Xin-Guang Liu‡
,
Xu Lu‡,
Ji-Xin Wang,
Bin Wu,
Lin Lin,
Hui-Ying Wang,
Ru-Zhou Guo,
Ping Li
* and
Hua Yang*
State Key Laboratory of Natural Medicines, China Pharmaceutical University, No. 24 Tongjia Lane, Nanjing 210009, People's Republic of China. E-mail: liping2004@126.com; 104yang104@163.com
First published on 5th December 2017
Secondary metabolites play a pivotal role in plant physiology and medicinal function. Much work has been carried out to uncover the genetic basis of plant secondary metabolite variation, but direct screening of gene variation in the whole genome is extremely time- and labor-consuming. The prediction of a candidate locus of a single nucleotide polymorphism (SNP) will save much time and resource. In this work, we combined a paired analytical metabolomics and a common garden trial to bridge the association of plant metabolism and related gene variation of Ginkgo cultivated varieties. Firstly, the leaves of 30 cultivated varieties of Ginkgo biloba L. grown in the same garden since 1990 were analyzed by UHPLC-QQQ MS/MS. Thirty-six metabolites in the flavonoid biosynthetic pathway were quantified. The biosynthetic rate of flavonoids in different cultivated varieties could reflect the related enzyme gene variation, since the environmental influence was minimized. Thus, the role of SNPs in possible varied genes was further associated with flavonoid synthesis. Results showed that after long term environment and artificial influence, different accessions of G. biloba showed a varied ability in flavonoid aglycone synthesis due to some gene polymorphism; this difference may be heritable but not obvious. Compared with previous methods, this strategy is advantageous in accuracy, low sample requirement and easier operation, providing effective information in phenotype–genotype association, and it can also be used in the heritability study of artificial breeding before large-area introduction.
Direct screening of gene variation in the whole genome is extremely time- and labor-consuming. If evidence is available to predict the candidate locus of single nucleotide polymorphism (SNP), then we can use simpler methods like direct sequencing, Taqman makers or restriction fragment length polymorphism PCR to save time and resources.8,9 Metabolomics can reveal differently expressed metabolites which are reflective of plants grown in different environments or diseased.10,11 However, untargeted metabolomics may not provide detailed information for a concerned pathway due to non-individual optimized conditions. Metabolic flux analysis is an interesting tool to facilitate a better understanding of physiological processes. Isotopic enrichments of the metabolites are necessary to obtain metabolic flux, and this is an accurate way to map the overall cellular functions;12 however, this experiment is still hardly operative. Considering the matrix effect, few analyses were conducted for the quantification of plant metabolites, while in most cases, the matrix effect of a plant extract is much lower than in bio-samples. In addition, the matrix effect can also be minimized by using structurally similar internal standards, and with a paired analytical metabolomics that calculates and compares the ratio of product/substrate of the enzymes in a pathway, a mapping flux might also be conducted in an accurate and easy way.
In the present work, we proposed a reliable strategy to refine the application of metabolomics in a plant genome study; an overview of our scheme is shown in Fig. 1. This study carried out a common garden trial where target plants were grafted from different origins to minimize environmental influence. A “paired analysis” of targeted metabolomics, which comprehensively considers the conversion rate of each biosynthetic reaction in a pathway, was used to analyze the samples. The different cultivate varieties of G. biloba L. grafted from different origins since 1990 were selected as a case study of our experimental design. Thirty-six metabolites in the flavonoid biosynthesis pathway were profiled in each variety. Combining the proposed paired analytical strategy, metabolic flux and possible varied genes were predicted. Then the relationship between SNPs and flavonoid synthesis was further associated by partial least squares regression analysis and homology analysis. The results demonstrated that Ginkgo cultivate varieties could be divided into 3 clusters based on flavonoid synthesis ability and possible varied genes were predicted. Compared to a genome sequencing study, this method was accurate in method validation and has a low sample requirement, which proves that targeted metabolomics could also be applied as a convenient strategy in studies of plant physiology.
![]() | ||
Fig. 1 Scheme of the paired analytical metabolomics to bridge the association of metabolism and gene variation. |
Kaempferol-3-O-rutinoside (Kaem-3-RU), isorhamnetin 3-O-rutinoside (Isor-3-RU), quercetin (Quer), kaempferol (Kaem) and isorhamnetin (Isor) were purchased from Zelang Medical Technology Co. Ltd. (Nanjing, China). Dihydromyricetin (Dmyri), dihydrokaempferol (DKaem), naringenin (Nari), protocatechuic acid, chlorogenic acid, catechin, caffeic acid (CA), procyanidin B2, epicatechin, p-coumaric acid (p-Coum), ferulic acid, clitorin, (−)-epigallocatechin (EGC), (−)-gallocatechin gallate (GCG), (−)-epicatechin gallate (ECG), epigallocatechin-3-gallate (EGCG), isorhamnetin-3-O-glucoside (Isor-3-G), quercetin-3-O-glucoside (Quer-3-G), apigenin-7-O-glucoside (Apig-3-G), quercetin-3-O-rhamnoside (Quer-3-R), kaempferol-7-O-β-D-glucoside, myricetin (Myri), luteolin (Lute), apigenin (Apig), quercetin-3-O-β-D-glucopyranosyl-(1–2)-α-L-rhamnoside (QGR), quercetin 3-O-2′′-(6′′-p-coumaroyl)-glucosyl-rhamnoside (QRCG), kaempferol 3-O-2′′-(6′′-p-coumaroyl)-glucosyl-rhamnoside (KRCG) and hesperidin (IS) were purchased from MUST Bio-technology Co. Ltd. (Chengdu, China). Ginkgetin, isoginkgetin, bilobetin, amentoflavone, sciadopitysin, hydroxybenzoic acid (HA) were purchased from Biopurify Co. Ltd. (Chengdu, China). Rutin and andrographolide were purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). Syringetin was purchased from Extrasynthese (Genay Cedex, France). Dihydroquercetin (Dquer) was purchased from Phystandard bio-Tech Co., Ltd. (Shenzhen, China).
Metabolite | Retention time (min) | Precursor m/z | Product m/z | Q1 pre bias (V) | CE | Q3 pre bias (V) | |
---|---|---|---|---|---|---|---|
1 | (−)-Epigallocatechin | 1.52 | 305.1 | 125.0 | 14 | 23 | 23 |
2 | p-Hydroxybenzoic acid | 3.22 | 137.1 | 93.0 | 28 | 17 | 17 |
3 | Chlorogenic acid | 3.40 | 353.2 | 191.1 | 25 | 14 | 19 |
4 | Catechin | 3.49 | 289.2 | 245.0 | 20 | 14 | 26 |
5 | Caffeic acid | 4.53 | 179.1 | 134.1 | 12 | 25 | 25 |
6 | Procyanidin B2 | 5.03 | 577.1 | 407.1 | 20 | 24 | 28 |
7 | Epicatechin | 6.20 | 289.1 | 245.1 | 20 | 15 | 26 |
8 | Dihydromyricetin | 6.31 | 319.1 | 193.1 | 22 | 12 | 20 |
9 | p-Coumaric acid | 7.53 | 163.1 | 119.1 | 11 | 16 | 22 |
10 | Clitorin | 9.31 | 739.2 | 284.1 | 20 | 45 | 29 |
11 | Quercetin-3-O-rutinoside | 9.75 | 609.2 | 300.1 | 20 | 38 | 30 |
12 | Dihydroquercetin | 9.85 | 303.1 | 285.0 | 21 | 13 | 30 |
13 | Quercetin-3-O-β-D-glucoside | 10.12 | 463.1 | 300.1 | 10 | 27 | 20 |
14 | Quercetin-3-O-β-D-glucopyranosyl-(1–2)-α-L-rhamnoside | 10.73 | 609.2 | 300.1 | 20 | 37 | 30 |
15 | Kaempferol-3-O-rutinoside | 10.83 | 593.2 | 285.1 | 20 | 32 | 30 |
16 | Isorhamnetin-3-O-rutinoside | 11.04 | 623.2 | 315.1 | 20 | 31 | 21 |
17 | Quercetin-3-O-α-L-rhamnoside | 11.23 | 447.1 | 300.0 | 10 | 26 | 20 |
18 | Isorhamnetin-3-O-glucoside | 11.41 | 477.1 | 314.0 | 10 | 28 | 20 |
19 | Kaempferol-7-O-β-D-glucoside | 11.44 | 447.1 | 285.0 | 12 | 24 | 30 |
20 | Apigenin-7-O-D-glucoside | 11.47 | 431.1 | 268.0 | 10 | 32 | 28 |
21 | Dihydrokaempferol | 11.84 | 287.1 | 259.1 | 20 | 14 | 28 |
22 | Myricetin | 11.98 | 317.1 | 151.1 | 11 | 24 | 30 |
23 | Quercetin-3-O-α-L-rhamnopyranosyl-2′′-(6′′′-p-coumaroyl)-β-D-glucoside | 12.62 | 755.0 | 300.1 | 20 | 47 | 30 |
24 | Kaempferol-3-O-α-L-rhamnopyranosyl-2′′-(6′′′-p-coumaroyl)-β-D-glucoside | 13.47 | 739.2 | 284.1 | 20 | 47 | 30 |
25 | Luteolin | 14.31 | 285.1 | 133.1 | 10 | 33 | 24 |
26 | Quercetin | 14.38 | 301.1 | 151.0 | 10 | 21 | 28 |
27 | Apigenin | 16.20 | 269.0 | 117.1 | 12 | 34 | 22 |
28 | Naringenin | 16.26 | 271.1 | 151.1 | 19 | 18 | 29 |
29 | Kaempferol | 16.64 | 285.0 | 93.0 | 10 | 35 | 17 |
30 | Syringetin | 16.66 | 345.1 | 315.0 | 12 | 26 | 21 |
31 | Isorhamnetin | 16.87 | 315.1 | 300.0 | 10 | 20 | 13 |
32 | Amentoflavone | 18.18 | 537.1 | 375.1 | 20 | 32 | 25 |
33 | Bilobetin | 19.34 | 553.1 | 521.0 | 40 | 31 | 36 |
34 | Isoginkgetin | 21.51 | 565.1 | 533.1 | 20 | 28 | 38 |
35 | Ginkgetin | 21.87 | 567.2 | 535.1 | 20 | 29 | 38 |
36 | Sciadopitysin | 25.51 | 579.2 | 547.1 | 28 | 27 | 26 |
IS | Hesperidin | 11.68 | 609.1 | 301.1 | 22 | 25 | 20 |
The mobile phases were eluted at 0.5 mL min−1 with the gradient as follows: 0–5 min, 8–10% B; 5–15 min, 10–30% B; 15–20 min, 0–49% B; 20–23 min, 49% B; 23–25 min, 49–60% B; 25–26 min, 60–80% B; 26–28 min, 80% B; 28–30 min, 80–8% B; 30–32 min, 8% B. The injection volume was 2 μL. 36 metabolites in the flavonoid biosynthesis were quantified in this work. The analytical methods for all the compounds were validated for linearity, accuracy, precision, repeatability, stability and recovery. The data of regression equation and method validation were listed in Tables S2 and S3.†
FLS-ex1-for: 5′GGCAACTATCTTTGGAGTCGAG3′
FLS-ex1-rev: 5′GTCCATAGATCTGAAACAA3′
FLS-ex2-for: 5′AAATAAGCTACTGTCGGCGC3′
FLS-ex2-rev 5′TGTGCAGTGATCCATTTGTCA3′
FLS-ex3-for 5′CGTTCTGCACCGGAGTTTAG3′
FLS-ex3-rev 5′GTCTTGGCATTGTATAAGGGAGG3′
Amplification was carried out by two respective PCR programs (Bio-Rad, Hercules, CA, USA): FLS ex1 using 10 cycles of 95 °C for 30 s, 61 °C for 30 s, 72 °C for 30 s, and 32 cycles of 95 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s with a final extension at 72 °C for 5 min. FLS ex2, ex3, using 10 cycles of 95 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, and 32 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s with a final extension at 72 °C for 5 min. The PCR products were purified and sequenced by ABI 3730 (Majorbio, Shanghai, China) at GENEWIZ, Inc. (Beijing, China). The sequences were analyzed by SepManPro 7.1.
To reveal the relationship between SNPs and the GbFLS activity, a partial least squares regression (PLSR) method was conducted to calculate the coefficients between 14 SNPs and the relative ratios of dihydrokaempferol/kaempferol, dihydroquercetin/quercetin and dihydromyricetin/myricetin in 30 Ginkgo cultivated varieties (Minitab 17.1.0, Minitab Inc., USA). PLSR finds a linear regression model by projecting the predicted variables and the observable variables. In this model, the SNP locus with one amino acid was set as “0” in the model, whereas the SNP locus with two heterozygous amino acids was identified as “1”. The ratios of dihydrokaempferol/kaempferol, dihydroquercetin/quercetin and dihydromericetin/myricetin were chosen as the “response”.
Untargeted metabolomics usually provides a comprehensive identification of all the metabolites. It is limited in the sense that it is practically impossible to optimize the conditions for each metabolite. These include extraction solvents, solvents for redissolution and MS or NMR parameters. For instance, polar and non-polar compounds may not be extracted from tissues with the same solvent.
Thus, a target metabolomics method was chosen for the flavonoid biosynthesis study, and a total run of 32 min was carried out for quantitative analysis all 36 analytes. The method was well validated for each compound. As shown in Table S2,† each calibration curve was linear over the studied concentration ranges with satisfactory correlation coefficients (R2 > 0.99). The proposed method was sensitive with LOQs ranging from 0.001 to 16 ng mL−1 (Table S2†). Precision was evaluated using quality control solutions at three concentrations. The RSD values across the various concentrations were less than 13.97% for intra-day precision analysis while the inter-day precisions were less than 14.5%. The repeatability RSD values of all the compounds were less than 8.78%, indicating that the method was reliable and repeatable. The overall recoveries fell within the range of 85.15–113.38% after spiking high, middle and low amounts of analytes before extraction, with RSDs less than 6.69%.
Our strategy arouses several considerations to minimize the errors in metabolomics. Firstly, when a pathway is known to be significant for a plant physical or commercial value, targeted metabolomics is superior in accuracy to comprehensive metabolomics. In this work, 70% aqueous methanol was used to extract flavonoids of high polarity. MS data were acquired in the negative ion mode because flavonoids are easier to dehydrogenate, leading to higher responses in this mode. All the methods were strictly validated to ensure the quantitation for each metabolite was reliable, stable, repeatable and precise. Secondly, a self-controlled trial can provide a great improvement in credibility and reduce the necessary sample number. In disease or diagnostic metabolomics, a paired experimental design is more recommended than an unpaired comparison to reduce the sample amount required.19
The chromatograms of 36 flavonoids in G. biloba leaves are shown in Fig. 3A. In Fig. 3B, the results showed that flavonol glycosides and biflavonoids were the major compounds in all leaves, while few aglycones and organic acids were present. The individual level of flavonoids among Ginkgo accessions were also different, such as TM-2, TC231 and SNFS showed a higher content of flavonol glycosides such as rutin, while YZYX and GL-9 proved to have more biflavonoids.
![]() | ||
Fig. 3 (A) The chromatograms of 36 flavonoids of Ginkgo leaf samples in a multiple reactions monitoring mode. The numbers of the peaks are according to Table 1. (B) The concentrations of 36 flavonoid metabolites in 30 Ginkgo cultivated varieties. |
Fig. 4 shows individual levels and relative ratios of the flavonoids involved in the reactions catalyzed by FLS, OMT and FGlcT. It shows that the absolute amount of flavonoids is extremely varied among different samples (Fig. 4A–C), so it is difficult to find their internal relationship. However, as each flavonoid metabolite was formed by the catalysis of a certain enzyme, the conversion rate in a reaction may indirectly reflect the activity of a target enzyme. Fig. 4A shows the individual level of aglycones and their glycosides, and their relative ratios are presented in Fig. 4B. We can see inconsistencies with the two results, for example in Fig. 4A and B, a sample with a higher glycoside level may not always have a higher glycoside/aglycone ratio, accession 9 had a middle level of Kaem-7-G, but the ratio versus kaempferol was the highest, which indicated this accession may have a high ability to synthesize glycosides. In addition, some reactions, such as that catalyzed by FGlcT (Fig. 4A and B), FLS (Fig. 4C and D) and OMT (Fig. 4E and F), have more than one substitute; the paired analysis also indicated that when the ratio of different substitutes changed consistently, the activity or expression level of that enzyme may simply increase or decrease. If this change was different in a sample, we might predict that the selectivity of the substitute varied. The phenomenon may be similar to the turnover of neurotransmitters in some human diseases.20 Fig. 4E and F indicate that the selectivity on quercetin and myricetin of methyltransferase (OMT) was not changed in most samples, but the selectivity of FLS and FGlcT differed in many cases. Conventional metabolomics evaluate the compound level just based on the absolute concentration or response. However, a higher response of metabolite cannot result from the different enzyme catalytic abilities or further association with gene variation due to the individual plant differences. A systematic analysis of the conversion rate is necessary to find the relationship between metabolomics result and gene variation.
![]() | ||
Fig. 4 The nominated concentrations (A, C and E) and their relative ratios (B, D and F) of the flavonoids involved in the reactions catalyzed by FLS, OMT and FGlcT of 30 Ginkgo cultivated varieties. |
Strain | Cluster | Distance | Strain | Cluster | Distance |
---|---|---|---|---|---|
ZA-1 | 1 | 2.82 | CRBG | 2 | 14.31 |
ZA-2 | 2 | 5.64 | PXVBG | 1 | 2.19 |
ZA-3 | 1 | 3.62 | TC202 | 1 | 2.19 |
ZA-4 | 1 | 4.71 | TM-2 | 1 | 3.13 |
DLY | 2 | 4.86 | TM-3 | 1 | 1.32 |
YL-13 | 2 | 17.24 | TM-4 | 1 | 5.40 |
XYZ | 2 | 6.71 | DML | 1 | 2.69 |
XC-9 | 2 | 5.51 | GL-2 | 2 | 3.99 |
DFZ | 3 | 0.00 | GL-6 | 1 | 1.91 |
TX-1 | 1 | 3.59 | GL-9 | 2 | 6.80 |
TX-3 | 1 | 4.23 | TCML-1 | 2 | 6.72 |
TX-4 | 1 | 7.80 | TCML-2 | 1 | 3.09 |
SNFS | 2 | 6.99 | TAXI-1 | 1 | 3.61 |
TC231 | 1 | 8.55 | TAXI-2 | 1 | 4.94 |
DTFS | 2 | 5.41 | YZYX | 1 | 2.42 |
Cluster | |||
---|---|---|---|
1 | 2 | 3 | |
CA/p-Coum | 1.62 | 2.42 | 0.37 |
Dkaem/Nari | 3.77 | 3.91 | 2.54 |
Myri/Dmyri | 1.97 | 1.92 | 1.88 |
Kaem/Dkaem | 0.07 | 0.05 | 0.02 |
Quer/Dquer | 0.89 | 0.37 | 0.14 |
Isor/Quer | 0.77 | 0.74 | 0.00 |
Syri/Myri | 0.14 | 0.10 | 0.00 |
Apig-7-G/Apig | 3.50 | 7.27 | 14.47 |
Kaem-7-G/Kaem | 1.29 | 3.66 | 23.29 |
Isor-3-G/Isor | 2.39 | 8.39 | 0.00 |
Quer-3-G/Quer | 5.73 | 18.21 | 27.77 |
To define the central role of these amino acid substitutions, in Fig. 5, the GbFLS cDNA sequence was translated into an amino acid sequence and then aligned with Scutellaria Baicalensis FLS (SbFLS), Vitis Vinifera FLS (VvFLS), Citrus Unshiu FLS (CuFLS) and Arabidopsis thaliana FLS (AtFLS). GbFLS is highly homologous with described proteins. The structure of FLS is composed of a β jelly-roll fold surrounded by ten different length α-helix. The iron metal may ligate with a bidentate group of cosubstrate 2-oxoglutarate on 3 side-chain residues, H228, D230 and H282, which conserved all FLS proteins. Hydrogen bonds may form between the other side of 2OG with 3 conserved residues, Y211, R292 and S294. The substrate might locate near an iron metal ion, in the possible residues of H137, F139, K207, F298 and E300.26 These substrate and catalyzed residues may play a vital role in the function of GbFLS. From Fig. 5 we can see no SNPs occurred in these positions or neighboring alleles, which indicates that these gene variations might not heavily influence the enzyme function.
Actually, 12 of 14 SNPs were found in exon 1, which is far from the substrate and catalyzed residues of GbFLS in the exon 2 and exon 3 (this region is still conserved). However, some of those SNPs located in the α-helices of exon 1 might affect the GbFLS structure and activity, including F62/L62, E71/Q71, P85/S85, F97/V97, N169/K169 and R170/G170, so this indicated the probability of the enhancement or inhibition of enzyme activity in the formation of quercetin, kaempferol and isorhamnetin. The plot of the PLSR coefficient against predictors (14 SNPs, predictors 1–14, represent the 14 SNPs according to the order in Fig. 5) is shown in Fig. 6. No SNP showed extremely higher coefficients than others, which may be due to the absence of SNPs in the catalyzing or substrate binding allele.
![]() | ||
Fig. 6 The plot of PLS coefficient versus predictors of myricetin/dihydromyricetin (A), kaempferol/dihydrokaempferol (B) and quercetin/dihydroquercetion (C). The predictors 1–14 represent the SNPs among these cultivated varieties in order with Fig. 5. |
Among them, predictor 1, 10, 13 and 14 showed a relatively significant influence on the synthesis of myricetin and kaempferol, which represented the SNPs of I12/F12/S12, F97/V97, N169/K169 and R170/G170, respectively. Three of these SNPs located in an allele of the protein form α-helices, which may have a higher possibility to influence the structure and function of GbFLS. The results indicated the probability of an enhancement or inhibition of enzymes in the formation of quercetin, kaempferol and isorhamnetin. This may contribute to FLS displaying variable substrate preferences and loose catalytic activities. For instance, in Fig. 6, predictors 1 and 2, which correspond to the mutation from I12 to F12/S12 and C50 to F50, showed a positive influence at converting dihydrokaempferol to kaempferol and dihydromyricetin to myricetin, but negatively regulated the reaction of converting dihydroquercetin to quercetin. This mechanism may be similar to a number of mutations of C. unshiu FLS reported in in vitro studies.27 This FLS had a higher affinity for dihydrokaempferol than for dihydroquercetin. A functional FLS cloned from Z. mays also showed a different Km for converting dihydrokaempferol and dihydroquercetin.28
The FLS protein in the substrate binding residue is evolutionarily conserved, including the residue ligate with iron metal, 2-oxoglutarate and flavonoid. Mutations occurring in these alleles may significantly affect the function of GbFLS. A SNP in these residues can be used as a general marker in Ginkgo breeding for improving nutritional quality and in the formation of target flavonoids.29,30 In addition, technology, like genome-editing, can be performed based on these potential functional SNPs as a novel control for the precise alteration of native genomes.31,32 Genome-editing technology may be used to specifically edit a single nucleotide, resulting in the change of the evolutionarily conserved GbFLS proteins in Ginkgo cultivated varieties. This could then trigger functional flavonoid biosynthesis without any visible deleterious effect on plant performance.
Footnotes |
† Electronic supplementary information (ESI) available. See DOI: 10.1039/c7ra06229j |
‡ These authors contributed equally to this work. |
This journal is © The Royal Society of Chemistry 2017 |