A. Berasaluce*ab,
L. Matthysb,
J. Mujikab,
M. Antoñana-Díezab,
A. Valeroa and
M. Agirregabiriaab
aCIC-Microgune, Polo Garaia, Goiru 9, 20500 Arrasate, Spain
bIK4-Ikerlan, Polo Garaia, Goiru 9, 20500 Arrasate, Spain. E-mail: aberasaluce@ikerlan.es
First published on 20th February 2015
This paper describes a bead beating-based miniaturized cell lysis device that works in continuous flow allowing the analysis of large volumes of samples without previous treatment. A permanent magnet along with zirconium/silica beads were placed inside a lysis chamber fabricated with cyclo-olefin polymer (COP) by a fast prototyping technique, and the actuation of an external magnetic field caused the motion of the beads within the chamber. Characterisation of the lysis process was carried out using Staphylococcus epidermidis as the target cell and showed that both small bead size and large volume, along with the presence of Tween 20 and low flow rate, influenced significantly the device performance. Taking into account the compromise between time consumption and efficiency, 60 μL min−1 lysis flow rate was chosen as optimum yielding 43% lysis efficiency relative to off chip bead beating. Compatibility with injection moulding manufacturing techniques and capability of working in continuous flow make this device a potential DNA extraction method suitable for lab-on-a-chip applications.
The accepted method to amplify and detect DNA molecules is real-time polymerase chain reaction (qPCR), a sensitive technique suitable for microfluidic integration.7,8 Its performance depends on previous DNA extraction from target cells, which in turn is cell wall disruption dependent, especially working with microorganisms that show resistivity to lyse such as Gram positive bacteria and fungi.9,10
Many works have reported microfluidic integrated DNA extraction methods. They can be roughly classified into two main groups: chemical methods and physical methods.
Chemical methods release cellular DNA by solubilising membrane lipids and proteins using chaotropic agents such as guanidine thiocyanate11,12 and biological enzymes.13 They are easy to implement as they do not need any additional equipment. However, a prior mixing step is needed and this can be difficult to achieve on chip as the flow regime is laminar. Furthermore, the employed chemicals can inhibit subsequent downstream reactions, thus a thorough cleaning step is necessary.14
Generally, physical methods require additional hardware components that increase complexity for microsystem integration. Conversely they present many advantages, since they do not leave residual substances, are faster and more efficient. Several physical lysis methods have been reported based on thermal treatment,15 sonolysis,16 electroporation,17 laser induced cell wall disruption18 and mechanical lysis.19 Among them, mechanical lysis based on bead beating is the commonly used method working with hard to lyse samples because of its effectiveness and reproducibility.20 Considering these advantages, Claremont BioSolutions has worked on different devices capable of lysing Gram positive bacteria (B. Subtilis and M. Bovis) achieving efficiencies as high as benchtop products within 2 minutes.21,22 However, such products also present some drawbacks; OmmiLyse Bead Blender is an off-chip device and Micro Bead-Beater requires tubes and pertinent connections for sample transport, hindering integration into a monolithic sample to answer system.
Some authors along the line have successfully implemented the bead beating strategy into microfluidic systems. Siegrist et al.23 adapted potential advantages of centrifugation into a microfluidic compact-disc labcard. The rotation of the chip actuated a permanent magnet located in the lysis chamber, causing intense mixing and subsequent collision between beads and cells. Nonetheless, sample volume was limited by the chamber volume (70 μL). Hwang et al.24 concentrated high volume of bacteria samples employing functionalized glass beads packed in a chamber and achieved lysis by pneumatic vibration of an elastomeric membrane of PDMS. Although this material is a good candidate for fabricating microfluidic prototypes by moulding, it also presents several disadvantages: (i) its aging affects the mechanical properties, (ii) it can release undesired contaminants to the sample that can be harmful for biological reactions if bad cross-linking process occurs and, (iii) it is not the best material for mass production. From a commercial point of view, polymers such as cyclic olefin copolymer (COC) or COP are the most suitable materials due to their compatibility with injection moulding fabrication techniques as well as their biocompatibility.
In this work we present a microfluidic device made of COP that combines a magnetic stirrer and bead beating features for cell wall disruption of hard to lyse microorganisms. The system is thought to be used in applications which require large sample volumes, such as nasal, oral and water bacteria analysis. In order to minimize time consumption, our system works in continuous flow performing lysis at flow rates ranging from 30 μL min−1 to 180 μL min−1. Its capability to process large volumes avoids previous off-chip treatment and the use of both chemical reagents and heat which can inhibit downstream PCR reactions and/or protein analysis.
The chamber inlet was connected to a syringe containing the sample via a Luer connector, whereas the outlet was connected to an empty syringe. The plunger of the sample syringe was computer controlled displaced at a determinate flow rate by a mechanical pusher. While the sample flowed through the system, the magnet was rotating due to the magnetic field rotation caused by the permanent magnet coupled to the electrical motor. Hence, a bead beating-based bacteria lysis device in continuous flow was achieved. The lysate product was recovered in the outlet syringe.
Microorganism | Forward 5′–3′ | Reverse 5′–3′ | Probe 5′–3′ |
---|---|---|---|
Staphylococcus epidermidis26 | CAACAAGACGTTCTTTCAAGTCATCT | AAGGTGCTAAGCAAGTAAGAAAGAAATT | /56-FAM/ATGCGTTGT/ZEN/TCATA TTTTTAGCGCCTCCA/3IABkFQ/ |
Methicillin resistant Staphylococcus aureus27 | CATTGATCGCAACGTTCAATTT | TGGTCTTTCTGCATTCCTGGA | /5TET/TGGAAGTTA/ZEN/GATT GGGATCATAGCGTCAT/3IABkFQ/ |
Streptococcus uberis28 | AGAGGAATTCATCATGTTTTAACA | AATTGTAGAAGAACCATTTGATGT | /56-FAM/AGCGTCTAACAAC TCGGCCTTTG/3IABKFQ/ |
Purified genomic DNA (12228D-5™) was used to build an external standard curve to quantify lysis performance and validate linearity in the operating concentration range. Efficiency of the qPCR was calculated by plotting the cycle threshold versus the logarithmic concentration of the standard DNA in 4 consecutive days, yielding 100 ± 0.1% efficiency. The cycle threshold was set at 100 arbitrary units for all the experiments.
On the other hand, qPCR efficiency resulted close to 100%, which means that in each cycle the DNA concentration was doubled. Therefore, lysis efficiency was calculated by the following equation:
ΔCt = Ctin chip − Ctoff-chip (bead beating) |
The possible contribution of unlysed bacteria to the lysis efficiency due to the thermocycling heating steps of the qPCR was measured and considered as a control. For this purpose, the Ct values of untreated samples and samples lysed by off-chip bead beating were compared. The ΔCt between both was of 7.7 cycles. Thus, according to the equations shown above, the supernatant DNA and DNA released during the qPCR heating steps represented the 0.5% of the total amount of DNA. Therefore, DNA contribution of the unlysed bacteria was considered negligible.
Minor value | Major value | |
---|---|---|
a Bead quantity refers to the free volume occupied by beads in the chamber.b The voltage applied to the electric motor. | ||
Bead diameter | 100 μm | 200 μm |
Bead quantitya | 40% | 45% |
Flow rate | 30 μL min−1 | 60 μL min−1 |
Bacteria conc. | 105 CFU mL−1 | 106 CFU mL−1 |
Stirrer voltageb | 7 V (5200 rpm) | 9 V (6800 rpm) |
Tween 20 | Absence | 0.05% |
Control (neg) | — | — |
One of the chosen variables for the study was the size of the beads. Two different sizes were purchased, catalogued as 100 and 200 μm in diameter by the suppliers. Beads were examined under the microscope (Fig. 2) and their diameter measured by ImageJ software. A statistical population of 55 samples gave a mean diameter value of 194 ± 19 μm for small beads and the mean value for 33 samples of the large beads was 355 ± 49 μm.
![]() | ||
Fig. 2 Microscope images of the beads used. Beads are catalogued as 100 μm (a) and 200 μm (b) in diameter. Pictures were taken with 60![]() ![]() |
To assess possible inhibitions or other undesired effects when lysate solution was introduced into the thermocycler without any purification step, an internal control was added to the reaction mixture. 4 μL of nuclease free water used in the initial reaction mixture was replaced with 1 μL of methicillin resistant Staphylococcus aureus (MRSA) genomic DNA (33591D-5™), 2 μL of primers and probe designed to detect mecA gene of MRSA (Table 1) and 1 μL of nuclease free water. Compatibility between primers and probes used in the duplex reaction was checked by Oligo Analyzer 3.1 software (IDT). The polymerase chain reaction was run under the same thermocycling conditions as described previously.
The study was carried out comparing qPCR results of eight lysis replicates containing the internal control with eight replicates containing just the internal control. The Ct average values of the internal control were similar for samples with lysate and without lysate, 31.3 ± 0.2 and 31.1 ± 0.1, respectively. This means that there are not adverse effects during the logarithmic phase of the amplification process and characterization of the lysis process can be done without any purification of the cellular debris.
The r square value of the built model was 0.8, suggesting the model fitted considerably. Variables influence on the lysis process is shown in Table 3. Highlighted in bold are variables affecting significantly (p < 0.05) and the values that improve the efficiency (taken from the Pareto graph, not shown).
Value | P | |
---|---|---|
Blocks | — | <0.01 |
Bacteria conc. | — | 0.68 |
Bead size | 100 μm | <0.01 |
Lysis time | 2 min | <0.01 |
Bead quantity | 45% | 0.03 |
Stirrer voltage | — | 0.60 |
Tween 20 | 0.05% | 0.02 |
Control (neg) | — | 0.88 |
Results show that both bead size and bead quantity affect notably on efficiency. Small beads size and 45% of chamber filling increases the amount of released DNA, possibly due to the higher probability of collision and shear. Nevertheless, none of these variables are suitable for subsequent optimization. On one hand, smaller beads could go through the barrier increasing the fluidic resistance or even clogging the channels, and on the other hand, larger amount of beads in the lysis chamber hinders the rotation of the magnet. Likewise, usage of Tween 20 improves DNA recovery, since its detergent nature weakens the cell wall.30 However, higher concentration of surfactant brings on bubble formation, which is a problem to avoid in microfluidics. The fourth variable is the flow rate. The lower the flow rate the higher the cell lysis efficiency, but low flow rates can be a drawback in case that a minimum time-to-results is required. Finally, it must be remarked that the partition of the experimental design in 4 blocks has eliminated the intervariability of the experiments.
With the adjustment of all these factors, the cycle difference between the initial solution and lysate has been increased from 4 cycles (see Fig. 3) up to 6.5 cycles.
Results are shown in Fig. 4, where it can be seen that the lowest flow rate achieves the highest efficiency (56%). On the contrary, the highest flow rate gives 30% lysis efficiency within three minutes. Summarizing, fast lysis process leads to a poor lysis efficiency while the opposite situation is a time consuming efficient process. Moreover, the higher the flow rate the lower the deviation of the measurements.
![]() | ||
Fig. 4 Effect of flow rate on DNA recovery efficiency in relation to off-chip bead beating vortex system. Three replicates were performed at each flow rate. |
Considering time to results and efficiency, 60 μL min−1 flow rate was chosen as the optimal flow rate. The whole lysis process takes 8 minutes.
Lysis efficiencies were 39 ± 5, 36 ± 2 and 41 ± 6 which correspond to 3 × 106, 3 × 107 and 3 × 108 CFU mL−1 respectively as shown in Fig. 5. Firstly, no trend is observed among different initial bacteria concentration, corroborating the fact that lysis efficiency is not bacterial concentration dependant as concluded in the experimental design. The existing variability can be a consequence of using a single quencher probe, which increases background signal and subsequently reduces sensibility and precision of the detection.34 And secondly, method performance is close to that observed with S. epidermidis.
![]() | ||
Fig. 5 Lysis efficiency relative to off-chip method and qPCR cycle threshold for 3 × 108, 3 × 107 and 3 × 106 CFU mL−1 Streptococcus uberis. Three replicates were carried out for each cell number. |
Although it was fabricated by a rapid prototyping technique, its design is fully compatible with mass production by injection moulding. The easy fabrication process and the relative small volume it occupies make this system suitable for future incorporation into an automated microorganism detection device.
This journal is © The Royal Society of Chemistry 2015 |