Environmentally benign antifouling potentials of triterpene-glycosides from Streptomyces fradiae: a mangrove isolate

Abstract

In the present study, an attempt has been made to screen and evaluate the antifouling potentials of the actinobacterial strain Streptomyces fradiae RMS-MSU isolated from the manakkudy mangroves of Tamilnadu. Screening results showed that the ethyl acetate extract of S. fradiae RMS-MSU displayed a wide spectrum of antagonistic activity (10 to 21 mm) against marine biofilm bacterial strains with least minimal inhibitory concentrations (MIC) and maximum bactericidal concentrations (MBC). The extract showed promising antimicroalgal activity with MIC values ranging between 100 and 400 μg mL⁻¹. The anti-crustacean activity for 50% mortality (LC₅₀) of Artemia salina was recorded as 273.77 μg mL⁻¹. An EC₅₀ value of 77.03 μg mL⁻¹ for the 50% inhibition of byssus production and attachment of mussel Perna indica was observed. The crude extract of S. fradiae RMS-MSU showed an LC₅₀ value of 718.79 μg mL⁻¹ for 50% mortality of mussel. A therapeutic ratio (LC₅₀/EC₅₀) of 9.33 indicated the nontoxic nature of the extract. The mollusc foot adherence assay using the limpet Patella vulgata showed 6.66% fouling and 92.96% regaining at 7 mg mL⁻¹ after transfer to fresh seawater.

---

Introduction

Marine biofouling is defined as the growth of unwanted micro and macroorganisms on the surface of natural and artificial structures immersed in seawater and it has created huge material and economic losses towards controlling and maintenance of mariculture, naval vessels and seawater pipelines etc.^1,2 For instance, Bhadury and Wright³ have reported that the government and industry spend nearly 6.5 billion US % annually to control marine biofouling. Moreover, ecological implications related to biofouling include increased carbon emissions and potential dispersion of invasive alien species.^4,5 There are two major environmental pollutants formed by the fouling of hulls, which are an increase in gas emissions (CO₂, CO and SO₂) into the atmosphere and the dissemination of potentially rare fouling species.⁶ However, the decrease in NO_x emissions forced by air quality concerns will have a tendency to shrink the net warming effect due to tropospheric ozone and CH₄ concentrations. If the decrease in NO_x emissions is greater than the parallel augment in CO₂ emission, then the mutual effect of NO_x control could shrink the global warming impact of international shipping.⁷

Antifouling paints are mixtures of toxic materials/biocides (copper, lead, mercury and arsenic) used to control fouling organisms. However, organotin and tributyltin (TBT) are the most effective antifoulants. Studies pertaining to toxic biocides indicated that a high TBT concentration was detected in many marine organisms such as invertebrates, vertebrates and marine plants.⁸ This has led the International Maritime Organization (IMO) to prohibit the use of toxic organotin-based antifoulants and their application on ships from 2008 onwards.⁹ Therefore, it is essential to develop eco-friendly anti-fouling compounds from marine organisms. Natural antifoulants have been proposed as one of the best possible alternative approaches to replace TBT coatings.¹⁰ Recent studies have shown that bioactive compounds derived from marine organisms are much more effective and eco-friendly in nature.^11,12 Raveendran and Limna Mol¹³ reported that the majority of natural product antifouling compounds isolated from various marine organisms, such as sponges, soft corals, tunicates, bryozoans, marine crustaceans, seaweeds, seagrasses and mangroves are terpenoids, steroids, furanones and alkaloids etc. In addition, several researchers have also reported that the antifouling performance of marine microbes, such as bacteria (Pseudoalteromonas tunicata, Alteromonas sp., Shewanella sp.), fungi (Cladosporium sp.) and cyanobacteria isolated from marine resources were found to be good.^14–18

Actinomycetes are distributed extensively in soil and have provided a lot of information regarding bioactive compounds with potent pharmaceutical activity as well as suggesting that actinomycetes isolated from marine and mangrove sediments are an excellent source for discovering new types of halotolerant bioactive metabolites.¹⁹ However, studies related to antifouling metabolites isolated from mangrove associated actinomycetes are rare and few authors have reported the antifouling properties of marine actinomycetes and those isolated from deep sea sediments. More recently, Xu et al.²⁰ and Cho et al.²¹ have isolated 2-furanone and diketopiperazines from the deep sea marine actinobacterium Streptomyces sp. and proved its promising antifouling activities, viz. anti-larval, anti-diatom and seaweed spore settlement activities. Similarly, Xu et al.²² isolated the branched-chain fatty acid, 12-methyltetradecanoid acid (12-MTA) from the marine sediment isolate, Streptomyces sp. UST040711-290 and showed that it strongly inhibited the settlement of larval of polychaete Hydroides elegans. Considering the importance of actinomycetes, in the present study an attempt has been undertaken to explore the anti-fouling and toxic properties of the crude extract of the mangrove associated actinobacterium Streptomyces fradiae.

Results and discussion

Most of the actinomycetes were identified using the classical method, i.e. based on the colour of the mycelium, sporophore arrangement, pigment diffusion and sugar utilization patterns. However, the species level strain identification was carried out using 16S rRNA gene sequencing. In the present study, the candidate strain S. fradiae RMS-MSU was subjected to identification through polyphasic characters. The results inferred that the strain was Gram positive with filamentous mycelium. The substrate as well as aerial mycelium colour was observed to be yellow and pink, respectively. A spiral spore morphology was observed in the aerial mycelium under a light microscope (400×) and did not produce any pigments in yeast malt extract glucose agar medium. The optimum temperature and pH required for its growth was recorded as 35 °C and pH 8, respectively. The candidate strain had NaCl tolerance, up to 5% with an optimum level of 2%. The biochemical characters of the candidate strain such as urease, nitrate and citrate production showed a positive reaction, whereas H₂S, MR, VP and indole showed a negative reaction. In accordance with the present results, Kathiresan et al.³⁵ and Masilamani Selvam et al.³⁶ identified S. fradiae Rh1 through the classical method using various phenotypic characters.

Sugar utilization was an important tool for identifying the unknown actinomycetes up to the genus level. Considering the sugar utilization pattern of the tested strain, it was found to be highly positive to lactose, mannitol and maltose and moderately positive in utilizing fructose, xylose and galactose. However, a negative result was recorded towards utilizing glucose, sucrose and inositol as the carbon source. Furthermore, it showed a positive influence on hydrolyzing protein, lipid, starch, gelatin and pectin. The candidate strain showed the production of protease, lipase, amylase, gelatinase and pectinase enzyme. Nevertheless, it showed a negative result towards hydrolyzing cellulose (Table 1). The results obtained from the BLAST analysis showed a 100% similarity with the reference strain S. fradiae (accession number FJ972686). Subsequently, the candidate strain was deposited in the NCBI Genbank as S. fradiae RMS-MSU with the following accession number HQ267533 (Fig. 1).

Table 1 Morphology, biochemical and physiological characteristics of the RMS-MSU strain^a

Characters	Results
a +++: High positive; ++: moderate positive; +: positive; −: negative.
Cell shape	Mycelium
Colony morphology	Round & irregular, margin: concave & irregular
Aerial mycelium colour	Pink
Substrate mycelium colour	Yellow
Spore colour	Grey
Spore shape	Spiral
Diffusion colour	−
Melanoid pigment	−
Growth	Aerobic
Grams reaction	++
Range of temperature	20 to 40 °C
Optimum temperature	35 °C
Range of pH for growth	5 to 9
Optimum pH	7.5 to 8
NaCl tolerance (%)	0.5–5%
Optimum NaCl	2%
Urease	+
H2S production	−
Nitrate reduction	+
MR reaction	−
VP reaction	−
Indole production	−
Citrate utilization	+
Glucose	−
Mannitol	++
Lactose	++
Fructose	+
Sucrose	−
Xylose	+
Inositol	−
Maltose	+++
Galactose	+
Protein	++
Lipids	++
Starch	+
Cellulose	−
Gelatine	+
Pectin	+

---

Fig. 1 Phylogenetic relationship of S. fradiae RMS-MSU with closely related BLAST sequences.

Deterrence of marine fouling is linked to the control of attachment and development of the fouling assemblages of microfouling and macrofouling communities.³⁷ In the present study, the antimicrofouling activity of the crude extract of S. fradiae showed a maximum zone of inhibition of 19 to 21 mm against E. coli, H. aquamarina, Pseudomonas sp. 1., A. hydrophila, Vibrio sp., C. freundii, S. sonaii and S. fonticola, followed by 18 mm against M. morganii and S. liquefaciens. However, it recorded a lower inhibitory zone ranging between 10 and 12 mm against biofilm bacterial strains, such as Enterobacter sp., Micrococcus sp., Salmonella sp. and V. parahaemolyticus (Fig. 2). In accordance with the present study, Bavya et al.³⁸ investigated the anti-microfouling activity of the crude extract of S. filamentosus R1 against the marine fouling bacterial strains, such as Bacillus sp., Serratia sp. and Alteromonas sp., and confirmed its promising growth inhibitory activity.

Fig. 2 Anti-microfouling activity (zone of inhibition – mm) of the crude ethyl acetate extract of S. fradiae RMS-MSU against the biofilm bacterial strains.

The minimal inhibitory (MIC) and minimal bactericidal (MBC) concentrations of the crude extract were tested at different concentrations against the biofilm bacterial strains using 96 multi-well plates. Here, the lowest MIC of 25 μg mL⁻¹ was recorded against E. coli, Vibrio sp., V. parahaemolyticus, Micrococcus sp., Pseudomonas sp. 1., S. sonaii and Pseudomonas sp. 2. However, the results showed a considerable increase in MIC ranging between 50 and 200 μg mL⁻¹ against A. hydrophila, M. morganii, C. freundii, P. pudita, H. aquamarina, S. liquefaciens, S. mercescens and Enterobacter sp., respectively. Therefore, the results from the present study clearly demonstrate the promising bacteriostatic activity of the crude extract. However, the MBC values for the crude extract exhibited a relatively higher concentration against the test biofilm bacterial strains and varied from 100 to 400 μg mL⁻¹. The positive control (copper sulphate) exhibited 100% bacteriostatic (MIC) and bactericidal (MBC) activity at the lowest concentration ranging from 5 to 15 μg mL⁻¹ and 10 to 20 μg mL⁻¹, respectively (Fig. 3).

Fig. 3 Minimal inhibitory (MIC) and minimal bactericidal (MBC) concentrations tested on: (A) crude extract of S. fradiae and (B) copper sulphate (CuSO₄) against the biofilm bacterial strains.

Though the antifouling compounds were effective against many fouling organisms, they poorly inhibit fouling microalgal strains such as diatoms and cyanobacteria.³⁹ A recent study showed excellent anti-microalgal activity for the crude extracts of several marine bacterial strains, viz. Pseudoalteromonas sp.,⁴⁰ Bacillus sp.,⁴¹ P. aeruginosa,⁴² Aquimonas sp.,⁴³ Vibrio sp.,⁴⁴ Shewanella sp.⁴⁵ and Streptomyces sp. L74.⁴⁶ In the present study, crude extract of S. fradiae RMS-MSU effectively inhibited the growth of several microalgal strains. However, there was a significant variation in the inhibitory effect. It was found that 100–200 μg mL⁻¹ of the crude extract significantly inhibited the growth of Chlorella sp., Nannochloropsis sp. and Dunaliella sp. A further increase in concentration showed no growth of Chlorella sp., Nannochloropsis sp. and Dunaliella sp. Other microalgal strains such as Chaetoceros sp. and Tetraselmis sp. showed growth inhibition at 200 μg mL⁻¹ of extract. The results for copper sulphate (positive control) showed complete growth inhibition against all the tested microalgal strains at a much lower concentration of 10 μg mL⁻¹ (Table 2). In accordance with the result from the present study, Yamamoto et al.⁴⁷ studied the anti-microalgal properties of the crude extract of S. phaeofaciens S-9 and observed the growth inhibitory activity of cyanobacterial strains, such as Microcystis aeruginosa NIES 298, M. aeruginosa NIES 112, Anabaena ucrainica and Chlorella sp. at a concentration of 1000 μg mL⁻¹. Therefore, the results of the present study are in accordance with the previous findings and emphasize that the active principle localized within the extract effectively inhibited the growth of marine microfoulers.

Table 2 Antimicroalgal activity of the crude extract of S. fradiae RMS-MSU against marine microalgal strains^a

Microalgal strain	Control (only microalgal strain)	Different concentration of crude extract (μg mL^−1)						Positive control CuSO4 (10 μg mL^−1)
		25	50	100	200	400	800
a +++: Excellent growth; ++: good growth; +: moderate growth; −: no growth.
Chaetoceros sp.	+++	+++	+++	++	+	−	−	−
Chlorella sp.	+++	++	+	−	−	−	−	−
Nannochloropsis sp.	+++	++	++	+	−	−	−	−
Dunaliella sp.	+++	++	+	+	−	−	−	−
Tetraselmis sp.	+++	+++	+++	++	+	−	−	−

---

The marine crustacean A. salina was ideally suited as a bioassay organism for detecting the toxicity of crude organic extracts or other active compounds.⁴⁸ Moreover, their toxicity against A. salina may be an indication of the potential toxicity towards various marine crustacean families.⁴⁹ From the present results, it was observed that the S. fradiae extract had a good anti-crustacean activity against A. salina with an LC₅₀ value of 273.768 ± 2.76 μg mL⁻¹. Comparatively, copper sulphate (positive control) recorded the least LC₅₀ value of 9.35 ± 0.76 μg mL⁻¹. It was noticed that after 24 h, the percentage mortality of A. salina larvae was significantly (P < 0.05) increased with respect to an increase in the concentration of the crude extract as well as the copper sulphate (positive control) treated groups (Fig. 4). This result was in agreement with the observations of Anibou et al.⁵⁰ and Manivasagan et al.⁵¹ who investigated the lethality of active metabolites and the crude extract of Streptomyces spp. using A. salina nauplii with least toxicity levels.

Fig. 4 Anti-crustacean assay with different concentrations of: (A) copper sulphate (CuSO₄) and (B) crude extract of S. fradiae against A. salina larvae. The mean ± SD value indicates a significant percentage of mortality on A. salina in different test concentrations of the crude extract and copper sulphate compared with the control (one-way ANOVA, Dunnett test, *P < 0.05; ***P < 0.0001; # non-significant).

The mussel is one of the bivalve groups of major fouling organisms in both animate and inanimate surfaces immersed in marine environment. Often, they cause serious economic problems. Few authors have performed a laboratory assay using different mussel species as a model organism to study the antifouling properties of the crude extracts.^52,53 In the present study, the crude extract of S. fradiae and copper sulphate were tested against the brown mussel P. indica to determine the byssal thread inhibiting activity. The results showed that the 50% effective concentration (EC₅₀) of crude extract and copper sulphate for the inhibition of the byssal thread of P. indica after 24 h was 77.03 ± 1.96 μg mL⁻¹ and 5.47 ± 0.06 μg L⁻¹ respectively. The same mussels were subjected to a toxic criterion study, which inferred that after 72 h of exposure, the 50% lethal concentration (LC₅₀) was found to be 718 ± 1.55 μg mL⁻¹ for S. fradiae extract and 6.08 ± 0.03 μg L⁻¹ for copper sulphate. It was noticeable that increasing the test concentration of the crude extract and positive control showed a gradual reduction in the number of byssal threads formed and their subsequent attachment over the surface of the substrate (Table 3 and Fig. 5a and b).

Table 3 Toxicity profile (EC₅₀ and LC₅₀ values) of S. fradiae RMS-MSU against P. indica and A. salina^a

Fouling organism	Test animal	*EC50	*LC50	LC50/EC50	Mode of action
a * Mean ± SD of three observations; ND: not determined and ** referring to Qian et al., 2010.
Bivalve	P. indica (μg mL^−1)	77.03 ± 1.96	718.79 ± 1.55	9.33**	Less/non-toxic
Positive control – CuSo4 (μg L^−1)		5.47 ± 0.006	6.08 ± 0.003	1.1**	Highly toxic
Crustacean	A. salina (μg mL^−1)	ND	273.77 ± 2.76	ND	Less/non-toxic
Positive control – CuSo4 (μg L^−1)		ND	9.35 ± 0.76	ND	Highly toxic

---

Fig. 5 Inhibition of the byssal attachment and mortality of P. indica exposed to different concentrations of: (A) crude extract of S. fradiae RMS-MSU and (B) copper sulphate (CuSO₄).

Li et al.³¹ suggested that the LC₅₀/EC₅₀ values of active compounds/metabolites depend on the properties of the antifouling substances and their relative toxicity. Here, the LC₅₀/EC₅₀ ratio of the crude extract of S. fradiae was found to be 9.33 whereas copper sulphate had a LC₅₀/EC₅₀ ratio of 1.11, which indicated its potential toxicity over the mussel P. indica. The present results fell against the observations of Qian et al.¹¹ who reported that natural antifouling compounds with a LC₅₀/EC₅₀ ratio of >50 μg mL⁻¹ were considered as non-toxic and a higher LC₅₀/EC₅₀ ratio was highly recommended when selecting a candidate compound. However, the higher LC₅₀ value of S. fradiae against A. salina confirmed its non-toxic nature.

The mollusc foot adherence assay is a reliable method for evaluating the antifouling properties of marine natural products. This assay is based on the adherence of the foot to the substrate through spreading and shrinkage with respect to the antifouling compounds. In this study, an attempt was taken to determine the fouling (%) and regaining (%) capacity of the foot of the common limpet P. vulgata against the crude extract of S. fradiae RMS-MSU (Fig. 6). The results showed 66.66 to 93.33% fouling of P. vulgata in 2, 3 and 4 mg mL⁻¹ concentrations of the extract coated plates. However, after 10 min exposure to fresh seawater, 33.33% to 72.22% regaining of foot spreading and adherence was noticed in 2, 3 and 4 mg mL⁻¹ of concentrations of the extract, respectively. A further increase in the concentration of the extract to 5 and 6 mg mL⁻¹ inferred a gradual decrease in the fouling of P. vulgata to 40.0% and 13.33% with the regaining of 78.25 ± 5.02 and 84.72 ± 4.94%, respectively. P. vulgata exposed at 7 mg mL⁻¹ concentration of crude extract coated plate showed only 6.66% fouling due to immediate reflex in shrinkage of the foot and loss of mobility of the foot over the substrate. In addition, after being transferred to fresh seawater, only 92.96% regaining and spreading of the foot was recorded. P. vulgata exposed to 8 mg mL⁻¹ concentration showed a complete inhibition (0% fouling) of foot adherence (spreading)/fouling over the extract coated plate. The results using copper sulphate showed that at 1 mg mL⁻¹ concentration, it displayed 23% fouling of P. vulgata, but after transfer to fresh seawater, 10% regaining was recorded. Further, a progressive increase in concentration, i.e. at 2 mg mL⁻¹, the foot of the limpets shrunk well and did not show any positive regaining. The results of the present study was in accordance with those reported by Selvin and Lipton,³² wherein the adherence (100% fouling) of P. vulgata was completely inhibited at a 4.02 mg mL⁻¹ concentration of the methanolic extract of Holothuria, Holothuria scabra. Similarly, Aseer et al.⁵⁴ in their study pointed out that the methanolic extract of mangrove A. marina showed 100% molluscicidal activity at a 6 mg mL⁻¹ concentration and at the same concentration showed 80% regaining of foot spreading and adherence. The results of the present study indicated that the S. fradiae RMS-MSU extract possesses promising anti-molluscan properties.

Fig. 6 Anti-molluscicidal activity of the crude extract of S. fradiae RMS-MSU and copper sulphate (CuSO₄) against the marine limpet P. vulgate. The mean value indicates a significant percentage of fouling and regaining of P. vulgata in different test concentrations compared with the control (one-way ANOVA, Dunnett test, *P < 0.05; **P < 0.01; ***P < 0.0001 and # non-significant).

In the present study, the crude extract of S. fradiae was purified using normal phase silica gel column chromatography. Altogether 32 fractions were collected, among them the 25^th fraction showed excellent antifouling properties against the marine fouling bacteria and microalgal strains (Table S1 and S2†). The bioassay guided column fraction (25^th fraction) was further purified and characterized by TLC. The TLC results showed the existence of three spots, viz. 0.54, 0.63 and 0.76 under visualization with UV light. Among these spots, the R_f value of 0.63 rendered the maximum inhibitory activity against fouling bacterial strains when tested through TLC bioautography (Fig. S1†). Besides, the chemical constituents of the bioassay guided spot in TLC plate sprayed with the Liebermann–Burchard's reagent showed a fluorescent dark violet color (R_f = 0.63) under visualization with long wavelength UV light (365 nm), which indicated the presence of triterpene-glycosides. In agreement with the results of the present study, Manivasagan et al.^55,56 reported that the chemical constituents, such as sesquiterpenes, terpenoids, polyketides, peptides, carprolactones, butenolides, quinones, alkaloids, macrolides, esters, methyl pyridine, lactams and chinikomycins isolated from marine actinomycetes exhibit many pharmacological properties. For instance, Kubanek et al.⁵⁷ showed that the triterpene-glycoside isolated from the marine sponges Erylus formosus and Ectyoplasia ferox showed promising antifouling activity against marine invertebrate and algal species in low concentrations in a field trial up to 90 days.

Infrared (IR) spectroscopy showed the presence of several possible functional groups in the wavenumber range from 721.33 to 3394.48 cm⁻¹. The broadband at 3394.48 cm⁻¹ (s) was attributed to the presence of a phenolic OH group. The sharp peak (s) observed at 3029.96, 2923.88 and 2854.45 cm⁻¹ indicates the presence of alkene groups [CH₂, CH₃]. The presence of aldehydes (H–C=O: C–H) was noticed by registering the peaks at 2700.15 and 2628.79 cm⁻¹. A single peak was recorded at 2401.85 cm⁻¹, which shows the presence of a nitrile group. A sharp peak at 1741.60 cm⁻¹ (s) marks the presence of esters with saturated aliphatics. Likewise, the medium peak recorded at 1649.02 cm⁻¹ (m) indicates the presence of primary amines (N–H). Two sharp (s) stretches observed at 1548.73 and 1529.44 cm⁻¹ represent the nitro group (N–O–). Another two peaks exhibiting a medium stretch (1460.01 cm⁻¹ (m) stretch rocks in CH₃) and sharp stretch (1375.15 cm⁻¹ (m) stretch bends in CH₂) were identified as an alkane group (C–H–). Four medium peaks recorded at 1240.14, 1163.00, 1097.42 and 1053.06 cm⁻¹ (m) revealed the presence of an aliphatic amine (C–N–). Finally, two separate peaks found at 975.91 (=C–H bend) and 721.33 cm⁻¹ (C–H – out plane rocks) imply the presence of alkenes groups (Fig. S2†). The presence of all the above mentioned functional groups indicate that the triterpene-glycosides in the bioassay guided column of S. fradiae RMS-MSU may contribute to bioactivity. Perusal of the literature showed the pharmaceutical importance of triterpene-glycosides in the crude/purified extract of several marine and terrestrial organisms through FT-IR spectroscopy and other spectral analysis.^58–60

Conclusions

The overall results of the present study clearly emphasize the antifouling potential of S. fradiae RMS-MSU against both micro and macrofouling organisms, and substantiate their low toxic nature. Further research on the purification and identification of the active antifouling compounds and field trial experiments are ongoing towards the development of novel eco-friendly antifouling coatings.

Experimental section

Chemicals and solvents

In the present study, the chemicals used have 95% purity and the solvents such as hexane, benzene, ethyl acetate and methanol were of HPLC grade. Microbiological media and other chemicals were purchased from Himedia, India. The genomic DNA isolation kit and PCR kit were purchased from Genei, Bangalore, India.

Candidate actinomycetes strain RMS-MSU and its taxonomical characteristics

The antifouling metabolite producing strain S. fradiae RMS-MSU was isolated from the rhizosphere soil of the mangrove plant Rhizophora mucronata collected from the Manakkudy mangrove ecosystem (77°-7-77°35′ E and 8°-8-35′ N) off the southwest coast of Tamilnadu, India. The candidate strain was maintained on yeast malt extract glucose medium (ISP-2; Himedia, Mumbai, India) (yeast extract: 4 g; malt extract: 10 g; glucose: 4 g; 50% filter sterilized seawater and pH 7.3 ± 2) and preserved in 20% glycerol at 4 °C for prolonged usage. The colony morphology (mycelium color) of RMS-MSU was noticed on yeast malt extract medium (ISP-2) at 37 °C for 7 days. The structure of the spores was examined by the slide culture method described by Nonomura²³ and the spore structure was observed under a light microscope with camera attached at 400× magnification (Coslab, Model no; HL23, Haryana, India). Physiological, biochemical and utilization of carbon sources by the candidate strain were carried out by following the procedures reported by Shirling and Gottlieb.²⁴

Molecular characterization of candidate strain RMS-MSU

Extraction of the genomic DNA of the candidate strain RMS-MSU was carried out by following the procedure reported by Kumar et al.²⁵ In brief, the genomic DNA was separated and purified using a DNA isolation and purification kit (Genei, Bangalore). The 16S rRNA gene was amplified using universal primers (16S F 5′ AGAGTTTGATCCCTGGCTCAG 3′ and 16S R 5′ GTACGGCTACCTTGTTACGAC 3′). The amplification was performed (Eppendorf gradient thermocycler 96, California, US) by the following steps: an initial denaturation step for 2 min at 94 °C, thereafter 30 amplification cycles consisting of denaturation at 94 °C for 1 min, followed by annealing at 55 °C for 1 min and then a final extension step consisting of 2 min at 72 °C. The total PCR amplicon was analyzed with 1% agarose gel electrophoresis and sequenced using a genetic analyzer (Applied Bio systems, USA). The comparison of the 16S rRNA gene sequence of the candidate strain RMS-MSU with other actinobacterial sequences was matched using the NCBI-BLAST database program and identified as Streptomyces fradiae RMS-MSU. The 16S rRNA sequence was deposited in the NCBI and its accession number (HQ267533) was obtained. The phylogenetic tree was constructed by the Neighbor-Joining (NJ) and Kimura two pair method and the topologies were evaluated by performing bootstrap analysis of 1000 sets using MEGA 4.0 software (The Biodesign Institute, Tempe, AZ, USA).²⁶

Fermentation and extraction of the secondary metabolites of S. fradiae RMS-MSU

In the present study, the seed culture was prepared by inoculating a loopful of mature sporulating S. fradiae RMS-MSU in 100 mL of yeast malt extract glucose broth medium at 150 rpm for 4 days at room temperature. Then, the S. fradiae RMS-MSU was mass cultivated in the optimized broth medium (mannitol: 10 g, yeast extract: 10 g, NaCl: 10 g, pH: 7.5, 1000 mL distilled water). About 20 L of autoclaved optimized broth medium was prepared in 10 × 2.5 L Erlenmeyer conical flasks, cooled and the 5% seed culture was inoculated and incubated at 150 rpm for 10 days. After the incubation period, the culture broth was centrifuged at 10 000 rpm for 20 min at 4 °C. Finally, the spent culture free broth was filtered through 0.45 and 0.22 μ cellulose membrane filter paper and the filtrate extracted with an equal volume (1 : 1 ratio) of ethyl acetate (HPLC grade, Himedia) at 120 rpm for 3 days. Then, the organic fraction was collected using a separating funnel and concentrated using a rotary vacuum evaporator (GOEL, GRFE-2, Gujarat, India) at 35 °C. Finally, the crude extract obtained was weighed and stored in pre-weighed clean glass vials at 4 °C.

Selection of the marine biofilm bacterial and microalgal strains

In total, 17 different marine biofilm bacterial strains, such as Aeromonas hydrophila (JN561697); Halomonas aquamarina (JN561698); E. coli (JN585664); Vibrio sp. (JN585665); Morganella morganii (JN596112); Citrobacter freundii (JN585667); Vibrio parahaemolyticus (JN585666); Enterobacter sp. (JF970207); Salmonella sp. (JN596113); Micrococcus sp. (JN596114); Serratia liquefaciens (JN596115); Pseudomonas sp. 1 (JN596116); Shigella sonnei (JN596117); Serratia marcescens (JN596118); Pseudomonas sp. 2 (JN596119); Pseudomonas putida (JN596120); and Serratia fonticola (JN596121) were isolated from marine substrates immersed in Thondi Coastal Water, Palk Bay, Tamilnadu, India and identified by 16S rRNA gene sequencing. Marine fouling microalgal strains such as Chaetoceros sp., Chlorella sp., Nannochloropsis sp., Dunaliella sp. and Tetraselmis sp. were obtained from the marine algal culture unit, CMFRI (Central Marine Fisheries Research Institute), Tuticorin, Tamilnadu, and the individual seed culture was maintained in Conway medium at 20 °C with a 12 h light period for 7 days.

Anti-microfouling assays

Anti-bacterial activity against the marine biofilm bacterial strains. The crude extract of S. fradiae RMS-MSU was tested against the marine biofilm bacterial strains using the agar well diffusion method.²⁷ In brief, biofilm bacterial strains at logarithmic phase were seeded individually on Mueller Hinton Agar (MHA) with 50% sterile seawater and the wells prepared using a sterile cork borer. Finally, each well was filled with 100 μL of DMSO (dimethyl sulphoxide) containing 400 μg mL⁻¹ of crude extract. DMSO (100 μL) was used as a negative control, whereas copper sulphate (20 μg mL⁻¹) was used as a positive control. The agar plates were incubated at 32 °C for 24 h. After the specified incubation period, the zone of inhibition was measured in mm from the edge of the well. Each assay was carried out in triplicate. Furthermore, the MIC and MBC concentrations were assessed through 96 well microplate assays (Flat Bottom; Polystyrene, Eppendorf, India) following the method of Sharma and Kumar.²⁸ Briefly, the different concentrations (6.25 to 400 μg mL⁻¹) of crude extract and positive control (copper sulphate) ranged from 5 to 20 μg mL⁻¹ were prepared and loaded in a 96 clear polystyrene plate using methanol : ethyl acetate at 3 : 1 as the carrier solvent and evaporated under sterile conditions. Thereafter, 1 × 10⁸ CFU mL⁻¹ cell densities (Amsterdam, 1996) of 100 μL of each biofilm bacterial inoculum were added into each well. Well plates containing only the biofilm bacterial strains suspension were used as a negative control and incubated at 30 °C for 24 h, each well was examined for microbial growth by turbidity observations. To determine the MIC and MBC, a loopful of inoculum was streaked onto Zobell marine agar plates and incubated at 37 °C for 24 h.²⁷ The concentration which inhibits the bacterial growth was recorded as the MIC value and the one in which there is no visible bacterial growth on the ZMA plates as the MBC.

Anti-microalgal assay against marine fouling microalgae. The anti-microalgal assay was also conducted with different concentrations (25, 50, 100, 200, 400 and 800 μg mL⁻¹) of the crude extract of S. fradiae RMS-MSU and the positive control, copper sulphate (10 μg mL⁻¹) separately using methanol : ethyl acetate (3 : 1) as the carrier solvent loaded in a 96 clear polystyrene plate (polymeric materials). The assay was started with an initial cell density of 1 × 10⁵ cells per mL for each marine microalgal strain. Then, the plates were incubated at 20 °C under 12 h light periods for five days. The lowest concentration of crude extract, where no algal growth was observed in 4 to 6 wells was recorded as the minimum inhibitory concentration.²⁹

Anti-crustacean assay. In the present study, the anti-crustacean assay was conducted using brine shrimp Artemia salina larvae (II in star) as a model organism. The anti-crustacean assay was performed using the 24 well clear polystyrene plate (polymeric materials) method.³⁰ For the toxicity test, 500 μL at different concentrations (25 to 500 μg mL⁻¹) of the crude extract of S. fradiae RMS-MSU was coated onto the 24 well microplates and the solvent evaporated at room temperature under sterile conditions. Then, ten live and healthy (most active swimming) larvae of A. salina were introduced into the coated microplate with 500 μL of filtered sterile seawater. After 24 h of incubation at 25 °C, the mortality was counted in each concentration loaded well. Copper sulphate (2.5 to 80 μg mL⁻¹) was used as a positive control, whereas wells free of extract and copper sulphate served as a negative control. The percentage of mortality noticed after 24 h was recorded and the LC₅₀ value calculated using probit analysis. The assay was carried out in triplicate.

Anti-macrofouling assay

Byssal thread inhibitory activity of the crude extract. The method described by Iyapparaj et al.⁵ was followed for the mussel bioassay. For the present study, the brown mussel, Perna indica with a uniform size range (1.5 to 2 cm length) was used. Before starting the experiment, the byssal threads of all the mussels were scrapped off completely and ten young and healthy mussels were introduced into individual beakers containing 100 mL of filtered and sterilized seawater. Then, the different concentrations of crude extract (50 to 800 μg mL⁻¹) were dissolved individually in DMSO and introduced into the experimental beakers. Beakers containing only seawater were used as the negative control, whereas seawater with copper sulphate (CuSO₄) was used as the positive control (1–124 μg mL⁻¹). The experiment was carried out in triplicate. The beakers were then incubated at room temperature with mild aeration (dissolved oxygen ranging from 4.2 to 5.1 mL L⁻¹). The settlement of the mussels at each concentration was recorded after 24 h. The EC₅₀ (effective concentration at which 50% of mussel showed inhibition of byssal attachment) was recorded based on the minimum concentration, which prevented byssal thread production and their subsequent attachment. The LC₅₀ value was estimated using probit analysis, after exposing the P. indica in test concentrations of the extract for 96 h. In the toxicity assay, the same mussels used in LC₅₀ estimation, which failed to develop byssal thread in seawater containing the crude extract were transferred to the extract free seawater and observed for 72 h for byssal production and attachment. The therapeutic ratio (LC₅₀/EC₅₀) value was calculated for the active extract to test its non-toxic nature.^11,31

Mollusc foot adherence assay on Patella vulgata. The mollusc foot adherence assay is a more rapid and reliable assay methodology, which requires a minimum quantity of the test compound to determine its effect on the settlement of mollusc by the spreading of their foot.³² In the present study, the common limpet, Patella vulgata, a rocky common fouler was used as a model organism to describe the anti-fouling properties of the crude ethyl acetate extract of S. fradiae RMS-MSU. Collected limpets were transported to the laboratory in a plastic container with aerated seawater. Before starting the experiment, they were acclimatized in the laboratory conditions for four days in seawater filled, sand bedded FRP tank. During the course of acclimatization, they were fed ad libitum with algae Ulva fasciata. The assay was performed in a series of assay plates (100 mm Petri plates). Briefly, the assay plates were spread evenly with different concentrations (1 to 7 mg mL⁻¹) of crude extract of S. fradiae RMS-MSU and subsequently evaporated to dryness in a hot air oven at 35 °C to obtain a uniform film of the extract. Plates containing concentrations of 1 and 2 mg mL⁻¹ copper sulphate as the positive control were maintained separately. Then, one third of all the coated plates were filled with filtered seawater, the control plate without extract was also maintained separately. The whole setup was carried out on the transparent glass surface to observe the foot reflex. The assay was performed in triplicate at a rate of 10 animals per plate. The immediate foot reflex and mobility was monitored continuously until the foot was completely shrunken. Similarly, fouling and the regaining percentage (only unsettled organisms) on the coated plates were also recorded.

Purification and partial characterization of the active metabolites

Purification of the bioassay guided fraction using chromatography techniques. The crude extract (1.5 g) of S. fradiae was purified using normal phase silica gel column chromatography (60–200 μm mesh size) with a stepwise gradient of solvents, including hexane, benzene, ethyl acetate, methanol and ending with warmed methanol. In total, 32 fractions (each 20 mL) were collected, dried under gloomy conditions and then all the fractions (100 μg mL⁻¹) were screened individually against both biofilm bacterial and microalgal strains through microplate assays. Amongst the fractions, the 25^th fraction showed the best antifouling properties over the other fractions. Furthermore, the 25^th fraction was purified by thin layer chromatography (TLC).²⁷ In brief, the 25^th fraction was redissolved in ethyl acetate : methanol (6 : 4) and made up to a volume of 100 mg mL⁻¹. From this, 100 μL was taken and spotted on TLC plates (TLC aluminum sheets, 20 × 20 cm, silica gel 60F₂₅₄, Merck, USA) using the same solvent systems as the mobile phase. Thereafter, the TLC plates were dried at room temperature and observed under UV/vis absorption (Bio-Rad; AlphaImager™ 3300) for detection and marking different spots at different wavelengths of 254 and 365 mm. The R_f values of the TLC plate were then calculated and recorded. Thereafter, the TLC plates were tested against fouling bacterial strains through TLC bioautography.²⁷

Chemical constituents and FT-IR analysis of the bioassay guided fraction. The chemical constituents of the bioassay guided fraction were identified through a conventional TLC plate spray method.³³ In brief, the TLC plate was sprayed with the Liebermann–Burchard reagent (a mixture of 5 mL acetic anhydride and 5 mL of 97% sulfuric acid prepared in 50 mL of chilled ethanol) and kept in a hot air oven for 10 min at 110 °C. Afterwards, the plate was visualized under UV light with short and long wavelength (365 nm) for the detection of triterpene glycosides. Furthermore, the presence of possible functional groups in the bioassay guided fraction of S. fradiae was also determined using Fourier transform infrared spectroscopy (Shimadzu FTIR-820 IPC, Japan), the frequency of the spectral analysis was set between 4000 and 400 cm⁻¹.³⁴

Statistical analysis

The results obtained in the present study were subjected to relevant statistical analysis using one-way ANOVA and further post hoc multiple comparison using the Dunnett test with varying levels of significance (P < 0.05; P < 0.01; P < 0.001; P < 0.0001) using the SPSS -16 version (SPSS Inc, Chicago, USA) and the EC₅₀ and LC₅₀ values for A. salina and P. indica were calculated in probit analysis using the EPA software (Environmental Protection Agency, Cincinnati, Ohio, USA).

Acknowledgements

The first author Santhiyagu Prakash wishes to acknowledge the authorities of the Center for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam, Nagercoil, Kanyakumari District, Tamilnadu, India for providing facilities to carry out this work.

Notes and references

1. A. G. J. Buma, S. B. Sjollema, W. H. vande-Poll, H. J. C. Klamer and J. F. Bakker, J. Sea. Res., 2009, 61, 133.
2. D. M. Yebra, S. Kill and K. Dam-Job Ansen, Prog. Org. Coat., 2004, 50, 75.
3. P. Bhadury and C. Wright, Planta, 2004, 219, 561.
4. A. Silkina, A. Bazes, J. Mouget and N. L. Bourgougnon, Mar. Pollut. Bull., 2012, 64, 2039.
5. P. Iyapparaj, P. Revathi, R. Ramasubburayan, S. Prakash, A. Palavesam, G. Immanuel, A. Sautreau and C. Hellio, Ecotoxicol. Environ. Saf., 2014, 103, 54.
6. J. P. Rodrigue, Growth Change, 2006, 37, 510.
7. H. Agrawal, W. A. Welch, J. W. Miller and D. R. Cocker, Environ. Sci. Technol., 2008, 42, 7098.
8. C. Alzieu, J. Sunjuan, J. P. Deltreil and M. Borel, Mar. Pollut. Bull., 1986, 17, 494.
9. I. Omae, Appl. Organomet. Chem., 2003, 17, 81.
10. L. D. Chambers, K. R. Stokes, F. C. Waish and R. J. K. Wood, Surf. Coat. Technol., 2006, 20, 3642.
11. P. Y. Qian, Y. Xu and N. Fusetani, Biofouling, 2010, 26, 223.
12. D. Blihoghe, E. Manzlo, A. Villela, A. Cutignano, G. Picariello, M. Faimali and A. Fontana, Biofouling, 2011, 27, 99.
13. T. V. Raveendran and V. P. Limna Mol, Curr. Sci., 2009, 97, 508.
14. S. Egan, S. James, C. Holmstrom and S. Kjelleberg, FEMS Microbiol. Ecol., 2001, 35, 67.
15. R. A. Long, A. Qureshi, D. J. Faulkner and F. Azam, Appl. Environ. Microbiol., 2003, 69, 568.
16. H. U. Dahms, X. Ying and C. Pfeiffer, Biofouling, 2006, 22, 317.
17. H. D. Bhattarai, V. S. Ganti, B. Paudel, Y. K. Lee, H. K. Lee, Y. K. Hong and H. W. Shin, World J. Microbiol. Biotechnol., 2007, 23, 243.
18. S. H. Qi, Y. Xu, H. R. Xiong, P. Y. Qian and S. Zhang, World J. Microbiol. Biotechnol., 2012, 25, 399.
19. D. B. Xu, W. W. Ye, Y. Han, Z. X. Deng and K. Hong, Mar. Drugs, 2014, 12, 2590.
20. Y. Xu, H. He, S. Schulz, X. Liu, N. Fusetani, H. Xiong, X. Xiao and P. Y. Qian, Bioresour. Technol., 2010, 101, 1331.
21. J. Y. Cho, J. Y. Kang, Y. K. Hong, H. H. Baek, H. W. Shin and M. S. Kim, Biosci., Biotechnol., Biochem., 2012, 76, 1116.
22. Y. Xu, H. Li, X. Li, X. Xiao and P. Y. Qian, Mar. Biotechnol., 2009, 11, 95.
23. H. Nonomura, J. Ferment. Technol., 1974, 52, 78.
24. E. B. Shirling and D. Gottlieb, Int. J. Syst. Bacteriol., 1966, 16, 313.
25. V. Kumar, A. Bharti, O. Gusain and G. S. Bisht, Journal of Science, Engineering & Technology Management, 2010, 2, 10.
26. N. Saitou and M. Nei, Mol. Biol. Evol., 1987, 4, 406.
27. S. Prakash, R. Ramasubburayan, C. Jinitha Mary, P. Iyapparaj, C. Kumar, A. Palavesam and G. Immanuel, Indian J. Geo-Mar. Sci., 2013, 42, 888.
28. B. Sharma and P. Kumar, Int. J. Appl. Res. Nat. Prod., 2009, 1, 5.
29. S. Prakash, N. K. Ahila, V. Sri Ramkumar, J. Ravindran and E. Kannapiran, Biocatal. Agric. Biotechnol., 2015, 4, 114–121.
30. Y. Zhang, J. Mu, J. Han and X. Gu, Toxicol. Mech. Methods, 2012, 22, 23.
31. Y. X. Li, H. X. Wu, Y. Xu, C. L. Shao, C. Y. Wang and P. Y. Qian, Mar. Biotechnol., 2013, 15, 552.
32. J. Selvin and A. P. Lipton, Curr. Sci., 2002, 83, 735.
33. H. Wagner, S. Bladt and E. M. Zgainsky, Plant Drug Analysis: A Thin Layer Chromatography Atlas, Springer, Berlin, 2nd edn, 1984, p. 320.
34. W. Kemp, Organic Spectroscopy, Macmillan Press Ltd., London, UK, 3rd edn, 1991, p. 227.
35. K. Kathiresan, R. Balagurunathan and M. Masilamani Selvam, Indian J. Biotechnol., 2005, 4, 271.
36. M. Masilamani Selvam, R. Balagurunathan and K. Kathiresan, J. Pharma Res., 2010, 3, 909.
37. E. Plouguerne, C. Hellio, C. Cesconetto, M. Thabard, K. Mason, B. Veron, R. C. Pereira and B. A. P. da Gama, J. Appl. Phycol., 2010, 22, 717.
38. M. Bavya, P. Mohanapriya, R. Pazanimurugan and R. Balagurunathan, Indian J. Geo-Mar. Sci., 2011, 40, 578.
39. P. J. Molino and R. Wetherbee, Biofouling, 2008, 24, 365.
40. B. Wang, X. R. Yang, J. Lu, Y. Zhou, J. Su, Y. Tian, J. Zhang, G. Wang and T. Zheng, Harmful Algae, 2012, 13, 83.
41. Y. S. Kim, D. S. Lee, S. Y. Jeong, W. J. Lee and M. S. Lee, J. Microbiol., 2009, 47, 9.
42. H. Ren, P. Zhang, C. Liu, Y. Xue and B. Lian, World J. Microbiol. Biotechnol., 2010, 26, 465.
43. C. Yaqing, Y. Xuaoyu, Z. Fengge, Y. Xingming and S. Qirong, Chin. J. Appl. Environ. Biol., 2012, 18, 752.
44. L. Fu, X. An, D. Li, L. Zhou, Y. Tian and T. Zheng, World J. Microbiol. Biotechnol., 2011, 27, 2949.
45. K. L. Pokrzywinski, A. R. Place, M. E. Warner and K. J. Coyne, Harmful Algae, 2012, 19, 23.
46. J. Luo, Y. Wang, S. Tang, J. Liang, W. Lin and L. Luo, PLoS One, 2013, 8(10), e76444.
47. Y. Yamamoto, T. Kouchiwa, Y. Hodoki, K. Hotta, H. Uchida and K. I. Harada, J. Appl. Phycol., 1998, 10, 391.
48. G. E. Lewis, S. Afr. J. Sci., 1995, 91, 382.
49. V. Samoylenko, D. C. Dunbar, A. Md Gafur, S. I. Khan, S. A. Ross, J. S. Mossa, F. S. El Feraly, B. L. Tekwani, J. Bosselaers and I. Muhammad, Phytother. Res., 2008, 22, 1570.
50. M. Anibou, A. Chait, A. Zyad, M. Taourirt, Y. Ouhdouch and A. Benherref, World J. Microbiol. Biotechnol., 2008, 24, 2019.
51. P. Manivasagan, S. Gnanam, K. Sivkumar, T. Thangaradjou, S. Vijalakshmi and T. Balasubramanian, Adv. Biol. Res., 2009, 3, 231.
52. C. Hellio, N. Bourgougnon and Y. Le Gal, Biofouling, 2000, 16, 235.
53. B. A. P. da Gama, R. C. Pereira, A. R. Soares, V. L. Teixeira and Y. Y. V. Alentin, Biofouling, 2003, 19, 161.
54. M. Aseer, S. Sujith, G. Seghal Kiran, J. Selvin and C. Shakir, Global J. Biotechnol. Biochem., 2009, 4, 59.
55. P. Manivasagan, J. Venkatesan, K. Sivakumar and S. K. Kim, Microbiol. Res., 2013, 168, 311.
56. P. Manivasagan, J. Venkatesan, K. Sivakumar and S. K. Kim, Microbiol. Res., 2014, 169, 262.
57. J. Kubanek, K. E. Whalen, S. Engel, S. R. Kelly, T. P. Henkel, W. Fenical and J. R. Pawlik, Oecologia, 2002, 131, 125.
58. S. V. Dyck, G. Caulier, M. Todesco, P. Gerbaux, I. Fournier, M. Wisztorski and P. Flammang, J. Exp. Biol., 2011, 214, 1347.
59. L. A. Yakovishin, D. Y. Belash and I. R. Yarovoy, Ukr. Bioorg. Acta, 2012, 1, 38.
60. J. Colorado-Ríos, D. Muñoz, G. Montoya, D. Márquez, M. E. Márquez, J. Lópezm and A. Martínez, Mar. Drugs, 2013, 11, 4815.

---

Footnote

† Electronic supplementary information (ESI) available. See DOI: 10.1039/c4ra15335a

---