octadecyl, octadecyl with embedded polar groups and pentafluorophenyl) as well as ionic liquids with the concentration range of 0.1–7 mM were used for this purpose. The results obtained during this study showed that the increase in concentration of ionic liquids results in increasing retention of the oligonucleotides. Such an effect was observed regardless of the stationary phase used. Moreover, elongation of the alkyl chain in the structure of ionic liquids caused an increase of antisense oligonucleotide retention factors. The results obtained during retention studies confirmed that addition of ionic liquids to the mobile phase influences antisense oligonucleotide retention in a way similar to the case of commonly used ion pair reagents such as amines. A method of oligonucleotide separation was also developed. The best selectivity was obtained for the octadecyl stationary phase since separation of mixtures of antisense oligonucleotides and their metabolites differing in sequence length was successful. It has to be pointed out that ionic liquids were used for the first time as mobile phase additives for oligonucleotide analysis.
Application of ILs as mobile phase modifiers in liquid chromatography results from their donor–acceptor properties, whereby they are able to block free silanols present on the surface of silica stationary phases, similarly to amines which are commonly used silanol activity suppressors.3 Xiaohua et al.4 used four different ILs containing 3-methylimidazolium tetrafluoroborate anions in amines analysis. They proved that as concentration of ILs and the length of the alkyl chain in the imidazolium cation structure increase, the retention factors (k) of amines decrease, which is related to cation repulsion. Furthermore, the researchers postulated that addition of ILs to the mobile phase may effectively shield free silanol groups and improve analyte peak shapes. Similar conclusions were drawn by He et al.2 during the analysis of ephedrines. Moreover, the authors suggested that ILs are better additives for peak shape enhancement than amines commonly used as silanol blockers (e.g. triethylamine TEA).
Besides the ability of amines to suppress the activity of free silanol groups, they are also commonly used as ion pair reagents (IPRs) in ion pair chromatography (IPC) as they are adsorbed on the stationary phase surface, and form ion pairs with the negatively charged analytes. Thus, polar and ionized compounds, such as oligonucleotides, are retained due to electrostatic and hydrophobic interactions, as well as hydrogen bonding.7
Nowadays, IPC is the most popular technique for quantification and separation of antisense oligonucleotides (ASOs), which are nucleic acid analogs, used in the treatment of several diseases.8 These compounds are built of several dozen nucleotides and are characterized by a modified structure, which prevents digestion by intracellular nucleases. Several difficulties can be encountered during their analysis, e.g. selection of stationary phase and appropriate IPR, which could provide effective separation of ASOs within a reasonable time as well as high MS sensitivity.9–12 Commonly used mobile phase composed of triethylammonium acetate (TEAA) and acetonitrile causes significant ionization suppression in mass spectrometry (MS).13 Application of more hydrophobic alkylamine acetates caused enhancement of MS sensitivity, however, the main issue was cation adduction. For this reason, 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP) was introduced to the mobile phase composed of alkylamine and methanol, providing high MS sensitivity, a small number of adducts and complete ASO separation.14 Nowadays, such mobile phases are the most popular for oligonucleotides analysis. On the other hand, Huber et al.15–17 obtained a significant reduction of cation adducts when triethylammonium bicarbonate and butyldimethylammonium bicarbonate were used as mobile phase for the analysis of various oligonucleotides. However, the separation efficiency for some of them (e.g. polythymidylic acids) was not satisfactory when a low concentration of IPR was applied. Consequently, there is a need for the development of other mobile phase additives (e.g. ILs) or other modes of liquid chromatography application. Ion exchange chromatography (IEC) and hydrophilic interaction liquid chromatography (HILIC) are also used in the analysis of oligonucleotides. IEC offers selective separation of N-deleted oligonucleotides, and accurate optimization of the chromatographic conditions allows for analysis of ASO in biological matrices with detection limits ranging from 40–250 ng ml−1.12 HILIC mode offers relatively high MS sensitivity, however, application of ammonium acetate or ammonium formate significantly influences separation selectivity.18,19
Until now, there have been no reports on application of ILs as mobile phase additives in ASO analysis. Therefore, an attempt has been made to examine the influence of IL type and concentration on the ASO retention for three different chromatographic columns. Moreover, the study included a comparison of the influence of ILs and conventional IPR on ASO retention. The methods for separation of modified ASOs and their metabolites were also developed for each tested column.
Name | Sequence 5′ → 3′ | Modification | Molecular mass | Mixture |
---|---|---|---|---|
OL1 | GCCCAAGCTGGCATCCGTCA | Phosphorothioate | 6368 | MIX 1 |
OL2 | GCCCAAGCTGGCATCCG | 5413 | ||
OL3 | GCCCAAGCTGGCAT | 4458 | ||
OL4 | GGGGAAGCTGGCATCCGTCA | 6488 | MIX 2 | |
OL5 | GCCCAAGCTGGCATGGGTCA | 6448 | ||
OL6 | GGGGAAGCTGGCATGGGTCA | 6568 | ||
ME20 | GCCCAAGCTGGCATCCGTCA | 2′-O-Methyl | 6621 | MIX 3 |
ME19 | GCCCAAGCTGGCATCCGTC | 6278 | ||
ME18 | GCCCAAGCTGGCATCCGT | 5959 | ||
MOE20 | GCCCAAGCTGGCATCCGTCA | 2′O-Methoxyethyl | 7657 | MIX 4 |
MOE19 | GCCCAAGCTGGCATCCGTC | 7269 | ||
MOE18 | GCCCAAGCTGGCATCCGT | 6892 |
Mobile phases were made with the use of deionized water (Milli-Q system, Millipore, El Paso, TX, USA), methanol (MeOH) (Merck KGaA, Darmstadt, Germany) and ILs such as 1-ethyl-3-methylimidazolium chloride [EMIM][Cl], 1-butyl-3-methylimidazolium chloride [BMIM][Cl], and 1-hexyl-3-methylimidazolium chloride [HMIM][Cl] (Sigma-Aldrich, Gillingham, Dorset, UK). The structures of ILs cations were presented on Fig. S1 in ESI.† Moreover, N,N-dimethylbutylamine and triethylamine (Sigma-Aldrich, Gillingham, Dorset, UK) were used in order to compare the influence of ILs and alkylamines on ASO retention. 5 mM amine chlorides were prepared by dilution of amine in deionized water and adjusting the pH to 6.8 by using of 5% hydrochloric acid (Merck KGaA, Darmstadt, Germany). Sodium chloride solution of the same concentration was also used as a mobile phase (POCH S.A., Gliwice, Poland). The mixture of phenol/chloroform/isoamyl alcohol (25/24/1, v/v/v) (VWR International, Poland) was used during liquid–liquid extraction (LLE) of ASO from human serum enriched with ASO.
Three various chromatographic columns with the same dimensions (100 × 2.1 mm, 1.7 μm) were tested in the investigations: Syncronis aQ (octadecyl with embedded polar group, Thermo, Waltham, USA), Kinetex F5 (pentafluorophenyl, Phenomenex, Torrance, USA) and Kinetex C18 (octadecyl, Phenomenex, Torrance, USA).
The concentrations of the studied ILs were in the range of 0.1–7 mM for octadecyl column, while for remaining stationary phases 3–7 mM of ILs were tested. Mobile phase flow rate was 0.2 ml min−1 (due to the limited apparatus pump pressure) for aQ column and 0.3 ml min−1 for the remaining ones. The following gradient elution program was used: 25–60% v/v MeOH in 15 minutes. The temperature of the autosampler and column was 30 °C. The UV detection wavelength was selected as λ = 260 nm, while the injection volume was 1–3 μl depending of the IL type.
For separation of the tested mixtures, the concentration of [HMIM][Cl] was 7 mM and 10 mM. In order to obtain the best possible separation, some parameters such as the flow rate, column temperature and gradient elution programs were adjusted.
In order to compare ASO retention for ILs and alkylamines, the following gradient elution program was applied: 20–40% v/v MeOH in 15 minutes. The injection volume equaled 2 μl, while the autosampler and column temperature was 30 °C.
Firstly, [BMIM][Cl] in the wide range of concentrations (0.1–7 mM) was investigated with respect to the ASOs retention on octadecyl column. Such IL concentrations were selected based on the literature.2,20,21,23 ASO k′ values obtained during this step of study are presented in Table 2.
k′ ± SD | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
[EMIM][Cl] | [BMIM][Cl] | [HMIM][Cl] | |||||||||
OGN | 3 mM | 5 mM | 7 mM | 0.1 mM | 0.5 mM | 3 mM | 5 mM | 7 mM | 3 mM | 5 mM | 7 mM |
aQ | |||||||||||
OL1 | 5.988 ± 0.166 | 6.590 ± 0.331 | 10.036 ± 0.045 | n.a. | n.a. | 11.797 ± 0.011 | 12.347 ± 0.036 | 12.757 ± 0.091 | 19.717 ± 0.343 | 20.453 ± 0.077 | 21.431 ± 0.066 |
OL2 | 6.445 ± 0.036 | 6.492 ± 0.127 | 6.658 ± 0.000 | n.a. | n.a. | 10.449 ± 0.011 | 11.193 ± 0.597 | 11.641 ± 0.254 | 18.301 ± 0.089 | 20.010 ± 0.048 | 20.239 ± 0.050 |
OL3 | 5.425 ± 0.123 | 5.695 ± 0.027 | 7.021 ± 0.011 | n.a. | n.a. | 9.330 ± 0.066 | 10.388 ± 0.054 | 10.900 ± 0.620 | 17.025 ± 0.143 | 18.905 ± 0.054 | 19.170 ± 0.077 |
OL4 | 6.081 ± 0.034 | 6.794 ± 0.023 | 8.226 ± 0.034 | n.a. | n.a. | 10.646 ± 0.089 | 11.538 ± 0.066 | 11.663 ± 0.111 | 18.208 ± 0.022 | 20.101 ± 0.000 | 20.203 ± 0.077 |
OL5 | 6.090 ± 0.000 | 6.833 ± 0.011 | 8.124 ± 0.022 | n.a. | n.a. | 10.630 ± 0.497 | 11.804 ± 0.320 | 11.944 ± 0.199 | 18.237 ± 0.000 | 20.251 ± 0.011 | 20.494 ± 0.111 |
OL6 | 5.260 ± 0.0658 | 6.215 ± 0.045 | 7.599 ± 0.011 | n.a. | n.a. | 10.183 ± 0.054 | 11.139 ± 0.034 | 12.180 ± 0.066 | 18.106 ± 0.100 | 20.196 ± 0.000 | 20.317 ± 0.000 |
![]() |
|||||||||||
C18 | |||||||||||
OL 1 | 8.308 ± 0.008 | 9.016 ± 0.047 | 10.492 ± 0.49 | tm | 6.971 ± 0.082 | 15.892 ± 0.130 | 17.645 ± 0.130 | 18.683 ± 0.136 | 27.417 ± 0.014 | 31.808 ± 0.195 | 39.105 ± 0.833 |
OL 2 | 6.494 ± 0.148 | 7.369 ± 0.305 | 8.331 ± 0.000 | tm | 6.167 ± 0.117 | 13.978 ± 0.006 | 15.917 ± 0.055 | 17.181 ± 0.026 | 26.752 ± 0.114 | 31.338 ± 0128 | 38.483 ± 0.075 |
OL 3 | 0.954 ± 0.089 | 2333 ± 0.062 | 6.944 ± 0.053 | tm | 1.212 ± 0.135 | 12.593 ± 0.014 | 14.605 ± 0000 | 15.907 ± 0.028 | 26.762 ± 0.400 | 30.583 ± 0.128 | 37.285 ± 0209 |
OL 4 | 6.408 ± 0.177 | 7.873 ± 0.095 | 8.466 ± 0.122 | n.a. | n.a. | 15.079 ± 0.061 | 16.855 ± 0.053 | 18.186 ± 0.014 | 28.980 ± 0.010 | 32.967 ± 0.169 | 40.388 ± 0.075 |
OL 5 | 6.235 ± 0.055 | 7.456 ± 0.400 | 8.226 ± 0.067 | n.a. | n.a. | 14.733 ± 0.006 | 16.677 ± 0.020 | 18.138 ± 0.014 | 29.214 ± 0.020 | 32.904 ± 0.758 | 40.915 ± 0.171 |
OL 6 | 5.445 ± 0.006 | 6.786 ± 0.548 | 7.130 ± 0.061 | n.a. | n.a. | 14.389 ± 0.047 | 16.473 ± 0.041 | 17.918 ± 0.012 | 29.515 ± 0.244 | 34.356 ± 0.670 | 40.464 ± 0.792 |
![]() |
|||||||||||
F5 | |||||||||||
OL1 | 16.224 ± 0.295 | 18.545 ± 0.075 | 20.391 ± 1.306 | n.a. | n.a. | 25.085 ± 0.396 | 26.759 ± 0.443 | 29.255 ± 0.370 | 36.562 ± 0.198 | 41.360 ± 0.468 | 41.623 ± 0.000 |
OL2 | 13.135 ± 0.075 | 15.210 ± 0.148 | 16.695 ± 0.223 | n.a. | n.a. | 23.688 ± 0.000 | 25.679 ± 0.000 | 28.172 ± 0.025 | 35.761 ± 0.395 | 39.686 ± 0.171 | 40.000 ± 0.121 |
OL3 | 10.921 ± 0.097 | 13.207 ± 0.025 | 14.862 ± 0.000 | n.a. | n.a. | 21.666 ± 0.050 | 23.933 ± 0.050 | 26.341 ± 0.000 | 34.697 ± 0.122 | 37.768 ± 0.025 | 39.426 ± 0.199 |
OL4 | 14.846 ± 1.532 | 15.892 ± 0.075 | 17.235 ± 0.050 | n.a. | n.a. | 24.684 ± 0.025 | 26.743 ± 0.025 | 29.080 ± 0.025 | 37.401 ± 0.50 | 41.238 ± 0.050 | 42.336 ± 0.075 |
OL5 | 13.257 ± 0.050 | 15.490 ± 0.050 | 16.780 ± 0.050 | n.a. | n.a. | 24.282 ± 0.050 | 26.357 ± 0.025 | 28.677 ± 0.000 | 37.542 ± 0.000 | 41.222 ± 0.025 | 42.983 ± 0.345 |
OL6 | 11.583 ± 0.148 | 13.973 ± 0.079 | 15.524 ± 0.000 | n.a. | n.a. | 23.585 ± 0.050 | 23.986 ± 2.738 | 28.313 ± 0.025 | 37.768 ± 0.075 | 41.291 ± 0.025 | 43.263 ± 0.050 |
ASOs were not retained on the stationary phase surface for the lowest concentration of IL cations (0.1 mM) in the mobile phase (Table 2). This is probably related to the fact that, the amount of [BMIM] cations adsorbed on the stationary phase ligands is probably insufficient to obtain ASO retention (Table 2).
Increasing of the ILs concentration ILs to 0.5 mM resulted in elution of ASOs after column void time; however, the k′ values obtained for these compounds are low (Table 2). Higher ASO k′ values were noted when [BMIM][Cl] concentration in the mobile phase was further increased (in the range between 3–7 mM) (Table 2 and Fig. 1). Such behavior of ASOs is similar to the case of IPC used in ASO analysis, where IPRs are used as mobile phase modifiers. Generally, the ASO retention mechanism in IPC results from simultaneous ion pair formation between negatively charged ASOs and cations of alkylamines, as well as IPRs adsorption on hydrophobic stationary phase ligands.9,11,24 Thus, both hydrophobic and electrostatic interactions take place in the retention of the analytes. One of the most important factors in IPC which influences ASOs retention is alkylamine concentration, since its increase results in greater ASOs retention, as in the case of our findings (Table 2).
In order to confirm the tendencies noted for C18 stationary phase, investigation was extended to other stationary phases and two ILs ([EMIM][Cl], [HMIM][Cl]) for the concentration range 3–7 mM. Fig. 1 illustrates the results obtained for F5 column. The results for the remaining stationary phases are shown in Fig. S2 and S3 in the ESI.† As it can be seen in these figures, similar tendencies as in the case of C18 column were obtained for the other ILs and stationary phases. The observed effects are probably related to the fact that for higher IL concentration probably a greater amount of imidazolium cations adsorbs on the stationary phase ligands. Thus ion exchanger is dynamically formed on the packing material ligands, which consequently leads to more effective electrostatic interactions with ASOs (Fig. 1, S2, S3 and Table 2). Another possible cause of this effect may be related to the formation of ion pairs between IL cations and the studied compounds. The negative charge of ASOs is then neutralized and the adsorption on the hydrophobic stationary phase takes place during a chromatographic run, as a consequence of hydrophobic interactions.
Furthermore, for lower IL concentrations the observed peak shapes were poorer than for higher ones (data not shown).
Berthod et al.22 postulated that ILs have a dual nature and both their anions and cations can adsorb on the stationary phase, depending on their position in lyotropic order. Chaotropic cations such as imidazolium ones are weakly hydrated, so they preferentially adsorb on the hydrophobic stationary phase ligands, since adsorption of cosmotropic anions (e.g. Cl−) is minor because they are strongly hydrated. Consequently, retention of basic solutes with positive charge is reduced when IL with a chaotropic cation and cosmotropic anion is added to the mobile phase.28 The k′ values of such analytes also decrease when alkyl chain in the imidazolium cation is longer.3 In the case of negatively charged ASOs, an opposite effect was observed (Table 2).
Furthermore, based on the data included in Table S1 in ESI† it may be concluded that, the longer the alkyl chain in the ILs structure is, the lower the symmetry of ASO peaks. Such an effect was observed regardless of tested stationary phase. It is probably related to stronger electrostatic interactions between ASOs and [HMIM] cation, compared to [BMIM] or [EMIM], which consequently leads to the peaks tailing. Moreover, with the increasing of given ILs concentration, there is slight decrease in the symmetry of tested compounds, which may be related with the adsorption of greater number of ILs cations and consequently, stronger electrostatic interactions (Table S1†). Although asymmetry factors obtained for [HMIM][Cl] are slightly greater, compared to the remaining ILs, peaks obtained for this IL were narrower, which may be crucial in terms of ASO mixtures separation.
Another important factor which may influence ASO retention is the sequence length. The longer the phosphodiester chain in the ASO structure, the stronger the retention, caused by the greater number of negatively charged phosphorothioate groups. Consequently, it is likely that a greater number of ion pairs (between ILs and ASOs) is formed, and they interact more effectively with the ILs adsorbed at the stationary phase structure (Table 2).
Another step of this investigation was performed in order to study the retention of imidazolium cations on the octadecyl ligands. The investigation was conducted for detection wavelength λ = 210 nm and the mobile phase consisted of methanol and water. Individual ionic liquids ([EMIM][Cl] and [BMIM][Cl]) were injected into the chromatographic system, together with the decreasing percentage of methanol in the mobile phase (from 95% to 5% v/v of MeOH changed in increments of 5%). For [EMIM][Cl] retention was observed only at low content of methanol in the mobile phase (5% and 10% v/v), which was insufficient to describe adsorption effects. For the [BMIM] cation, with the decrease of the MeOH content in the mobile phase, k′ values were increasing in the range of 0.87–7.12 for 5–25% v/v of MeOH (Table S2 in the ESI†). Stronger adsorption was obtained for the imidazolium cation with a longer alkyl chain in its structure ([BMIM]), compared to [EMIM] cations (Table S2†). Based on these results it was demonstrated that ILs adsorb on stationary phase ligands, similarly to alkylamine IPRs in IPC mode. Therefore we have proved that increasing IL concentration in the mobile phase makes them IPRs suitable for ASOs. Such an effect is in the agreement with the results obtained by Berthod et al.,22 who conducted a frontal analysis for this purpose.
k′ ± SD | |||||
---|---|---|---|---|---|
[BMIM][Cl] | DMBACl | [EMIM][Cl] | TEACl | NaCl | |
OL1 | 70.715 ± 0.078 | 58.237 ± 0.036 | 45.074 ± 0.812 | 35.241 ± 0.191 | 31.115 ± 0.155 |
OL2 | 64.679 ± 0.191 | 52.554 ± 0.191 | 37.993 ± 0.024 | 30.405 ± 0.000 | 29.832 ± 0.036 |
OL3 | 59.658 ± 0.424 | 49.031 ± 0.078 | 31.528 ± 0.967 | 25.844 ± 0.133 | 20.250 ± 0.310 |
Surprisingly, ASO k′ values obtained for NaCl and TEACl are similar (Table 3). Such an effect may be the result of interactions between sodium cations and negatively charged ASOs, causing reduction of their charge. Consequently, increase of their affinity to the stationary phase occurred, resulting in retention improvement. However, ASO peaks obtained with NaCl used as mobile phase additive were much broader than in the case of mobile phase modified with the TEACl. This may be a consequence of increased role of hydrophobic interactions between ASOs and stationary phase, when IPR is added to the mobile phase, contrary to NaCl.
With increasing [HMIM][Cl] concentration, the resolution of MIX 1, 3, 4 also increased for all the tested stationary phases (Fig. 4). Moreover, an improvement in the shape and symmetry of ASO peaks was observed. Such tendencies were demonstrated by the asymmetry factors obtained for the analysis for both concentrations: in the case C18 for MIX1, asymmetry factors equaled 1.36, 1.43 and 1.26 for 7 mM of ILs, while for 10 mM these values were as follows: 0.81, 0.98 and 1.19 (Fig. 4A). For F5 and aQ stationary phases similar effects were observed regarding asymmetry factors. For the first packing material and 7 mM and 10 mM of ILs following asymmetry factors were noted: 1.59, 1.49, 1.49 and 1.01, 1.33, 1.23 (Fig. 4D), while for aQ one: 1.25, 1.17, 1.64 and 1.02, 0.90, 0.99 (Fig. 4G). This effect may be related to stronger adsorption of [HMIM][Cl] when higher concentration was applied. However, it may be also a result of the different gradient elution programs applied for 7 mM and 10 mM of MIX 1 (Fig. 4A). The same chromatographic parameters were used in the separation of MIX 3 and MIX 4 for C18 column and both IL concentrations. For higher [HMIM][Cl] concentration, an improvement of resolution for both ASO mixtures was noted.
Similar effects were observed for the F5 column, where the impact of concentration on resolution was observed in particular for MIX 3 (Fig. 4E). Coelution of metabolites was observed for 7 mM of [HMIM][Cl], while increasing concentration caused enhancement of separation efficiency (Fig. 4E). For the other mixtures (Fig. 4D and F) increasing IL concentration caused just elongation of analysis time, without affecting resolution.
In case of aQ column, the satisfactory resolution of ASOs was obtained only for MIX 1, contrary to MIX 3 and MIX 4 (Fig. 4G). MIX 1 is composed of ASOs which are built of 20, 17 and 13 nucleotides, whereas MIX 3 and MIX 4 contain 20-mer ASOs and their n − 1 and n − 2 synthetic metabolites (Table 1). Consequently, sequence differences are greater for MIX 1 components, which allows rapid separation. Increasing of the mobile phase flow rate for the 10 mM of [HMIM][Cl] allowed reduction of ASO k′ values (compared to lower IL concentration) without affecting their resolution. Regardless of the tested ILs concentration, separation of MIX 3 and MIX 4 was not satisfactory since coelution of shorter ASOs was observed (Fig. 4H and I). Such phenomenon may be related to insufficient selectivity of this stationary phase.
To summarize, the best resolution of tested mixtures was obtained for C18; however, for F5 the ASO mixture separation was also satisfactory, so both of them may be used in further studies.
It has to be pointed out, however, that the separation of MIX 2, consisting of ASOs differing by their sequence (Table 1) has been unsuccessful due to the coelution of the mixture components. Such an effect was observed regardless of the stationary phase used and [HMIM][Cl] concentration. This indicates that the developed method is not sufficiently selective with respect to positional isomers (MIX 2), because of small differences in their molecular masses and position of nucleotides (Table 1). Thus, they interact with the stationary phases with similar strength.
Liquid–liquid extraction with the phenol:
chloroform
:
isoamyl alcohol at the ratio 25
:
24
:
1 was used for ASO isolation from serum samples since it allows reducing of specific ASO affinity to plasma proteins. In order to remove phenol residue it was necessary to carry out an additional extraction step with the use of chloroform at the ratio of 3
:
1 to the supernatant.
Linearity of the method was established by calculating the determination coefficient (R2) for the calibration curve in the range of 8–20 μM (five different concentrations). Calibration curve was prepared by enriching of post-extracted diluted serum samples by an appropriate concentration of OL4. The obtained calibration curve (y = 2.3063x − 6.4301) was linear with R2 equal 0.9959; thus the developed method is characterized by acceptable linearity within the test range of concentrations. LOD of the method has been calculated using the following equation: , where SD is standard deviation of linear regression and b is a slope of the calibration line, while LOQ has been determined by triplicating of LOD value. LOD of the method equaled 1.74 μM, while LOQ value was 5.23 μM. The matrix effect was determined by comparison of the ASO peak area for a standard sample with the peak area of the same concentration of ASO in a serum sample enriched post-extraction and its equaled 14.8%. Recovery was also evaluated by comparison of the ASO concentration determined in enriched serum samples with concentration of ASO added to serum sample and its equaled 62.18% ± 0.37. It has to be pointed out that the developed method may be used for real ASO samples analysis; however, recovery value needs to be further improved.
The developed method was also applied for the determination of potential impurities formed during synthesis process of oligonucleotides. aQ stationary phase was used for this purpose. Application of gradient elution allowed for complete separation of OL1 from its impurity (Fig. 5B). Calibration curves were prepared by the subsequent dilution of the OL1 and OL2 mixture. The concentration range of OL2 was 2–15 μM, while for OL1 5–25 μM (five different concentrations). Linearity of the method was determined by determination of R2 coefficient, which equaled 0.9977 for OL1 and 0.9967 for OL2. Based on the calibration curves equations for OL1 (y = 1.4848x + 4.016) and OL2 (y = 0.724x + 0.918) concentration of these compounds was determined and it equaled 24.17 μM for OL1 and 8.89 μM for OL2. The developed method is suitable for separation and determination of sequence related impurities of oligonucleotides.
Another important factor which has an impact on the retention of ASOs is ILs cation size. The greatest ASO k values were obtained for [HMIM][Cl] with the longer alkyl ligand embedded in the imidazolium cation. This cation probably more effectively adsorbs on the stationary phase ligands, compared to the [BMIM] and [EMIM] ones, which leads to the enhancement of ASO retention. Moreover, for the larger imidazolium cation ([HMIM]), the improvement in ASO peak shapes was also noted.
The method of separation of synthetic metabolites was developed during the study involving mobile phases containing [HMIM][Cl] and methanol. However, it has to be pointed out that addition of [HMIM][Cl] to the mobile phase gives sufficient selectivity only for ASO with different lengths of the phosphate backbone, because separation of sequential isomers failed. Finally, ILs as the mobile phase additives were used in determination of ASOs in fortified serum extracts. The LOD and LOQ values of the developed method were as follows: 1.74 μM and 5.23 μM. Moreover, method was characterized by acceptable linearity at the concentration range 8–20 μM. However, the obtained recovery value needs to be increased further.
Footnote |
† Electronic supplementary information (ESI) available. See DOI: 10.1039/c9ra06483d |
This journal is © The Royal Society of Chemistry 2019 |