DOI:
10.1039/C6RA00153J
(Paper)
RSC Adv., 2016,
6, 34841-34848
Enhancement of the performance of constructed wetlands for wastewater treatment in winter: the effect of Tubifex tubifex
Received
4th January 2016
, Accepted 29th March 2016
First published on 31st March 2016
Abstract
Constructed wetlands (CWs) have recently been studied as a promising technology to achieve nutrient removal. However, the sustainable operation of CWs has shown low-efficiency wastewater treatment in winter. This study presented an improved constructed wetland (CW) with the addition of Tubifex tubifex in winter using laboratory batch systems. It was found that the reduction of nitrate (NO3–N) was significantly enhanced in wastewater in which water celery (Oenanthe javanica (Blume) DC) and Tubifex tubifex coexisted, with a removal efficiency of up to 97.58%. This system could also achieve high removal efficiencies for total nitrogen (TN, 85.10%) and ammonium nitrogen (NH4–N, 56.93%) associated with sediment stored. The organic carbon in both the wastewater and sediment was higher with the effect of Tubifex tubifex on mineralization, which could provide a carbon source sufficient for biological denitrification. The bioturbation by Tubifex tubifex could greatly stimulate the absolute abundance of anaerobic microbes. The outcomes of this study indicate that the potential utility of Tubifex tubifex could improve the ecosystem and water purification by CWs in winter.
1. Introduction
Constructed wetlands (CWs), as a promising technology for treating wastewater, have been widely used in multiple wastewater treatment and nutrient management.1 Wastewater treatment using CWs is efficient, and has a lower cost, fewer operation and maintenance requirements. CWs could achieve removal of nutrients and organics in biological, chemical and physical processes.2 Biological processes are significantly dependent on the temperature conditions as a crucial influencing factor. The operation of CWs in a cold climate has been perceived as a challenge associated with the withering of plants, reduction of microbial activity, and lower contamination treatment.3,4 Therefore, selecting low-cost and efficient alternative technologies for CW operations in winter requires further study and enhancement.
Much advancement has been made in contaminant removal by CWs under low temperature conditions through specific design changes, such as a deeper substrate and the two-stage subsurface vertical flow systems.5 The wetland configuration with natural or artificial insulation was also adapted to prevent a freezing environment, such as construction under a greenhouse and the use of various insulation materials. However, these methods were rather expensive. Further investigations for improving the sustainability of CWs during seasonal temperature changes are highlighted here.
Information on contaminant filtration in aquatic organisms, however limited, has proven the potential functional mechanism of bioaccumulation and biotransformation.6 However, animals are rarely considered for wastewater treatment in CWs. Tubifex tubifex, a kind of oligochaete, has become widely distributed in many aquatic environments, even in low oxygen conditions.7 In addition, this species can also remain alive in cold temperatures while maintaining a high activity.8 It lives submerged in sediment, using the anterior section for predation and the tail of the posterior section for respiration.9 Tubifex tubifex can be a major consumer of nutrients and phytoplankton through accumulation in the gut or settling as faecal pellets in eutrophic lakes. Compared to other strategies of CW development, the predation of Tubifex tubifex can directly remove contaminants as an ecological and economical process. Its faeces are good plant fertilizer and protein for other organisms, also a sufficient carbon source for denitrification. Furthermore, sediment metabolism and microbial communities were also stimulated due to its bioturbation activity.10 Thus, Tubifex tubifex has profound ecological effects on energy and biomass transformation in ecosystem.11 Given the potentially massive effects of purification by Tubifex tubifex and its cold-resistance capacity, this organism may ultimately result in the improved treatment performance of CWs in winter.
The main objectives of this study are as follows: (1) to improve the performance of CW ecosystems in winter with the addition of Tubifex tubifex, as well as consider a possible application for improving wastewater treatment; (2) to evaluate the effect of Tubifex tubifex on the removal of pollutants from wastewater and sediment; and (3) to analyse the effectiveness of Tubifex tubifex on microbial abundance.
2. Materials and methods
2.1 Plant and Tubifex tubifex preparation
Water celery (Oenanthe javanica (Blume) DC) is a hygrophyte that can grow in winter and was therefore selected for laboratory-scale CWs.12 Sprouted O. javanica plants with a height of 20 cm used in this study were collected from the natural wetlands of Nansi Lake, Shandong Province, China. Before being planted, young plants were gently washed with tap water to remove adhering soil and dead plant tissues. After being planted into laboratory-scale surface-flow constructed wetland systems (SFCWs) in September with a density of 35 rhizomes per m2, the O. javanica was acclimatized with water initially at a shallow depth (0.1 m). Then it was cultivated using Hoagland nutrient solution (10%) for almost 1 month to allow establishment of the vegetation and bio-film.13
The length of the Tubifex tubifex used in this experiment varied but had an average length of 15 to 20 mm. They were purchased in a local market. Prior to experimental use, the Tubifex tubifex were cultivated in synthetic freshwater for at least 1 week in the laboratory with the dissolved oxygen concentration maintained at more than 6 mg L−1. Before being inoculated into the CWs, the Tubifex tubifex were washed off, and the water was adsorbed by filter paper. The density of Tubifex tubifex in the experiment units were 12
800 to 13
000 individuals per m2, which corresponds to the density ranges observed in natural aquatic environments.14 Once introduced into the CWs, the Tubifex tubifex organisms immediately dig into the sediment.
2.2 Laboratory-scale constructed wetlands setup
Wetland microcosms were located in the School of Environmental Science and Engineering, Shandong University. Nine polyethylene barrels (30 cm in inner diameter, 40 cm in height) were used to build SFCWs. As shown in Fig. 1, each microcosm was filled with three layers of substrate. The bottom layer was washed gravel at a depth of approximately 5 cm to avoid clogging when draining the water. The upper layer was filled with washed sand (<2 mm, mainly SiO2, Al2O3, and Fe2O3) with a depth of 10 cm to promote rooting for O. javanica. To provide a suitable habitat for Tubifex tubifex, the uppermost layer was made up of sediment with a depth of 5 cm, which was obtained from Nansi Lake, Shandong Province, China. All the microcosms had an inlet in the top and an outlet at the bottom in order to discharge the wastewater after each cycle. In the central of the microcosm, a vertical perforated PVC pipe with holes (25 cm in length and 3 cm in diameter) was inserted into the bottom to measure various physical and chemical parameters, such as temperature and dissolved oxygen (DO).
 |
| | Fig. 1 Profile of the lab-scale CW microcosms. | |
To evaluate the effect of Tubifex tubifex, the CW microcosms were divided into three groups. Group T–P had both plantings of O. javanica and the addition of Tubifex tubifex, Group P and Group T contained only plants or Tubifex tubifex, respectively. There were three replicates of each group (n = 3).
2.3 Experimental procedure
The experiment was performed from September to the following February with the ambient temperature ranging from 1 to 6 °C in Jinan, which is located in the north of China. Synthetic wastewater was designed and utilized to simulate the characteristics of real wastewater based on Chinese environmental quality standards for different grades of surface water.15 The sequencing fill-and-draw batch mode was applied in this study. Microcosms were saturated with synthetic wastewater from the inlet for treatment and drained from the outlet after each experimental cycle, then immediately refilled for the next cycle. Influent wastewater was prepared with tap water in a storage tank (100 L). To imitate polluted water, the composition of synthetic wastewater was as follows (per litre): sucrose 51.35 mg, (NH4)2SO4 37.60 mg, KH2PO4 7.00 mg, and KNO3 76.57 mg. Some micronutrients such as Ca, Mg, S, Fe, Zn, Cu, Mn, B, and Mo were also added for normal growth and cultivation of the plants, which were obtained from 5 mM Ca(NO3)2, 2 mM MgSO4, 10 μM MnSO4, 50 μM H3BO3, 0.7 μM ZnSO4, 0.2 μM CuSO4, 0.01 μM (NH4)6Mo7O24, and 70 μM Fe–EDTA–Na2.16 The characteristics of the influent water were as follows: chemical oxygen demand (COD) 60.30 ± 0.37 mg L−1, nitrate nitrogen (NO3–N) 18.01 ± 0.37 mg L−1, ammonium nitrogen (NH4–N) 5.59 ± 0.30 mg L−1, total nitrogen (TN) 24.64 ± 0.20 mg L−1, and total phosphorus (TP) 1.20 ± 0.30 mg L−1. When filled, each system held 10 L of wastewater to a depth of 15 cm above the media. To keep the water depth constant, distilled water was added to each system every day to compensate for the evapotranspiration loss during the experiment. After 2 months of operation, the CWs showed good performance, and the treated contaminant concentration tended to be stable. All the chemicals used were analytical reagent grade and were purchased from the Shanghai Guoyao Chemical Reagent Company Ltd. (Shanghai, China).
The hydraulic retention time (HRT) of each CW was 13 days due to the low temperature, which corresponded to a hydraulic loading rate (HLR) of 1.1 cm per day.
2.4 Sampling and sample analyse
Water samples were collected in the overlying water using polyethylene bottles (100 mL) for chemical analyses. Water temperature and DO were determined in situ with a DO metre (HQ30d, Hach, USA). Parameters such as NO3–N, NO2–N, NH4–N, TN, COD and TP were determined in the laboratory according to standard methods after being filtered through a 0.45 μm cellulose acetate membrane filter by applying manual pressure to a syringe.17
The initial and final sediment samples were collected in each microcosm during the experiment. To obtain a representative sample for each system, sediment samples were taken from the 0–5 cm depth at the same height, and five individual samples of equal mass were homogenized. After collection, the sediment samples were dried at −60 °C using a freeze dryer (Unicryo MC 2 L freeze dryer, Germany) for 36 h, then sieved (0.2 mm) and stored at −20 °C until used for other analyses. The nitrogen fractions stored in the sediment were analysed in 1 N KCl 1
:
10 extracts of the soils, then determined by distillation for NH4–N and colorimetric analysis for NO3–N following the recommendations of the U.S. Environmental Protection Agency (EPA) Method 352.1. Prior to the analysis of the carbon content in the sediment, inorganic carbon was removed with HCl. The sediment organic carbon (SOC) was analysed in 0.01 N CaCl2 1
:
5 extracts of the soil by means of a Multi N/C 3100 analyser.18
2.5 Microbial analyse
The DNA was extracted from sediment samples (0.5 g dry weight) using a MOBIO PowerSand™ DNA Isolation Kit (USA). The DNA yields were measured using a NanoDrop ND-1000 UV-vis spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The absolute abundance of 16S rRNA and different functional genes such as ammonia monooxygenase (amoA), nitrite oxidoreductase (nxrA), anammox 16S rRNA (amx), nrfA (present in diverse groups of bacteria including Proteobacteria, Planctomycetes, Bacteroides, and Firmicutes) and denitrifying bacteria such as copper-containing nitrite reductase (nirK), cd1-containing nitrite reductase (nirS) were quantified by the quantitative polymerase chain reaction (qPCR) assay with Roche LC-480 (USA) using specific primers (Table 1).19–25 The reaction mixtures (20 μL) contained primers ((8 × 10−6) μM for each), SYBR Green Mix (10 μL, Roche), and the template DNA (2 μL). RNase-free water was also used to balance the systems. The qPCR data were measured using a LightCycler® 480 II (Roche, America). After the quantification cycles, the final qPCR was generated using the installed Abs Quant/2nd Derivative Max on a Roche LC-480.
Table 1 Primers of target genes used in qPCR analysis
| Target gene |
Process |
Primer |
Primer sequence (5′-3′) |
Amplification size (bp) |
Reference |
| Bacterial 16S rRNA |
|
338F |
ACTCCTACGGGAGGCAGCAG |
180 |
15 |
| 518R |
ATTACCGCGGCTGCTGG |
| Anammox 16S rRNA |
Anammox |
AMX809F |
GCCGTAAACGATGGGCACT |
257 |
16 |
| AMX1066R |
AACGTCTCACGACACGAGCTG |
| amoA |
Nitrification |
amo598f |
GAATATGTTCGCCTGATTG |
120 |
17 |
| amo718r |
CAAAGTACCACCATACGCAG |
| nxrA |
Nitrification |
F1norA |
CAGACCGACGTGTGCGAAAG |
322 |
18 |
| R1norA |
TCYACAAGGAACGGAAGGTC |
| nrfA |
Dissimilatory nitrate reduction to ammonium (DNRA) |
nrfAF2aw |
CARTGYCAYGTBGARTA |
235 |
19 |
| nrfAR1 |
TWNGGCATRTGRCARTC |
| nirK |
Denitrification |
nirK583F |
TCA TGGTGCTGCCGCGKGACGG |
326 |
20 |
| nirK909R |
GAA CTTGCCGGTKGCCCAGAC |
| nirS |
Denitrification |
nirScd3aF |
GT(C/G)AACGT(C/G)AAGGA(A/G)AC(C/G)GG |
425 |
21 |
| nirSR3cd |
GA(C/G)TTCGG(A/G)TG(C/G)GTCTTGA |
2.6 Statistics analyse
Measurements for each group were performed in triplicate with the results expressed as the mean ± standard deviation. The program SPSS 19.0 (SPSS, Chicago, USA) was used to perform all the statistical analyses, and an analysis of variance (ANOVA) was used to test the significance of the results. The results were considered to be statistically significant when p < 0.05. Standard deviations of three replicates were indicated by error bars. Invisible error bars indicated that the standard deviations were smaller than the marker size.
3. Results and discussion
3.1 Effect of Tubifex tubifex on wastewater purification
The data obtained from the DO concentration test in the water–sediment interface for each microcosm are shown in Table 2. The results show that the DO concentration was highest in Group P, followed by Group T–P and then Group T. The reduction of DO concentration for Tubifex tubifex was mainly due to its respiration and enhanced bioturbation activities in winter, which could increase the oxygen consumption.26 Meanwhile, the oxygen present was further consumed by the oxidation of the high organic content stored in the faecal pellets produced by Tubifex tubifex.27
Table 2 Tested DO and temperature in water–sediment interface of constructed wetland systems
| Group |
Group T–P |
Group P |
Group T |
| DO (mg L−1) |
4.35 ± 0.44 |
7.54 ± 0.12 |
3.56 ± 0.02 |
| Temperature (°C) |
2.10 ± 0.16 |
1.97 ± 0.05 |
2.13 ± 0.17 |
In the tested CW systems, as shown in Fig. 2a, the addition of Tubifex tubifex showed a remarkable effect on nitrogen removal. The TN removal rate for Group P was only 65.59% due to the poor adsorption capacity of the hydrophyte in winter. However, the final TN concentration of Group T–P was less than 3.68 mg L−1, with removal efficiency up to 85.10%, which was 22.92% higher than that of Group P. Group T showed the same tendency, with 12.43% higher removal efficiency than Group P. It showed good nitrogen removal performance by Tubifex tubifex due to its uptake and transformation. The nitrogen in the wastewater was digested by the worms, and efficiently used for new biomass formation.28 A comparison of nitrogen transformation among the groups is shown in Fig. 2b to provide insight into the mechanism of nitrogen removal. The concentrations of NH4–N, NO3–N, and NO2–N varied greatly in the different groups during the experiment. In the presence of Tubifex tubifex, NH4–N was the main form of nitrogen, with negligible NO3–N. Tubifex tubifex could ingest inorganic nutrients from the overlying wastewater, especially NO3–N. Then, the NO3–N was transported through its gut and extracted as NH4–N. Unlike Group T–P and Group T, the major form of nitrogen in Group P was NO3–N. Lower NO2–N and NH4–N concentrations were found in Group P, which might be due to the improved nitrification process in the microcosms with a greater oxidizing condition. Phosphorus was also a key factor for the removal of pollutants. The dynamics of the influent and final TP concentration in each group are illustrated in Fig. 2c. As Fig. 2c shows, the phosphorus concentrations in the different groups are not significantly different (p > 0.05). However, Group P has only a little higher phosphorus concentration than that of the other two groups. The main removal mechanism for phosphorus was plant uptake and substrate adsorption, but the assimilation effect was reduced by the low biological activity in winter.29 However, with the addition of Tubifex tubifex, bioturbation and the galleries created thereby increased the contact between orthophosphate and metal ions (such as Fe and Ca) in the water–sediment interface, which could accelerate the deposition of phosphorus onto sediment and thus its removal from wastewater.
 |
| | Fig. 2 Treatment performance of TN, TP and COD in overlying wastewater: (a) TN concentration; (b) dynamic transformations of nitrogen; (c) TP concentration; (d) COD concentration. | |
The carbon source required for denitrification is normally insufficient in CWs. In contrast, nitrate-contaminated wastewaters do not usually have sufficient labile carbon for denitrification.30 As shown in Fig. 2d, Group T–P has the highest COD concentration of 26.14 mg L−1, followed by Group T and Group P with a final treated concentration of 24.00 mg L−1 and 23.32 mg L−1 (p > 0.05), respectively. COD releases are associated with the faecal pellets by Tubifex tubifex and anaerobic degradation of organic matter.31 Tubifex tubifex competed with bacteria for labile organic carbon, thus its metabolism could decrease anaerobic respiration and mineralization processes, with lower degradation of COD. A higher COD concentration for Tubifex tubifex contributed to the enhanced reduction of NO3–N by the denitrification process.
To determine the biological nutrient removal performance, concentrations of NO3–N and NH4–N were also determined in Fig. 3. In the CWs, as shown in Fig. 3a, the NO3–N concentration dropped quickly before the 6th day, then decreased slowly to the final concentration. The measured peak concentration of NO3–N was found in Group P, with a final treated concentration of 7.66 mg L−1 and a removal efficiency of 57.70%. Microcosms with Tubifex tubifex achieved a much higher NO3–N removal efficiency than that of Group P (p < 0.05), with a final treated concentration of 0.43 and 1.06 mg L−1 for Group T–P and Group T, respectively. The removal efficiencies for Group T–P and Group T were as great as 97.58% and 94.10%, which were 40.87% and 38.68% higher than that of Group P, respectively. This enhanced treatment performance on NO3–N removal with Tubifex tubifex was ascribed to the microbial process. The lower DO concentration and an adequate carbon source produced by Tubifex tubifex contributed to enhanced biological denitrification, with NO3–N transformed into nitrogen gas. Meanwhile, the ingestion and extraction was also largely associated with decreases in NO3–N, which is attributed to releases of NH4–N. As shown in Fig. 3b, during 13 days' retention, the supernatant NH4–N concentration decreased to 0.15 mg L−1 in Group P, with a removal efficiency of 97.24%. The final treated NH4–N concentrations for Group T–P and Group T were 2.44 mg L−1 and 3.63 mg L−1, respectively, corresponding to the removal rates of 56.93% and 34.83%. The unexpected NH4–N concentrations were largely due to its extraction of Tubifex tubifex in terms of metabolite and mineralization products after ingesting inorganic nutrients.28 The lower DO concentration was also associated with insufficient nitrification by Group T–P and Group T, with a lower amount of NH4–N transformed to NO3–N.
 |
| | Fig. 3 Treatment performances of NO3–N and NH4–N in overlying wastewater: (a) NO3–N concentration; (b) NH4–N concentration. | |
3.2 Effect of Tubifex tubifex on nitrogen and organic carbon content stored in sediment
In CWs, the adsorption of organic and inorganic matter onto the sediment is believed to be one of the primary mechanisms for the removal of pollutants. In contrast, pollutants in the substrate are taken up by the plant roots or degraded in a microbial process and then removed from the CWs by subsequent harvesting of plant biomass. Nitrogen accumulated in the sediment of CWs was determined and estimated as shown in Fig. 4a. At the end of the experiment, the removal efficiency of nitrogen was as great as 31.49%, 62.60% and 24.76% for Group T–P, Group P and Group T, respectively. These results indicate that the stored nitrogen contents in Group T–P and Group T were higher than that of Group P (p > 0.05). The bioturbation and galleries dug in the superficial sediment layer by Tubifex tubifex could promote the transfer of nitrogen from the wastewater to the sediment.32 Meanwhile, the adsorption of faecal pellets at the sediment surface could also increase nutrient scavenging into the substrate.8 It was also found that the inorganic nitrogen left in the sediment consisted of a mixture of NH4–N and NO3–N. The NO3–N content stored in the sediment was also a little higher with Tubifex tubifex (p > 0.05). The anaerobic production of NO3–N has been observed here due to the lower oxygen level with Tubifex tubifex, as observed in modern sediments.8 Meanwhile, a higher NH4–N content was detected for Tubifex tubifex because of its metabolism. The ingested contaminants from sediment solids and wastewater by Tubifex tubifex could be extracted from faecal pellets as NH4–N, and deposited in the superficial sediment. In addition, the mineralization production from the sediment digested by Tubifex tubifex could also contribute to NH4–N accumulation.28
 |
| | Fig. 4 Contents of nitrogen and organic carbon in sediment: (a) nitrogen; (b) organic carbon. | |
As the main factor for denitrification, the organic carbon content stored in the sediment for each microcosm was also determined as shown in Fig. 4b. Similar to nitrogen, the content of organic carbon stored in Group P was lower than that with Tubifex tubifex (p > 0.05). Due to the bioturbation of Tubifex tubifex, organic materials available for bacteria are redistributed in the sediment.8 Meanwhile, the pathways, rates and extent of organic matter mineralization were also strongly influenced by Tubifex tubifex during the experiments. Due to the respiration rates of Tubifex tubifex, the process of organic carbon being metabolized to CO2 and H2O was limited, with NH4–N and NO3–N as major electron conveyors.33 The higher organic carbon content in Group T–P compared with Group T was attributed to the effect of O. javanica. Plants could accumulate carbon through root exudates or the degradation of cellulose into available organic carbon.34 Thus, the coexistence of plants and Tubifex tubifex could promote the denitrification process by providing an adequate carbon source.
Furthermore, the sediment volume in Group T–P and Group T had a mean reduction from 3.53 L to 3.20 L and 3.24 L during the experiment because of the ingestion of sediment by Tubifex tubifex. This sediment reduction was another reason for the higher nutrient content accumulated with Tubifex tubifex. The contaminants stored in the reduced volume of sediment would be transferred to the parts remaining after transformation by Tubifex tubifex. Meanwhile, the bioturbation of Tubifex tubifex could avoid substrate clogging in CWs.
3.3 Effect of Tubifex tubifex on microbial communities
The microbial process has been determined to be an important pathway contributing to nitrogen removal.35 However, microbial activities are mostly constrained by low temperature conditions.30 The absolute abundances of bacterial 16S rRNA, amx, amoA, nxrA, nirK, nirS and nrfA genes for each microcosm were quantified after the experiment to determine their dynamic populations. As shown in Fig. 5a, the absolute abundances of bacterial 16S rRNA was a little higher with Tubifex tubifex due to its stimulation of microbial communities through bioturbation (p > 0.05). However, amoA genes with Tubifex tubifex showed a lower abundance due to the consumption of oxygen (Fig. 5b), which was attributed to a lower NH4–N removal efficiency. The nxrA gene was also lower in Group T–P and Group T associated with the amoA gene, because the nxrA gene was dependent on the NO2–N produced from the oxidation of the required NH4–N performed by the amoA gene (Fig. 5b). Researchers have shown that a NO3–N loss occurred through denitrification and dissimilatory nitrate reduction to ammonium (DNRA).27 After its transformation from NO3–N to NH4–N via DNRA, the higher nrfA gene for Tubifex tubifex promoted a reduction in the NO3–N concentration but with an increased NH4–N concentration (Fig. 5c). The higher amx gene was also detected with Tubifex tubifex, which was mainly due to the higher COD concentration, according to the positive impact of an adequate carbon source on the amx activity.36
 |
| | Fig. 5 Dynamic populations of nitrogen functional genes in each microcosm: (a) bacteria 16S rRNA; (b) nitrification bacteria; (c) nrfA and amx genes; (d) denitrification bacteria. | |
Despite the negative influence that was found on nitrification bacteria, Tubifex tubifex markedly enhanced the abundance of denitrification bacteria in the sediment. Two denitrifying genes nirK and nirS are summarized in Fig. 5d. These two genes exhibited an increase associated with the enhanced denitrifying activity responsible for eliminating the NO3–N concentration. Microbes ingested by Tubifex tubifex could not be digested and continue survival during passage through the gut. The gut interior of Tubifex tubifex may maintain metabolic pathways in an anaerobic microenvironment. Meanwhile, the microbes that generally exist in an aerobic environment may experience a shift to anaerobic conditions through ingestion by Tubifex tubifex, which could also induce denitrification activity.37
In particular, bioturbation activities by Tubifex tubifex greatly stimulated anaerobic microbial activity, including nrfA, amx, nirS and nirK. The reduced nitrification bacteria might be unfavourable for NH4–N removal. However, there were no significant differences in these microbes for each group (p > 0.05). Thus, the nitrogen transformation for Group T–P and Group T was mainly due to the digestion and extraction by Tubifex tubifex.
4. Conclusion
This study found that Tubifex tubifex could retain its activity in winter with a high removal efficiency of TN and NO3–N. However, the NH4–N diffusive flux or absorption onto sediment was increased with Tubifex tubifex due to its direct extraction, resulting in greater NH4–N production in the water column. No significant difference was observed in COD and TP concentrations for each microcosm. In contrast the organic carbon both in the wastewater and stored in the sediment with Tubifex tubifex was a little higher due to its faecal pellets and influence on mineralization. Thus, NO3–N removal was further enhanced by a lower DO concentration and an adequate carbon source with the addition of Tubifex tubifex.
Further study indicated that Tubifex tubifex could improve microbial communities. The bioturbation activity of Tubifex tubifex could stimulate the microbial processes that are important for nitrogen transformation favourably towards denitrification. From an economic perspective, Tubifex tubifex could be used to improve the ecosystem and water quality of CWs in winter.
Acknowledgements
This work was supported by the National Science Foundation of China (21007032 and 21307078), National Water Special Project (2012ZX07203-004) and the Independent Innovation Foundation of Shandong University (2014JC023).
References
- J. Vymazal, Eco Eng, 2009, 35, 1–17 CrossRef.
- A. Sani, M. Scholz and L. Bouillon, Bioresour. Technol., 2013, 147, 585–596 CrossRef CAS PubMed.
- D. Huett, S. Morris, G. Smith and N. Hunt, Water Res., 2005, 39, 3259–3272 CrossRef CAS PubMed.
- P. Kuschk, A. Wiessner, U. Kappelmeyer, E. Weissbrodt, M. Kästner and U. Stottmeister, Water Res., 2003, 37, 4236–4242 CrossRef CAS PubMed.
- G. Langergraber, K. Leroch, A. Pressl, K. Sleytr, R. Rohrhofer and R. Haberl, Desalination, 2009, 246, 55–68 CrossRef CAS.
- S. Gifford, R. H. Dunstan, W. O'Connor, C. E. Koller and G. R. MacFarlane, Trends Biotechnol., 2007, 25, 60–65 CrossRef CAS PubMed.
- Y. Y. Mosleh, S. Paris-Palacios, M. T. Ahmed, F. Mahmoud, M. Osman and S. Biagianti-Risbourg, Chemosphere, 2007, 67, 167–175 CrossRef CAS PubMed.
- P. Anschutz, A. Ciutat, P. Lecroart, M. Gérino and A. Boudou, Aquat. Geochem., 2012, 18, 475–497 CrossRef CAS.
- S. Lagauzère, P. Boyer, G. Stora and J.-M. Bonzom, Chemosphere, 2009, 76, 324–334 CrossRef PubMed.
- S. Navel, F. Mermillod-Blondin, B. Montuelle, E. Chauvet and P. Marmonier, Oikos, 2012, 121, 1134–1144 CrossRef.
- Y. Wu, P. G. Kerr, Z. Hu and L. Yang, Bioresour. Technol., 2010, 101, 3903–3908 CrossRef CAS PubMed.
- S. Zheng, Z. Yang and M. Sun, Desalination, 2010, 250, 158–161 CrossRef CAS.
- C. Zhao, H. Xie, J. Xu, X. Xu, J. Zhang, Z. Hu, C. Liu, S. Liang, Q. Wang and J. Wang, Sci. Total Environ., 2015, 505, 633–639 CrossRef CAS PubMed.
- F. Mermillod-Blondin, A. Foulquier, F. Gilbert, S. Navel, B. Montuelle, F. Bellvert, G. Comte, V. Grossi, F. Fourel and C. Lécuyer, Sci. Total Environ., 2013, 450, 230–241 CrossRef PubMed.
- E. China, MEP, China, GB3838–2002, 2002.
- Z. J. Liu, Y. K. Guo and J. G. Bai, J. Plant Growth Regul., 2010, 29, 171–183 CrossRef.
- A. P. H. Association, A. W. W. Association, W. P. C. Federation and W. E. Federation, Standard methods for the examination of water and wastewater, American Public Health Association., 1915 Search PubMed.
- N. Roig, J. Sierra, E. Martí, M. Nadal, M. Schuhmacher and J. L. Domingo, Agric., Ecosyst. Environ., 2012, 158, 41–48 CrossRef.
- G. Muyzer, E. C. De Waal and A. G. Uitterlinden, Appl. Environ. Microbiol., 1993, 59, 695–700 CAS.
- I. Tsushima, T. Kindaichi and S. Okabe, Water Res., 2007, 41, 785–794 CrossRef CAS PubMed.
- H. M. Dionisi, A. C. Layton, G. Harms, I. R. Gregory, K. G. Robinson and G. S. Sayler, Appl. Environ. Microbiol., 2002, 68, 245–253 CrossRef CAS PubMed.
- F. Poly, S. Wertz, E. Brothier and V. Degrange, FEMS Microbiol. Ecol., 2008, 63, 132–140 CrossRef CAS PubMed.
- A. Welsh, J. C. Chee-Sanford, L. M. Connor, F. E. Löffler and R. A. Sanford, Appl. Environ. Microbiol., 2014, 80, 2110–2119 CrossRef PubMed.
- X. Liu, S. M. Tiquia, G. Holguin, L. Wu, S. C. Nold, A. H. Devol, K. Luo, A. V. Palumbo, J. M. Tiedje and J. Zhou, Appl. Environ. Microbiol., 2003, 69, 3549–3560 CrossRef CAS PubMed.
- E. Kandeler, K. Deiglmayr, D. Tscherko, D. Bru and L. Philippot, Appl. Environ. Microbiol., 2006, 72, 5957–5962 CrossRef CAS PubMed.
- Y. Tian and Y. Lu, Water Res., 2010, 44, 6031–6040 CrossRef CAS PubMed.
- G. Nogaro and A. J. Burgin, Biogeochemistry, 2014, 120, 279–294 CrossRef CAS.
- T. Hendrickx, H. Temmink, H. Elissen and C. Buisman, J. Hazard. Mater., 2010, 177, 633–638 CrossRef CAS PubMed.
- C. Arias, M. Del Bubba and H. Brix, Water Res., 2001, 35, 1159–1168 CrossRef CAS PubMed.
- S. Wu, P. Kuschk, H. Brix, J. Vymazal and R. Dong, Water Res., 2014, 57, 40–55 CrossRef CAS PubMed.
- G. Nogaro and F. Mermillod-Blondin, Environ. Sci. Technol., 2009, 43, 3632–3638 CrossRef CAS PubMed.
- F. Mermillod-Blondin, G. Nogaro, F. Vallier and J. Gibert, Chemosphere, 2008, 72, 213–223 CrossRef CAS PubMed.
- Y. Tian, Y. Lu and Z. Li, Bioresour. Technol., 2012, 121, 176–182 CrossRef CAS PubMed.
- Y. Chen, Y. Wen, J. Zhou, Z. Tang, L. Li, Q. Zhou and J. Vymazal, Water Res., 2014, 59, 1–10 CrossRef CAS PubMed.
- W. Zhi, L. Yuan, G. Ji and C. He, Environ. Sci. Technol., 2015, 49, 4575–4583 CrossRef CAS PubMed.
- J. Yang, L. Zhang, Y. Fukuzaki, D. Hira and K. Furukawa, Bioresour. Technol., 2010, 101, 9471–9478 CrossRef CAS PubMed.
- P. Stief, Biogeosciences, 2013, 10, 7829–7846 Search PubMed.
|
| This journal is © The Royal Society of Chemistry 2016 |
Click here to see how this site uses Cookies. View our privacy policy here.