Phenolic metabolites from mangrove-associated Penicillium pinophilum fungus with lipid-lowering effects

Abstract

Chemical examination of the mangrove-associated fungus Penicillium pinophilum (H608) resulted in the isolation of 16 phenolic metabolites, including a new metabolite, namely 5′-hydroxypenicillide (1). The structure of the new compound was determined by extensive spectroscopic analyses, in association with the Mosher method for configurational assignment. All compounds were tested for inhibitory effects against oleic acid (OA)-elicited lipid accumulation in HepG2 cells, while eight compounds (4, 7–8, and 11–15) exhibited inhibition toward lipid accumulation at a dose of 10 μM with no cytotoxic effect. Further investigation revealed six compounds (4, and 11–15) that significantly suppressed intracellular total cholesterol (TC) and triglycerides (TGs). A real-time quantitative PCR indicated that compounds 4, 11, and 13–15 dramatically decreased the expression of fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC) and 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) in association with up-regulation of carnitinepalmitoyl transferase-1 (CPT-1). In addition, seven compounds (4, 8, 11, and 13–16) significantly reduced oxidized low-density lipoprotein stimulated lipid accumulation in RAW264.7 cells. Mechanistic study revealed that compounds 14–16 remarkably decreased CD36 and SR-1 transcription, while compounds 4 and 15 dramatically up-regulated PPARγ, LXRα and ABCG1 to promote cholesterol efflux. This work provided a group of new chemical entities as promising leads for the development of hypolipidemic and anti-atherosclerotic agents.

---

1. Introduction

Hyperlipidemia is known as abnormally elevated levels of lipids (high cholesterol and/or triglyceride levels) and/or lipoproteins in the blood, which raise the risk of cardiovascular (atherosclerosis and coronary heart diseases) and heart diseases.^1–5 In addition, hyperlipidemia also aggravates other pathological conditions such as hypothyroidism and chronic kidney dysfunction.⁶ On the other hand, atherosclerosis,⁷ a progressive disease characterized by the formation and accumulation of lipid plaques in the arteries and by inflammatory responses, results in insufficient blood supply to organs and tissues, that induces death of cardiovascular disease.^8,9 Low-density lipoprotein (LDL) plays a key role for the accumulation of extracellular and intracellular lipids in the arterial intima to develop atherogenesis.^10,11 Foam cell formation is a main determinant of atherosclerotic lesions, in which macrophages express scavenger receptors on their plasma membranes and uptake oxidized LDL.¹² Foam cells also secrete various inflammatory cytokines to accelerate the development of atherosclerosis. For instance, scavenger receptors CD36, SR-A1 and SR-A2 bind to and uptake excess oxLDL into macrophages,¹³ leading to the accumulation of excess cholesterol, which is toxic to cells. ATP-binding cassette (ABC) transporters (ABCA1 and ABCG1) induce the reverse cholesterol transport (RCT) pathway by mediating the translocation of cholesterol across cellular bilayer membranes.^14–16 ABCA1 promotes the efflux of cholesterol to lipid-poor apolipoproteins such as apolipoprotein A1 (apoA1), while ABCG1 mediates cholesterol efflux to high-density lipoprotein (HDL).^17–19 The expression of ABCA1 and ABCG1 is regulated by proliferator-activated receptor gamma (PPARγ)-dependent and liver X receptor alpha (LXRα)-dependent pathways, respectively.^20,21 The marketed lipid-lowering agents with beneficial therapeutic effects are mainly classified into statins and fibrates,²² while rosiglitazone is used for the treatment of atherogenesis through the stimulation of cholesterol efflux by up-regulating ABCA1 to prevent foam cell formation. Among the statin derivatives, compactin (mevastatin) is the first fungal metabolite with a PKS-based scaffold to be isolated from the fungi Penicillium citrinum and P. brevicompactum, and it performed as a specific inhibitor of HMG-CoA reductase being highly effective in lowering plasma cholesterol levels in animals and men.²³ The fungal product lovastatin, (mevinoline) structurally related to compactin as isolated from the fungus A. terreus, was the first marketed statin drug.²⁴ Microbial transformation of compactin results in the lactone ring opening to form pravastatin, which shows a reduction in side effects compared with lovastatin and simvastatin.²⁵ Thus, natural products are an excellent strategy for developing future effective and safe hypolipidemic and anti-atherosclerotic drugs.²⁶ With the aim of discovering new bioactive natural products with lipid-lowering effects from marine-derived microorganisms, a cell model-based bioassay was performed. The results demonstrated that a mangrove soil-derived fungus Penicillium pinophilum can reduce lipid accumulation. Chromatographic separation of an active lipid-lowering ethyl acetate (EtOAc) fraction from the fungus led to isolation of 16 phenolic compounds (Fig. 1). In this paper, we report the inhibitory effects of the phenolic analogues on the lipid-lowering effects and oxLDL-induced foam cell formation, in addition to the potential mechanisms in RAW264.7 macrophages.

Fig. 1 Structures of the isolated compounds.

2. Experimental

2.1. General procedures

Optical rotations were measured by an Autopol III automatic polarimeter (Rudolph Research Co., Ltd.). IR spectra were measured on a Thermo Nicolet Nexus 470 FT-IR spectrometer. The ¹H and ¹³C NMR spectra were recorded on a Bruker Avance-400FT NMR spectrometer using TMS as an internal standard. HRESIMS spectra were obtained on a Bruker APEX IV 70 eV FT-MS spectrometer and on a Thermo DFS spectrometer using a matrix of 3-nitrobenzyl alcohol. EIMS (70 eV) were recorded on a Finnigan MAT 95 mass spectrometer. Column chromatography was carried out using silica gel (160–200, 200–300 mesh), and HF₂₅₄ silica gel for TLC was obtained from Qingdao Marine Chemistry Co. Ltd. Sephadex LH-20 (18–110 μm) from Pharmacia. HPLC was performed on an Alltech 426 pump employing an UV detector, and the prevail C₁₈ column (5 μm) was used for semi-preparative HPLC separation. A chiral-phase column (Phenomenex Lux, cellulose-2, 250 × 10 mm, 5 μm) was used for chiral analysis. 25-[N-[(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)-methyl] amino]-27-norcholesterol (25-NBD cholesterol), MTT, digitonin, simvastatin, rosiglitazone, Oil Red O and Dulbecco’s modified Eagle’s medium (DMEM) were purchased from Sigma-Aldrich, Inc. (St. Louis, MO, USA). An intracellular cholesterol assay kit was purchased from Jian Cheng Biotechnology Company (Nanjing, China). Human oxLDL, ApoA1 and HDL were obtained from Yiyuan Biotechnologies (Guangzhou, China). A total RNA extraction reagent (RNAiso Plus), a Prime Script RT reagent kit, and a SYBR-Green PCR kit were purchased from Transgene Biotech, Inc. (Beijing, China). A luciferase assay kit was purchased from Promega Inc. (Beijing, China).

2.2. Fungal strain and identification

The fungus Penicillium pinophilum (H608) was isolated from the mangrove sediment, which was collected from the Xiamen coastline, in May 2012. The strain was identified by comparing the morphological character and 18S rDNA (ITS) sequence with those of standard records. The morphological examination was performed by scrutinizing the fungal culture, the mechanism of spore production, and the characteristics of the spores. For inducing sporulation, the fungal strains were separately inoculated onto potato dextrose agar. All experiments and observations were repeated at least twice leading to the identification of the strain H608 as Penicillium pinophilum. The strain H608 was deposited at the State Key Laboratory of Natural and Biomimetic Drugs, Peking University, China, with the GenBank (NCBI) accession number KP901304.

2.3. Fermentation

The fermentation was carried out in 30 Fernbach flasks (500 mL), each containing 100 g of rice. Distilled H₂O (100 mL) was added to each flask, and the contents was soaked overnight before autoclaving at 15 psi for 30 min. Spore inoculum was prepared by suspending the seed culture in sterile, distilled H₂O to give a final spore/cell suspension of 1 × 10⁶ per mL. After cooling to room temperature, each flask was inoculated with 5.0 mL of the spore inoculum and incubated at 25 °C for 40 days.

2.4. Extraction and isolation

The fermented material was extracted successively with EtOAc (3 × 500 mL). The EtOAc extract was evaporated to dryness under vacuum to afford a crude residue (11.7 g), which was then subjected to silica gel (200–300 mesh) vacuum column chromatography, eluting with PE/EtOAc (from 5 : 1 to 0 : 1, gradient) to obtain six fractions (F1 to F6). The ¹H NMR spectra informed that the fraction F4 contains the components featured by phenolic compounds. Thus, fraction F4 (3.0 g) was chromatographed over C₁₈ gel (ODS, MeOH/H₂O = 3 : 1) to obtain four subfractions (SF4a–SF4d). SF4c (1.43 g) was purified on a silica gel column using hexane/acetone = 5 : 2 as an elutant to obtain 1 (18.0 mg), 2 (24.5 mg), 3 (7.6 mg), 4 (18.2 mg), 5 (8.7 mg), and 6 (24.8 mg). SF4b (310 mg) was subjected to RP-HPLC with a mobile phase of MeCN/H₂O = 2 : 1 (2 mL min⁻¹) to yield 16 (17.6 mg), 15 (7.8 mg), and 14 (23.5 mg). SF4d (110 mg) was subjected to RP-HPLC with a mobile phase of MeCN/H₂O = 3 : 1 (2 mL min⁻¹) to yield 7 (27.1 mg), 8 (17.2 mg), 9 (13.5 mg), 10 (11.7 mg), 11 (8.7 mg), 12 (6.7 mg), and 13 (18.3 mg).

5′-Hydroxypenicillide (1): white solid. [α]²⁵_D −27.5 (c 0.05, MeOH); UV (MeOH) λ_max (log ε) 217 (1.74), 280 (1.12) nm; IR (KBr) ν_max 3388, 2958, 1732, 1598, 1468, 1357, 1294, 1206 cm⁻¹; for ¹H and ¹³C NMR data, see Table 1; HRESIMS m/z 389.1594 [M + H]⁺ (calcd for C₂₁H₂₅O₇, 389.1600).

Table 1 ¹H and ¹³C NMR data of 1 ^a

No.	1
	δH (ppm, J in Hz)	δC (ppm)
a Measured in DMSO-d6 at 400 MHz for ^1H and 100 MHz for ^13C.
1	6.96, d (8.4)	118.0 CH
2	7.65, d (8.4)	131.6 CH
3		134.4 C
4		153.7 C
4a		119.5 C
5		167.8 C
7	5.08, s	69.1 CH2
7a		127.5 C
8	6.34, d (1.6)	120.3 CH
9		138.7 C
10	6.77, d (1.6)	118.7 CH
11		148.9 C
11a		142.2 C
1a		151.4 C
13	2.16, s	20.8 C
1′	4.93, dd (3.0, 8.6)	64.3 CH
2′	1.21, m; 1.60, m	43.2 CH2
3′	1.78, m	33.8 CH
4′	0.90, d (6.7)	22.1 CH3
5′	4.36, d (6.0)	69.4 CH2
OMe	3.80, s	62.4 CH3
11-OH	9.68, s

---

2.5. MPA esterification and 9-AMA esterification of 1

Compound 1 (4 mg, 0.01 mmol) was dissolved in dimethyl carbonate (4 mL), then DBU (0.6 mmol) was added. The solution was kept at 90 °C under magnetic stirring and monitored by TLC. After disappearance of 1, the solvent was evaporated under reduced pressure. The residue was solubilized with ethyl acetate (10 mL) and treated with a solution of 1 N HCl (5 mL). The final products were extracted with ethyl acetate (3 × 10 mL), and the reunited organic extracts were washed with a saturated solution of NaCl and dried over Na₂SO₄. After filtration and evaporation of the solvent, the methylated compound was purified by chromatography on a column using silica gel (160–200 mesh) eluting with CH₂Cl₂/CH₃OH (5 : 2) to yield 11-methylated 1 (3.8 mg).

Both (R)- and (S)-MPA esters of 11-methylated 1 were obtained by the treatment of 11-methylated 1 (0.9 mg, respectively) with (R)- and (S)-MPA (3.1 mg), and dicyclohexylcarbodiimide (3.9 mg) in dry CDCl₃ (0.6 mL) catalyzed with dimethylaminopyridine (2.32 mg) and stirred at RT overnight. The MPA esters, 1a (1.4 mg) and 1b (1.6 mg), were purified by semi-preparative HPLC using MeCN (100%) as a mobile phase.

Esters 1c and 1d were prepared separately by treatment of 11-methylated 1 (1 mg) with the corresponding (R)- and (S)-9-AMA acids (1.1 equiv.) in the presence of EDC (1.1 equiv.) and DMAP in dry CH₂Cl₂, under a N₂ atmosphere. The reaction was stirred at room temperature for 12 h. The organic layer was washed sequentially with H₂O, HCl (1 M), H₂O, NaHCO₃ (sat), and H₂O, then dried (Na₂SO₄) and concentrated under reduced pressure to obtain the corresponding ester. Final purification was achieved by column chromatography on silica gel 160–200 mesh eluting with hexane–EtOAc (3 : 1) to yield 1c (1.2 mg) and 1d (1.5 mg).

2.6. HepG2 cell culture

HepG2 cells, which originated from the American Type Culture Collection (ATCC) (Manassas, VA, USA) and obtained from the Peking Union Medical College, were maintained in DMEM containing 10% fetal bovine serum (FBS) at 37 °C and 5% CO₂. Before treatment, cells were kept in serum-free DMEM for 12 h then incubated with the indicated concentration of SN12 or with simvastatin (10 μM) in DMEM containing oleic acid (100 nM) for 24 h. The blank group was incubated with serum-free DMEM alone. Oil red O staining was performed as previously reported and the intracellular contents of the total lipid, total cholesterol and triglyceride were determined by kits according to the manufacturer’s instructions.

2.7. Oleic acid (OA)-elicited lipid accumulation

HepG2 liver cells were maintained in DMEM supplemented with penicillin/streptomycin (100 μg mL⁻¹) and 10% fetal bovine serum. The cells with 70–80% confluence were incubated in DMEM/oleic acid (100 μM) for 12 h and then were treated with the compounds (each, 10 μM) and the positive control simvastatin was in DMEM/100 μM oleic acid with DMEM/100 μM oleic acid as a blank for an additional 6 h. Subsequently, the cells were subjected to Oil Red O staining or TC and TG determination as described previously.⁴² Each experiment (n = 8 for Oil Red O staining or n = 3 for TC and TG determination) was repeated in triplicate.

2.8. oxLDL-induced foam cell formation

RAW264.7 cells were maintained in DMEM supplemented with penicillin/streptomycin (100 μg mL⁻¹) and 10% fetal bovine serum. The cells with 70–80% confluence were incubated with DMEM + oxLDL (50 mg mL⁻¹) and individual compound (each, 10 μM) or the positive control rosiglitazone (10 μM) for 12 h. Subsequently, the cells were subjected to Oil Red O staining, photography and TC determination.

2.9. Cholesterol uptake assay

Cholesterol uptake assays were performed using 25-NBD cholesterol in RAW264.7 macrophages. The cells were plated in 96-well clear-bottom black plates at 4 × 10⁴ cells per well. Six hours later, the medium was removed, and the cells were labeled with 25-NBD cholesterol (5 μg mL⁻¹) in aliquots of serum-free DMEM individually containing 10 μM of each of the experimental compounds or an equal volume of DMSO for the indicated time. Then, the cells were washed twice with phosphate buffered saline (PBS), and the amounts of cholesterol in the cells were measured using a Tecan Infinite M1000Pro Microplate Reader (TECAN Group Ltd., Shanghai, China; excitation 485 nm, emission 535 nm). Each uptake assay was performed in duplicate in three experiments.

2.10. Cholesterol efflux assay

RAW264.7 cells were equilibrated with NBD-cholesterol (1 μg mL⁻¹) for 12 h. The NBD-cholesterol labeled cells were washed with PBS and incubated in serum-free DMEM containing 50 μg mL⁻¹ HDL and 10 μM of each experimental compound individually for 6 h. Fluorescence-labeled cholesterol released from the cells into the medium was measured with a Tecan Infinite M1000Pro Microplate Reader (TECAN Group Ltd., Shanghai, China). Cholesterol efflux was expressed as a percentage of fluorescence in the medium relative to the total amount of fluorescence detected in the cells and the medium. Each experiment was performed in triplicate with 3 replicates each time.

2.11. Quantitative real-time PCR

Total RNA extraction, cDNA synthesis, and quantitative PCR assays were performed as described previously.⁴³ Samples were cycled 40 times using a Fast ABI-7500 sequence detector (Applied Biosystems). ABI-7500 cycle conditions were conducted for 5 min at 95 °C, and were followed by 40 cycles of 15 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. The cycle threshold (CT) was calculated under default settings for real-time sequence detection software (Applied Biosystems). At least three independent biological replicates were performed to check the reproducibility of the data. The gene-specific primers used for quantitative PCR are listed in Table 2.

Table 2 Primers used in real-time quantitative PCR analysis

	Name	Forward (5′-3′)	Reverse (5′-3′)
For HepG2	FAS	CGGTACGCGACGGCTGCCTG	GCTGCTCCACGAACTCAAACACCG
	ACC	TGATGTCAATCTCCCCGCAGC	TTGCTTCTTCTCTGTTTTCTCCCC
	HMGR	GGACCCCTTTGCTTAGATGAAA	CCACCAAGACCTATTGCTCTG
	CPT-1	CGTCTTTTGGGATCCACGATT	TGTGCTGGATGGTGTCTGTCTC
	β-Actin	CCTGGCACCCAGCACAAT	GCCGATCCACACACGGAGTACT
For RAW264.7	PPARγ	GCAGCTACTGCATGTGATCAAGA	GTCAGCGGGTGGGACTTTC
	LXRα	AGGAGTGTCGACTTCGCAAA	CTCTTCTTGCCGCTTCAGTTT
	ABCG1	CAAGACCCTTTTGAAAGGGATCTC	GCCAGAATATTCATGAGTGTGGAC
	CD36	CAAGCTCCTTGGCATGGTAGA	TGGATTTGCAAGCACAATATGAA
	SR-1	TTAAAGGTGATCGGGGACAAA	CAACCAGTCGAACTGTCTTAAG
	β-Actin	ACACTGTGCCCATCTACGAG	CAGCACTGTGTTGGCATAGAG

---

2.12. Western blot

HepG2 cells were lysed in lysis buffer containing 10% glycerol, 1% Triton X-100, 135 mM NaCl, 20 mM Tris (pH 8.0), 2.7 mM KCl, 1 mM MgCl₂, and protease and phosphatase inhibitors (0.5 mM PMSF, 2 μM pepstatin, and 2 μM okadaic acid). Aliquots of samples were subjected to SDS-PAGE followed by transfer to polyvinylidenedifluoride (PVDF) membranes. Immunoblotting was performed using respective antibodies (1 : 1000). Following incubation with horseradish peroxidase-conjugated secondary antibody, proteins were detected with ECL plus kits.

2.13. Measurement of PPARγ promoter activity

A transactivation reporter assay in 293T cells was performed. Briefly, cells were transiently transfected with a PPARγ expression vector and a DR-1 luciferase reporter vector. At 6 h after transfection, the transfection mixture was replaced with fresh medium containing the appropriate agonist. Luciferase assays were performed after 24 h using a luciferase assay kit according to the manufacturer’s instructions.

2.14. Cell viability assay

Cell viability was examined using an MTT assay. RAW264.7 macrophages in 96-well culture plates were treated with compounds with 50 μM digitonin as a cytotoxic control. The cells were incubated for 12 h, and MTT reagent (5 mg mL⁻¹) was added to each well. After 2 h, the medium was removed and cells were lysed in 200 μL of DMSO. The absorbance at 565 nm was measured using a microplate reader (TECAN Group Ltd., Shanghai, China).

2.15. Statistical analyses

The data are presented as the mean ± SEM. Differences were assessed by one-way analysis of variance (ANOVA) followed by Dunnett’s post hoc test. A probability level (p) of 0.05 was considered significant. SPSS 17.0 for Windows (SPSS, Chicago, IL, USA) was used for statistical analysis.

3. Results and discussion

3.1. Structural elucidation

Compound 1 had a molecular formula of C₂₁H₂₄O₇, as determined by HRESIMS (m/z 389.1594 [M + H]⁺, calcd 389.1600) and NMR data, requiring ten degrees of unsaturation. The ¹H NMR spectrum exhibited resonances for three methyl groups, four aromatic protons belonging to meta- and ortho-spin systems, and a number of alkyl protons. The ¹³C NMR spectrum provided a total of 21 carbon resonances (Table 1), including 12 aromatic carbons for two phenyl rings and a carbonyl carbon. Analyses of 2D NMR (COSY, HMQC and HMBC) data established the basic skeleton of 1 to be a diphenyl ether lactone, closely related to the structure of penicillide.²⁷ The distinction was only attributed to the substitution at the isopentyl side chain, in which a hydroxyl group at C-5′ (δ_C 69.4) was assigned by the HMBC correlations from H₃-4′ (δ_H 0.90, d) to C-3′ (δ_C 33.8), C-2′ (δ_C 43.2) and C-5′, in addition to the COSY correlation from H-3′ (δ_H 1.78, m) to H₂-5′ (δ_H 4.36), H₃-4′ and H₂-2′. The configuration of C-1′ was determined on the basis of the revised Mosher method.²⁸ Firstly, the phenolic group at C-11 was protected by methylation with dimethyl carbonate (DMC),²⁹ and then the esterification of 11-methylated 1 with (R)-MPA and (S)-MPA was accomplished. Calculation of the Δδ (δ_R − δ_S) data of the (R)- and (S)-MPA esters of 11-methylated 1 (Fig. 2) caused the configuration of C-1′ to be S. In addition, the absolute configuration at C-3′ was established according to the methodology reported by Riguera and coworkers for determining the absolute configuration of β-chiral primary alcohols.³⁰ 11-Methylated 1 was reacted with (R)- and (S)-2-(anthracen-9-yl)-2-methoxyacetic acid (9-AMA) to form 9-AMA esters. Calculation of Δδ (δ_R − δ_S) values obtained from the R- and S-ester derivatives 1c and 1d led to an S configuration assigned at C-3′. Thus, the structure of 1 was assigned to 5′-hydroxypenicillide.

Fig. 2 Δδ (δ_R − δ_S) values (in ppm) for the MPA esters and 9-AMA esters of 1.

Inspection of spectroscopic data and the comparison of the NMR data and specific rotation resulted in the structures of 15 known phenolic metabolites to be found to be identical to penicillide (2),²⁷ isopenicillide (3),³¹ dehydroisopenicillide (4),²⁷ 1-dehydroxypencillide (5),²⁷ vermixocin B (6),³² methyl tenellate (7),³³ secopenicillide A (8),³⁴ talaromycin C (9),³⁵ deacetyl talaromycin C (10),³⁵ deoxyfunicone (11),³⁶ funicone (12),³⁷ 3-O-methylfunicone (13),³⁸ vermistatin (14),³⁹ hydroxyvermistatin (15),⁴⁰ and methoxyvermistatin (16).⁴¹ Based on their scaffolds, these compounds are classified as penicillide-type, tenellic acid-type, funicone-type, and vermistatin-type.

During the separation process, a spirolactone purpactin C⁴¹ was isolated as an unstable component, which was able to convert to secopenicillide A (8). The penicillide-type analogues such as vermixocin B (6) were likely derived from 8 via reduction of the aldehydic group to form an alcohol intermediate, and then esterification occurred. In addition, the structural relationship of the remaining diphenyl ethers was depicted by the occurrence of deacetylation, hydroxylation, methylation, and dehydration (Fig. 3).

Fig. 3 Postulation of the biogenetic relationship of the isolated compounds.

3.2. Pharmacological activity

3.2.1. Lipid-lowering effect. Compounds 1–16 were tested for inhibitory effects against oleic acid (OA)-elicited lipid accumulation in HepG2 liver cells. Prior to the test, the cytotoxic activity of all compounds toward HepG2 cells was evaluated by an MTT assay, while all compounds showed weak or no cytotoxic effects with IC₅₀ > 50 μM. The lipid-lowering test revealed that eight compounds (4, 7–8, and 11–15) exerted inhibitory effects against lipid accumulation at a dose of 10 μM as measured by Oil Red O staining (Fig. 4). Analyses of the primary structure–activity relationship were conducted to recognize the weak activity of penicillide-type analogues with the exception of 4, which was characterized by the presence of a hydroxyisoprenyl group. In regard to the tenellic acid-type analogues, the substitution of the side chain and functional group at ring A directly affected the inhibitory effect. The analogues with dimethoxymethane (9) to replace an aldehydic group (9 vs. 10, OD: 0.278 vs. 0.276) or with an acetoxy group instead of a hydroxyl group at the side chain (10 vs. 8, OD: 0.276 vs. 0.267) reduced the activity. Funicone-type analogues are more effective among the tested compounds, while 11 (OD: 0.264) exhibited an effect more potent than that of its analogues 12 (OD: 0.272) and 13 (OD: 0.271) which were modified with a hydroxyl or methoxy group at C-3. Vermistatin-type analogues 14–16 with a γ-lactone unit were more effective than 11, indicating that the γ-lactone unit is a functional group for lipid-lowering function.

Fig. 4 Spectrophotometry at 358 nm after Oil Red O staining. The dose of compounds and simvastatin (Simv) was 10 μM. The blank group (Blk) was given DMEM only while the other groups were given 100 μM of OA to elicit lipid accumulation. Bars depict the means ± SEM in triplicate. ##p < 0.01, ###p < 0.001 blank group vs. negative control; *p < 0.05, **p < 0.01, ***p < 0.001, test group vs. negative control group. Blk: blank group; NC: negative control; Simv: simvastatin.

3.2.2. Compounds decrease TC and TG levels and regulate lipogenic genes. Further investigation revealed that five compounds (4, 11, and 13–15) significantly suppressed intracellular total cholesterol (TC) levels (Fig. 5A) and intracellular triglycerides (TGs) (Fig. 5B), of which 4, and 13–15 were more potent than the positive control simvastatin, a marketed anti-hyperlipidemic drug. In order to uncover whether the lipid-lowering effects of the active compounds are related to key lipogenic genes, a real-time quantitative PCR experiment was performed. The experimental data conducted for compounds 4, 11, and 13–15 show dramatically down-regulating fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC) and 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) at the mRNA levels (Fig. 6), whereas these compounds significantly up-regulated the lipid catabolic gene carnitinepalmitoyl transferase-1 (CPT-1). These findings indicated that the lipid-lowering effects of the compounds (4, 11, and 13–15) were induced by the inhibition of lipogenesis and the stimulation of lipid catabolism.

Fig. 5 Compounds inhibit lipid accumulation in oleic acid (OA)-elicited HepG2 cells. (A) and (B) Intracellular levels of total cholesterol (TC) and triglycerides (TGs).

Fig. 6 mRNA levels of key lipid metabolic genes determined by real-time quantitative PCR with β-actin as the internal control. The concentrations of the compounds and simvastatin (Simv) were 10 μM. The blank group (Blk) was given DMEM only while the other groups were given 100 μM of OA to elicit lipid accumulation. Bars depict the means ± SEM in triplicate. ##p < 0.01, ###p < 0.001 blank group vs. negative control; *p < 0.05, **p < 0.01, ***p < 0.001, test group vs. negative control group. Blk: blank group; NC: negative control; Simv: simvastatin.

3.2.3. Compounds decrease oxLDL-induced lipid overaccumulation in RAW264.7 cells. Foam cell formation conducted the elevation of macrophage cholesterol levels and imbalanced lipid efflux and influx, leading to atherosclerotic lesions. Therefore, detection of the lipid-lowering active compounds against foam cell formation in RAW264.7 macrophages as induced by oxLDL directly reflected the inhibitory effects against atherosclerosis. We established a model of foam cell formation accounting for macrophage RCT. This model is presented as a system of non-linear ordinary differential equations to be motivated by observations of time scales for oxidation of lipids and MRCT. The bioassay results revealed that compounds 4, 8, 11, and 13–16 significantly reduced oxLDL-stimulated lipid accumulation in RAW264.7 cells in a dose of 10 μM, reflecting their effects to prevent oxLDL-induced foam cell formation in RAW264.7 macrophages. In addition, compounds 4 and 15 exhibited potent effects which were comparable to that induced by the positive control rosiglitazone at the same dose (10 μM) (Fig. 7A). Cell surface enlargement is an additional sign to detect the formation of foam cells. Therefore, an evaluation assay consisting of photography after Oil Red O staining was performed. Compounds 4, 8, 11, and 13–16 largely alleviated neutral lipid accumulation, and reduced the cell surface area (Fig. 7B).

Fig. 7 Compounds suppress oxLDL-induced foam cell formation in RAW264.7 macrophages. (A) Spectrophotometry at 358 nm after Oil Red O staining; (B) phenotype of foam cell induced by compounds. The concentrations of the compounds and rosiglitazone (Rosi) were 10 μM. The blank group was given DMEM only while the other groups were given 50 μg mL⁻¹ of oxLDL to induce foam cell formation. Bars depict the means ± SEM in triplicate. ##p < 0.01 blank group vs. negative control; *p < 0.05, **p < 0.01, ***p < 0.001, test group vs. negative control group. Blk: blank group; NC: negative control; Rosi: rosiglitazone.

Lipid dysregulation is a key factor to induce atherosclerosis, a major risk of cardiovascular disease (peripheral arterial disease, coronary heart disease, stroke, and heart attack). Macrophage-derived foam cells are a major constituent of the fatty deposits characterizing the disease atherosclerosis. Foam cells are formed when certain immune cells (macrophages) take on oxidized low-density lipoproteins (oxLDL) through failed phagocytosis. High-density lipoproteins (HDL) are known to have a number of anti-atherogenic effects. One of these stems from their ability to remove excess cellular cholesterol for processing in the liver, a process called reverse cholesterol transport (RCT). HDL induced macrophage RCT by forming foam cells and removing excess lipids by efflux transporters.

3.2.4. Compounds inhibit cholesterol uptake in RAW264.7 macrophages. Among these active compounds, compounds 4, 11, and 14–16 dramatically decreased the intracellular total cholesterol levels, whereas 8 and 13 were inactive (Fig. 8A). These results suggested that compounds 4, 11, and 14–16 were adequate in cholesterol uptake or cholesterol efflux to high-density lipoprotein (HDL). Real-time quantitative PCR was performed to determine the mechanism of compounds to regulate the cholesterol dynamics and the expressions of cholesterol efflux/influx-modulating genes. Similar to 25-NBD cholesterol, compounds 11 and 14–16 dramatically inhibited cholesterol uptake in RAW264.7 macrophages in a dose-dependent manner (Fig. 8B), while compounds 4 and 14–16 significantly stimulated cholesterol efflux to HDL (Fig. 8C). The efficiencies of 4 and 15 for cholesterol efflux (FI: 63.92% and 64.88%) showed them to be more potent than rosiglitazone (FI: 63.38%). In addition, compounds 14 and 16 showed significant activity to inhibit cholesterol influx (FI: 62.39% and 60.26%), but they exerted a weaker effect than rosiglitazone (FI: 63.38% ± 0.30%) (Fig. 8B and C).

Fig. 8 Compounds suppress intracellular total cholesterol (TC) accumulation and regulate cholesterol influx/efflux in RAW264.7 macrophages. (A) Intracellular TC levels; (B) time-dependent cholesterol uptake curves indicated by NBD-cholesterol; (C) NBD-cholesterol efflux to HDL.

3.2.5. Compounds regulate mRNA levels of cholesterol efflux/influx-modulating genes and PPARγ transcriptional activity. The critical scavenger receptors CD36 and SR-1 are the main targets to regulate cholesterol dynamics such as cholesterol uptake, while peroxisome proliferator-activated receptor γ (PPARγ), liver X receptor α (LXRα) and ATP-binding cassette G1 (ABCG1) play key roles in stimulating cholesterol efflux. Compounds 14–16 (10 μM) significantly induced down-regulation of CD36 and SR-1 transcription, while compound 11 only decreased the mRNA level of CD36. However, compound 4 was inactive toward the two cholesterol influx stimulators (Fig. 9). These findings suggested that the compounds with different scaffolds undertook distinct mechanism for the cholesterol uptake. Moreover, compounds 4 and 15 dramatically increased the mRNA levels of PPARγ, LXRα and ABCG1 (Fig. 9), indicating the promoting cholesterol efflux of the two compounds closely related to the cholesterol efflux stimulators. Compounds 14 and 16 were effective in promoting cholesterol efflux but showed no significant effects on the transcription of these three cholesterol efflux stimulators, suggesting that the two compounds may stimulate cholesterol efflux via a currently unknown mechanism.

Fig. 9 Effects of compounds 4, 11, and 14–16 on the mRNA levels of PPARγ, LXRα, ABCG1, CD36 and scavenger receptor-1 (SR-1) in RAW264.7 cells. Real-time PCR was conducted with gene-specific oligonucleotide primers. The amplification of β-actin served as an internal control. The values shown are the means ± SEM of at least three experiments. *p < 0.05, **p < 0.01, ***p < 0.001 vs. control.

4. Conclusions

In summary, this is the first report of diphenyl ethers and related natural products, which were potent for lipid-lowering effects and inhibition of foam cell formation. These findings suggested them to be potential leads against hyperlipidemia and atherosclerosis. Mechanistic study revealed the inhibition of intracellular total cholesterol (TC) levels and intracellular triglycerides (TGs) of compounds 4, 11, and 13–15 related to down-regulation of fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC) and 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and the up-regulation of the lipid catabolic gene carnitinepalmitoyl transferase-1 (CPT-1). The suppression of oxLDL-induced foam cell formation by compounds 4, 11, and 14–16 via inhibiting cholesterol influx was induced by the down-regulation of CD36 and SR-1 or promotion of cholesterol efflux by up-regulation of PPARγ, LXRα and ABCG1. The present work shows a group of new chemical entities to be promising for the development of anti-hyperlipidemic and anti-atherosclerosis agents.

Acknowledgements

This work was supported by the National Basic Research Program 973 (2015CB755906), the NSFC-Shangdong Joint Fund for Marine Science (U1406402), the National Hi-Tech863-Projects (2011AA090701, 2013AA092902), COMRA (DY125-15-T-01), and National Natural Science Foundation of China (41376127, 81573436).

Notes and references

1. K. M. Patel, A. Strong, J. Tohyama, X. Jin, C. R. Morales, J. Billheimer, J. Millar, H. Kruth and D. J. Rader, Circ. Res., 2015, 116, 789–796.
2. J. S. Kishor, M. K. Kathivarin and S. Rahul, Bioorg. Med. Chem., 2007, 15, 4674–4699.
3. S. M. Grundy, G. J. Balady and M. H. Criqui, Circulation, 1998, 97, 1876–1887.
4. W. F. Keane, J. Peter and B. L. Kasiske, Kidney Int. Suppl., 1992, 38, S134–S141.
5. M. J. Veerkamp, J. Graaf, S. J. H. Bredie, J. C. M Hendriks, P. N. M. Demacker and A. F. H Stalenhoef, Arterioscler., Thromb., Vasc. Biol., 2002, 22, 274–282.
6. R. L. Satarasinghe, R. Ramesh, A. A. A. Riyaaz, P. A. K. G. Gunarathne and A. P. Silva, Drug Metab. Drug Interact., 2007, 22, 279–283.
7. L. Fernandez-Friera, J. L. Penalvo, A. Fernandez-Ortiz, B. Ibanez, B. Lopez-Melgar, M. Laclaustra, B. Oliva, A. Mocoroa, J. Mendiguren, V. M. de Vega, L. García, J. Molina, J. Sánchez-González, G. Guzmán, J. C. Alonso-Farto, E. Guallar, F. Civeira, H. Sillesen, S. Pocock, J. M. Ordovás, G. Sanz, L. J. Jiménez-Borreguero and V. Fuster, Circulation, 2015, 131, 2104–2113.
8. R. Ladeiras-Lopes, S. Agewall, A. Tawakol, B. Staels, E. Stein, R. J. Mentz, A. Leite-Moreira, F. Zannad and W. Koenig, Int. J. Cardiol., 2015, 192, 72–81.
9. S. Mendis and O. Chestnov, Curr. Cardiol. Rep., 2014, 16, 486.
10. K. M. Patel, A. Strong, J. Tohyama, X. Jin, C. R. Morales, J. Billheimer, J. Millar, H. Kruth and D. J. Rader, Circ. Res., 2015, 116, 789–796.
11. L. N. Rao, T. Ponnusamy, S. Philip, R. Mukhopadhyay, V. V. Kakkar and L. Mundkur, Lipids, 2015, 50, 785–797.
12. X. H. Yu, Y. C. Fu, D. W. Zhang, K. Yin and C. K. Tang, Clin. Chim. Acta, 2013, 424, 245–252.
13. S. O. Rahaman, W. Swat, M. Febbraio and R. L. Silverstein, J. Biol. Chem., 2011, 286, 7010–7017.
14. G. J. Zhao, K. Yin, Y. C. Fu and C. K. Tang, Mol. Med., 2012, 18, 149–158.
15. J. Y. Lee, J. Karwatsky, L. Ma and X. Zha, Am. J. Physiol.: Cell Physiol., 2011, 301, C886–C894.
16. M. A. Kennedy, G. C. Barrera, K. Nakamura, A. Baldan, P. Tarr, M. C. Fishbein, J. Frank, O. L. Francone and P. A. Edwards, Cell Metab., 2005, 1, 121–131.
17. A. Ji, J. M. Wroblewski, L. Cai, M. C. de Beer, N. R. Webb and D. R. van der Westhuyzen, J. Lipid Res., 2012, 53, 446–455.
18. L. Yvan-Charvet, N. Wang and A. R. Tall, Arterioscler., Thromb., Vasc. Biol., 2010, 30, 139–143.
19. A. Chawla, W. A. Boisvert, C. H. Lee, B. A. Laffitte, Y. Barak, S. B. Joseph, D. Liao, L. Nagy, P. A. Edwards, L. K. Curtiss, R. M. Evans and P. Tontonoz, Mol. Cell, 2001, 7, 161–171.
20. G. Chinetti, S. Lestavel, V. Bocher, A. T. Remaley, B. Neve, I. P. Torra, E. Teissier, A. Minnich, M. Jaye, N. Duverger, H. B. Brewer, J. C. Fruchart, V. Clavey and B. Staels, J. Nat. Med., 2001, 7, 53–58.
21. A. Ravelli, Arthritis Rheum., 2012, 64, 33–36.
22. K. Pahan, Cell. Mol. Life Sci., 2006, 63, 1165–1178.
23. A. Endo, M. Kuroda and Y. Tsujita, J. Antibiot., 1976, 29, 1346–1348.
24. A. Endo, J. Med. Chem., 1985, 28, 401–405.
25. C. J. Vaughan and A. M. Gotto Jr, Circulation, 2004, 110, 886–892.
26. E. S. Stroes, P. D. Thompson, A. Corsini, G. D. Vladutiu, F. J. Raal, K. K. Ray, M. Roden, E. Stein, L. Tokgozoglu, B. G. Nordestgaard, E. Bruckert, G. De Backer, R. M. Krauss, U. Laufs, R. D. Santos, R. A. Hegele, G. K. Hovingh, L. A. Leiter, F. Mach, W. März, C. B. Newman, O. Wiklund, T. A. Jacobson, A. L. Catapano, M. J. Chapman and H. N. Ginsberg, Eur. Heart J., 2015, 36, 1012–1022.
27. K. Suzuki, K. Nozawa, S. Udagawa, S. Nakajima and K. Kawai, Phytochemistry, 1991, 30, 2096–2098.
28. T. Amagata, A. Amagata, K. Tenney, F. A. Valeriote, E. Lobkovsky, J. Clardy and P. Crews, Org. Lett., 2003, 5, 4393–4396.
29. R. Bernini, F. Crisante and M. C. Ginnasi, Molecules, 2011, 16, 1418–1425.
30. F. Freire, J. M. Seco, E. Quiñoá and R. Riguera, Chem. Commun., 2007, 1456–1458.
31. D. Zhao, C. Shao, Q. Zhang, K. Wang, F. Guan, T. Shi and C. Wang, J. Nat. Prod., 2015, 78, 2310–2314.
32. B. Prokas, D. Uhrin, J. Adamcova and J. Fuska, J. Antibiot., 1992, 45, 1268–1272.
33. H. Oh, T. O. Kwon, J. B. Gloer, L. Marvanova and C. A. Shearer, J. Nat. Prod., 1999, 62, 580–583.
34. S. Komai, T. Hosoe, T. Itabashi, K. Nozawa, T. Yaguchi, K. Fukushima and K. Kawai, J. Nat. Med., 2006, 60, 185–190.
35. M. Chen, L. Han, C. Shao, Z. She and C. Wang, Chem. Biodiversity, 2015, 12, 443–450.
36. T. Sassa, M. Nukina and Y. Suzuki, Agric. Biol. Chem., 1991, 55, 2415–2416.
37. L. Merlini, G. Nasini and A. Selva, Tetrahedron, 1970, 26, 2739–2749.
38. S. De Stefano, R. Nicoletti, A. Milone and S. Zambardino, Phytochemistry, 1999, 52, 1399–1401.
39. N. Murtaza, S. A. Husain, T. B. Sarfaraz, N. Sultana and S. Faizi, Planta Med., 1997, 63, 191.
40. Y. Liu, G. Xia, H. Li, L. Ma, B. Ding, Z. She, Y. Lu, L. He and X. Xia, Planta Med., 2014, 80, 912–917.
41. Z. Liu, G. Xia, S. Chen, Y. Liu, H. Li and Z. She, Mar. Drugs, 2014, 12, 3669–3680.
42. C. Wu, Y. Guo, Y. Su, X. Zhang, H. Luan, X. Zhang, H. Zhu, H. He, X. Wang, G. Sun, X. Sun, P. Guo and P. Zhu, J. Cell. Mol. Med., 2014, 18, 293–304.
43. C. Wu, X. Zhang, X. Zhang, H. Luan, G. Sun, X. Sun, X. Wang, P. Guo and X. Xu, J. Nutr. Biochem., 2014, 25, 412–419.

---

Footnote

† Electronic supplementary information (ESI) available. See DOI: 10.1039/c6ra00033a

---