Injectable hybrid hydrogel-mediated calcium-sensing receptor (CaSR) activation for enhanced osteogenesis and bone remodeling

Grace Felciya Sekar Jeyakumar ab, Poornima Velswamy c, Deebasuganya Gunasekaran ab, Alexandar Vincent Paulraj c, Nivethitha Paneerselvam Manimegalai ab and Uma Tiruchirappalli Sivagnanam *ab
aBiological Materials Laboratory, CSIR-Central Leather Research Institute, Sardar Patel Road, Adyar, Chennai, India
bDepartment of Leather Technology, Alagappa College of Technology, Anna University, Chennai, India
cDepartment of Pharmacology and Therapeutics, Institute of Systems Molecular and Integrative Biology, University of Liverpool, UK

Received 5th March 2025 , Accepted 1st July 2025

First published on 4th July 2025


Abstract

Injectable hydrogels have transfigured bone tissue engineering by offering minimally invasive solutions for treating irregularly shaped critical-size bone defects. Unlike traditional fixed-shaped bone grafts that require invasive surgeries and precise defect matching, injectable hydrogels adapt to defect geometries and accelerate healing. The hydrogels mimic the extracellular matrix with their porous, interconnected 3D architecture, promoting cell adhesion, proliferation, differentiation, vascularization, and nutrient flow, which are essential for effective bone regeneration and affirm the osteoconductivity. Chitosan–alginate hydrogels are particularly promising due to their mechanical stability, biodegradability, and ability to deliver bioactive compounds sustainably. To enhance its osteoinductive properties, bioinorganic ions such as strontium (Sr2+)-based hybrid nanocomposites have been explored. Strontium has garnered attention for its ability to activate the calcium-sensing receptor (CaSR)-mediated signaling pathways by regulating bone resorption and bone formation by various bone matrix proteins, thereby promoting bone homeostasis and regeneration. Strontium's ionic similarity to calcium enables it to act as a robust activator of CaSR, triggering pathways that enhance bone regeneration. Building on this, we developed an innovative hybrid material hydrogel by reinforcing the chitosan–alginate hydrogels with a Sr–Fe–TQ (strontium–iron–thymoquinone) nanocomposite. This bioengineered hydrogel system demonstrated excellent hemocompatibility (in human RBCs), cytocompatibility, biocompatibility, and enhanced efficiency in vitro in MG-63 osteoblast-like cells. In vivo studies using a rabbit critical-size defect model showed accelerated bone remodeling, achieving better defect closure and superior bone volume restoration (∼99%) compared to the controls. This study underscores the transformative potential of the Sr–Fe–TQ hydrogel as an injectable, osteoconductive, and osteoinductive scaffolds for critical-size defect repair. By combining minimally invasive delivery, sustained bioactive release, and superior regenerative outcomes, this hydrogel system addresses key challenges in bone tissue engineering, paving the way for next-generation biomaterials in regenerative medicine.


1. Introduction

Injectable hydrogels have caught the attention of biomaterial scientists for bone tissue engineering due to their minimally invasive procedure, which can replace implantation surgery.1,2 Implantation surgery using fixed-shaped bone grafts has shown complications in cases of irregular and twisted shape defects. Since the framework of the defect boundary must be adjusted to match the inserted implant, the healing is delayed. Hence, the injectable hydrogel can be used in irregularly shaped critical-size defects for accelerated bone regeneration. Hydrogels are 3-dimensional structures with a porous interconnected structure that mimics the natural extracellular matrix.3 Two or more polymers can be used to fabricate multi-component hydrogels to form interpenetrating polymer networks.3 The 3-dimensional architecture of the hydrogel exhibits excellent cell adhesion, proliferation, and differentiation.4 It also aids in the infiltration, flow of nutrients and oxygen, vascularization, and angiogenesis, which are essential parameters for bone regeneration. The swelling property of the hydrogel makes it an exceptional drug delivery vehicle and seedbed for cells, aiding in osteoconduction. The chitosan–alginate system is a versatile hydrogel system used in tissue engineering applications.5 This hydrogel system provides mechanical stability, biodegradability, and sustained delivery of compounds.6–8 A potent bone implant should possess osteoinductive properties in addition to its osteoconductive properties to assist in bone regeneration. Among various osteoinductive compounds, bioinorganic ions are those that need to be explored for their application in bone regeneration.9 Bone regeneration occurs in 4 stages, namely, hematoma formation/inflammation, soft callus formation, hard callus formation, and remodeling (mineralization and bone matrix formation). CaSR is one of the important signaling pathways that participate in the bone regeneration process. It is a G-protein-coupled receptor family that regulates the Ca2+ concentration in the extracellular matrix. The binding of Ca2+ to the CaSR activates multiple signal transduction pathways, such as ERK1/2 MAPK, Wnt/β-catenin to regulate the bone-forming cells osteoblasts, and the RANK/RANKL/OPG, NF-κB pathway to regulate bone-resorbing cells osteoclasts.10,11 The osteoblasts secrete various bone matrix proteins such as osteopontin (OPN), osteoprotegerin (OPG), osteonectin (SPARC), collagen I, procollagen (ADAMTS-2), and osteocalcin (OCN), which play major roles in the CaSR pathways to contribute to bone regeneration. Strontium ions, which are known to play a role in the calcium-sensing receptor, mediate osteogenesis by activating several signaling pathways for bone regeneration. Due to the ionic similarities of Sr2+ and Ca2+ ions, the Sr2+ ions act as a complete activator of the CaSR when compared to other divalent and trivalent metal ions.12 Sr2+ ions were reported to play a major role in osteogenic, odontogenic, and chondrogenic differentiation through CaSR and MAPK/ERK pathways.13 Even at low concentrations, Sr2+ enhances the differentiation and proliferation of human dental pulp stem cells by upregulating the odontogenic markers like dentine sialophosphoprotein and dentine matrix protein. It downregulates cartilage-degrading enzymes like MMP3 and ADAMTS5, contributing to chondrogenicity. Sr2+ was also known to improve collagen synthesis and mineralization by varying the conduct of pre-osteoblasts/osteoblasts to induce mineralized bone nodules. It also helps in reducing the proinflammatory cytokines like TNF-α, and IL-β1.14 Hence, Sr2+ activates CaSR pathways to regulate osteoblastogenesis and osteoclastogenesis to aid bone regeneration by maintaining bone homeostasis.

The tunable nature of the bioinorganic ions, according to the necessities, has paved the way for organic–inorganic nanocomposites or hybrid materials. With the known role of strontium and thymoquinone(TQ) in bone regeneration, we synthesized a thymoquinone (TQ)-intercalated metal nanocomposite (Sr–Fe–TQ) with strontium and iron as divalent and trivalent cations based on our previous research.15,16 The organic–inorganic hybrid nanocomposite, Sr–Fe–TQ, was previously reported to accelerate the mineralization process and play a key role in the regulation of the bone matrix proteins, leading to the osteogenesis process.15 The hybrid nanocomposite enhances the collagen binding capacity of the hydroxyapatite by regulating the synthesis of pro-collagen and collagen, alkaline phosphatase secretion, and calcium deposition.15 For application, this osteoinductive compound (Sr–Fe–TQ) should be reinforced in an osteoconductive matrix. Hence, we developed chitosan–sodium alginate hydrogels strengthened with Sr–Fe–TQ nanocomposites as a hybrid hydrogel (Sr–Fe–TQ gel) to stimulate the calcium-sensitive receptors to activate various signaling pathways to accelerate bone regeneration in critical-size defects.17,18 This hybrid hydrogel will offer a promising acellular strategy for bone regeneration, by combining the mechanical robustness, bioactivity, and clinical usability.19

2. Methodology

2.1 Materials used

Chitosan (low molecular weight), alginic acid of sodium salt, phosphate buffered saline (pH-7.4), ethanol, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), dimethyl sulfoxide (DMSO), calcein AM, formalin, alizarin red S, cetylpyridinium chloride, and the alkaline phosphatase diethanolamine activity kit were procured from Sigma. Collagen type I, osteocalcin (OCN), osteopontin (OPN), osteonectin/SPARC, and osteoprotegerin (OPG) were bought from Santa Cruz Biotechnology. Goat anti-mouse ALP-conjugated secondary antibody was purchased from Abcam. The Duoset ELISA ancillary reagent kit (DY0008B) was procured from R&D Systems. MG-63 cell lines were procured from NCCS, Pune, India.

2.2 Synthesis of Sr–Fe–TQ hybrid material

About 50 mM of strontium nitrate hexahydrate and 25 mM of ferric nitrate nonahydrate were dissolved in distilled water (solution I). Next, 200 mM of thymoquinone and 100 mM of NaOH were also dissolved in distilled water, separately (solution II). Solution II was added dropwise into solution I with vigorous stirring, and this mixture was allowed to stand for about 1 hour, followed by centrifugation at 10[thin space (1/6-em)]000 rpm for 30 minutes. The resulting pellet was washed several times and dried in a hot air oven at 70 °C for 14 hours. The pellet was crushed into powder using a mortar and pestle.15

2.3 Developing hybrid-hydrogel

Sodium alginate (3% w/v) was dissolved in distilled water using mild stirring for an hour, and chitosan (3% w/v) was added slowly to the mixture. The mixture was blended into a smooth, flowable gel-like texture with mild stirring. Next, 1% w/v of the synthesized Sr–Fe–TQ hybrid material was added to the gel slowly until it was uniformly dispersed. To crosslink the gel, 1% w/v calcium chloride was added to it.20

2.4 Physicochemical characterization

The Fourier Transform Infrared-Attenuated Total Reflectance (FTIR-ATR) spectrum was used to study the prepared hydrogel's vibrational analysis. The spectral measurements were conducted in the frequency range of 4000–600 cm−1 (JASCO Inc. Model no: FT/IR-4700 type A). The thermal stability of the hydrogel was analyzed by differential scanning calorimetry (DSC2A-00837). A known weight of hydrogel was taken in the sample holder and heated at the rate of 10 °C min−1 from 25 °C to 300 °C. Heat flow w g−1 was plotted against the temperature to determine the degradation temperature and melting temperature. The morphological features of the hydrogel were observed by scanning electron microscopy (SEM). The dried hydrogel was taken in carbon tape and sputter-coated with gold before analysis (TESCAN Clara). The swelling index of the hydrogel was studied for drug delivery, nutrient flow, and vascularization. The swelling index is a necessary parameter for hydrogels as it helps in the delivery of drugs in a sustained manner. The hydrogels were weighed and immersed in the PBS buffer for a definite time, and then the hydrogels were taken out of the PBS buffer and weighed. The initial (W1) and the final (W2) weights of the hydrogel determine the swelling index.21
image file: d5bm00349k-t1.tif

2.5 In vitro biocompatibility and osteogenic efficacy of the hydrogel

The in vitro cytocompatibility of the hydrogel was studied by MTT assay in MG-63 osteoblastic cell lines. The hemocompatibility of the hydrogel was determined using human red blood cells. The osteogenic effectiveness of the hydrogel was studied with osteogenic gene expression and bone matrix protein expression studies in the MG-63 cell line. The bone mineralization potential of the hydrogel was investigated by alkaline phosphatase secretion and calcium deposition assay in MG-63 cells.
a. MTT assay. MG-63 cells were seeded on the hydrogels taken in the 96-well plates supplemented with minimum essential medium, fetal bovine serum, and antibiotic solution and incubated at 37 °C with 5% CO2 for 24–48 h. After certain time points, the medium was removed from the wells and MTT was added. After incubation for 4 hours, MTT was removed, and DMSO was added to the wells. The absorbance of the resulting solution was obtained at 570 nm after an hour.
b. Hemocompatibility. The hemocompatibility of the hydrogels was studied in human red blood cells in vitro. About 500 μL of RBCs suspended in PBS was taken, and the hydrogels were immersed in it for 1 hour. After incubation, the mixture was centrifuged at 5000 rpm for 10 minutes. The optical density of the resulting supernatant solution was analyzed at 560 nm for possible hemolysis. Tap water serves as the positive control, and PBS serves as the negative control.
image file: d5bm00349k-t2.tif
c. Cell adhesion and proliferation assay. The cell adhesion and proliferation assay was performed by the live cell staining method. MG-63 cells were seeded on the hydrogels taken in 24-well plates supplemented with minimum essential medium, bovine serum albumin, and antibiotic solution and incubated at 37 °C with 5% CO2. After 72 hours, the media was emptied and washed with PBS. Here, 500 μL of formalin was added to the wells for 1 hour to fix the cells. Formalin was then removed, and the wells were washed with PBS thrice. DAPI stain was added to the wells for 10 minutes and then washed with PBS for 5 minutes. The plate was air dried for 15 minutes, followed by the addition of calcein AM stain to the wells for 5 min. After the incubation period, the wells were emptied and thoroughly washed to remove excess stains. Once the plate is air-dried, it can be subjected to fluorescence microscopy.
d. Real-time polymerase chain reaction. Gene expression of RUNX-2, BMP-2, and BGLAP genes was studied by the RT-PCR assay. MG-63 cells were treated with the hydrogels for 7 days, and RNA extraction was performed from the cells treated with the hydrogels. The RNA was converted to cDNA for the RT-PCR analysis. The primer sequence used for the RT-PCR is given below.
Gene Primer sequence
GAPDH Forward: TCGACAGTCAGCCGCATCT
Reverse: GGCGCCCAATACGACCAAA
RUNX2 Forward: ATCTCCGCAGGTCACTACCA
Reverse: CATTCCGGAGCTCAGCAGAA
BGLAP Forward: TCACACTCCTCGCCCTATTG
Reverse: CTCTTCACTACCTCGCTGCC
e. Enzyme-linked immunosorbent assay. The expression of bone matrix proteins such as osteocalcin, osteopontin, SPARC, collagen I, procollagen, and osteoprotegerin was studied by ELISA (Duoset ELISA ancillary reagent kit). MG-63 cells were treated with the hydrogels for a period of 7 days, and proteins were extracted from the cells after incubation. The proteins were quantified and subjected to ELISA.

2.6 In vitro ion release

The release of Sr2+ ions from the Sr–Fe–TQ hydrogel was studied for the effective therapeutic outcome. A known weight of hydrogel with a known amount of nanocomposites (approximately 10 mg) was taken in the dialysis membrane. The membrane with hydrogel was placed inside a beaker containing PBS (pH 7.4) with constant stirring. A known amount of PBS was taken from the beaker at definite time points (day 1, day 4, day 7, and day 14) and replaced with the same amount of fresh PBS.22–24

The PBS collected from the beaker at the time points was subjected to Inductively Coupled Plasma-Optical Emission Spectrometry (ICP-OES) to determine the concentration of Sr2+ ions released from the hydrogel at the defined time points.

2.7 In vitro degradation of the hydrogel

A lyophilized hydrogel of known weight (W1) was kept immersed in PBS (pH 7.4) for defined periods (7, 14, 21, and 28 days). After the specified period, the hydrogel, along with the PBS, was freeze-dried. The final weight (W2) of the freeze-dried hydrogel was noted. The percentage of degradation was derived from the initial and final weights of the hydrogel.21
image file: d5bm00349k-t3.tif

2.8 In vitro mineralization assay

a. Alkaline phosphatase assay. The in vitro efficacy of the developed hydrogels in the bone regeneration process was studied by alkaline phosphatase assay. MG-63 cells were treated with the hydrogels for 7, 14, 21, and 28 days. After the specified period, the medium in which the cells were grown was taken for the ALP assay (Alkaline Phosphatase Diethanolamine Kit, Sigma).

The ALP staining assay was also performed to correlate with its colorimetric assay. MG-63 cells were treated with the hydrogels for 7, 14, 21, and 28 days. After the specified period, the medium was removed, and the cells were washed and fixed. The ALP staining solution was added to the cells for about 5–10 minutes. After the incubation, the staining solution was removed, and the cells were washed with PBS to remove excess solution. After drying, the cells were viewed under a light microscope.

b. Alizarin red S staining. The calcium deposition of the cells treated with the hydrogels was studied using alizarin red staining. MG-63 cells were treated with the developed hydrogels for periods of 7, 14, 21, and 28 days. After the incubation period, the medium was removed from the cells and fixed with formalin for 1 hour. The cells were washed thrice with PBS after the removal of formalin. Alizarin red S stain was added to it for 30 minutes and removed after the incubation period. The dye was then dissolved with cetylpyridinium chloride for 30 minutes, and the resulting solution was subjected to absorbance at 405 nm.

2.9 In vivo hydrogel-assisted bone regeneration studies

In vivo, the hydrogel-implanted bone regeneration was studied via irregular-sized tibial defects in a rabbit model. The study was approved by the Institutional Animal Ethics Committee, CSIR-Central Leather Research Institute [IAEC no: 02/2020 (C)]. All surgical procedures were performed in accordance with the guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA). New Zealand white male rabbits weighing around 2.5 kg were used for the study. The animals were divided into 4 groups: Sr–Fe–TQ group, Sr–Fe control group, positive control, and negative control. A critical-size defect without any implant serves as a positive control, and rabbit without any defect serves as a negative control. A critical-size defect of diameter >5 mm was created in the dorsal surface of the tibia near the growth plate with a contra-angle dental drill under anesthesia (30 mg kg−1 ketamine and 5 mg kg−1 xylazine).25 Hydrogel was injected into the defect site and sutured. Fracture healing was monitored with radiography. The bone marker expression was studied at week 2, week 4, and week 12. After 12 weeks, the rabbits were euthanized with sodium pentothal, and the tibial region was dissected for further analysis, such as micro-CT, histopathology, and immunohistochemistry.26
a. Indirect ELISA. The plasma of the blood collected from the rabbits at different time points (2nd, 4th, and 12th week) was subjected to indirect ELISA to determine the expression of SPARC, OCN, OPN, OPG, COL, and ADAMTS-2.
b. Micro-computed tomography.
Quantitative analysis of micro-CT images. The dissected tibia stored in formalin was used for micro-CT analysis. This study aimed to quantitatively analyze micro-CT images of rabbit tibia using ImageJ and 3D Slicer. The samples, consisting of tibial images, were prepared with uniform resolution and settings for consistency. Bone segmentation was performed to isolate bone regions, followed by the generation of 3D models of segmented bone structures. Bone texture analysis was carried out to assess density patterns within bone regions. Micro-CT images were processed by setting pixel intensity thresholds to distinguish bone from non-bone areas. Unwanted slices were removed, and the images were purified. Porosity was calculated as the percentage of void space over the total volume (1 – BV/TV), where BV represents bone volume and TV represents total volume, and Porosity (%) = 100 × (1 – BV/TV)19,22
c. Histopathology. After the animal was euthanized, the tibial region was dissected from the rabbit and stored in formalin. Tissue sections were made, and Hematoxylin and Eosin staining and Masson trichome staining were performed.
d. Immunohistochemistry. The immunohistochemical analysis of collagen I, osteopontin, and osteoprotegerin was done in the tissue sections from the tibial segments injected with the hydrogels.

2.10 Statistical analysis

Origin Pro 8 software (Origin Lab, Northampton, Massachusetts, USA) was used for all the statistical analysis. One-way ANOVA with Tukey testing was performed to understand the statistical significance. The results are expressed as Mean ± SD, and P < 0.05 was considered statistically significant.

3. Results and discussion

3.1 Characterization of hybrid material

Sr–Fe–TQ hybrid material has been synthesized using the in situ coprecipitation method. The SEM of Sr–Fe–TQ and Sr–Fe nanocomposites showed aggregated structures similar to previously reported study.15 The EDAX of the synthesized nanocomposite Sr–Fe–TQ showed a C (carbon) peak in addition to the Sr and Fe peaks, indicating the presence of the organic compound TQ. The SEM of the synthesized nanocomposites is shown in Fig. 1.
image file: d5bm00349k-f1.tif
Fig. 1 Scanning electron micrograph and energy dispersive analysis X-ray of [A] Sr–Fe–TQ (scale bar: 1 μm) and [B] Sr–Fe nanocomposite (scale bar: 5 μm).

TEM of the Sr–Fe–TQ nanocomposite showed no definite structures. However, Sr–Fe showed sheet-like structures in TEM as seen in Fig. 2. This shows that the hybrid material Sr–Fe–TQ is amorphous. The amorphous nature of the nanocomposite might be due to the intercalation of thymoquinone, which loses its crystallinity during the in situ co-precipitation. The TEM and elemental mapping of Sr–Fe–TQ and Sr–Fe nanocomposites are shown in Fig. 2. The difference in the amount of Sr and Fe in the Sr–Fe and Sr–Fe–TQ is due to the charge balance to maintain structural integrity. The trivalent ions (Fe3+) are higher in the Sr–Fe nanocomposites, which may be due to the isomorphic substitution of the trivalent cations in the place of divalent cations to achieve the net positive charge for the possibilities of anion exchange. However, in the Sr–Fe–TQ hybrid material, the divalent ion (Sr2+) is slightly higher than Fe3+ to ensure balance with the negatively charged intercalated anion (i.e., thymoquinone).27


image file: d5bm00349k-f2.tif
Fig. 2 Transmission electron micrograph and elemental mapping of [A] Sr–Fe–TQ (scale bar: 200 nm) and [B] Sr–Fe nanocomposite (scale bar: 50 nm).

3.2 Fabrication and characterization of the hybrid material hydrogel

The Sr–Fe–TQ hybrid material was reinforced into the chitosan–alginate gel blend, resulting in the Sr–Fe–TQ Gel as per the biosafe concentration and cytotoxicity assays (ESI I) based on our previous studies. In addition to the CaCl2 crosslinker, Sr2+ and Fe3+ ions in the nanocomposite also contribute to crosslinking chitosan and alginate. This enables a slow degradation rate and the controlled release of hybrid material.

The vibrational analysis of the Sr–Fe–TQ hydrogel reveals a peak around 3300 cm−1, corresponding to O–H stretching vibrations due to intermolecular hydrogen bonding. This peak results from the overlapping O–H and N–H vibrations in chitosan and the O–H stretching in sodium alginate. The peak near 1034 cm−1 is attributed to C–O stretching in alginate, while the absorption band at 1635 cm−1 indicates asymmetric N–H deformation, confirming the presence of protonated amines (NH3+ ions). The cationic R–NH3+ groups of chitosan form ionic bonds with the anionic carboxyl groups of alginate, facilitating hydrogel formation. The vibrational analysis is illustrated in Fig. 3A. The thermal analysis by DSC shows that the degradation temperature (Td) of the control (chitosan–alginate gel) is 82.94 °C, whereas that of the Sr–Fe–TQ Gel is 108.92 °C. The melting temperature (Tm) of the control was observed at 151.76 °C, whereas that of the Sr–Fe–TQ Gel was found to be 179.28 °C. The reinforcement of the Sr–Fe–TQ hybrid material into the chitosan–alginate gel significantly reduced the degradation rate and increased the stability of the gel, as shown in Fig. 3B.


image file: d5bm00349k-f3.tif
Fig. 3 [A] Fourier transmission infrared spectroscopy and [B] differential scanning calorimetry of the developed hydrogel.

Scanning electron micrography shows the porous morphological structure of the prepared hydrogels, which helps in the flow of nutrients, oxygen, and cells, contributing to bone regeneration. The control shows more porous structures. The Sr–Fe control and Sr–Fe–TQ gel appear to be rigid with fewer pores. This is due to the presence of Fe3+ and Sr2+ ions, which bind to the carboxylate group of the alginate, forming egg-box structures and crosslinking alginate chains. This crosslinking provides a more stable network and improves the mechanical properties of the hydrogel.28 The SEM of the developed hydrogels is shown in Fig. 4.


image file: d5bm00349k-f4.tif
Fig. 4 Scanning electron micrograph of the developed hydrogels (scale bar: 200 μm).

The swelling percentage of the Sr–Fe–TQ gel exhibits reduced and sustained swelling over time, which contributes to the prolonged release of osteoinductive factors. This reduced swelling is due to the presence of Fe3+ and Sr2+ ions, which crosslink the alginate chains, creating egg-box structures. These ions bind with the GG blocks (α-L-guluronic acid residues), MM blocks (β-D-mannuronic acid residues), and MG blocks of the alginate chains. Sr2+ ions have more coordination sites than the Ca2+ ions, which also contributes to the reduced swelling of the Sr–Fe–TQ gel.28 In contrast, the control (chitosan–alginate gel) and Sr–Fe control show progressively increased swelling at each time point. The Sr–Fe control showed increased swelling even in the presence of metal ions because the Sr–Fe nanocomposites have a greater amount of Fe3+ than Sr2+ due to the isomorphic substitution, as reported in the elemental mapping of TEM and SEM, and Fe3+ has the least affinity for alginate when compared to Sr2+. Hence, the crosslinking was weak compared to the Sr–Fe–TQ gel, which has more Sr2+ ions than Fe3+ ions. Therefore, the Sr–Fe nanocomposite-loaded hydrogel (Sr–Fe control) showed increased swelling compared to the Sr–Fe–TQ gel.28 The swelling is indirectly proportional to the stability of the hydrogel. The swelling ratio at different time intervals is graphically represented in Fig. 5.


image file: d5bm00349k-f5.tif
Fig. 5 Swelling percentage of the developed hydrogels.

3.3 In vitro toxicity of Sr–Fe–TQ gel

The in vitro cytotoxicity of the Sr–Fe–TQ gel was studied with the MG-63 osteoblast-like cells using the MTT assay. The cell viability of the Sr–Fe–TQ gel-treated MG-63 cells showed more than 60% in 24 hours. However, it was less than the Sr–Fe control and the control. At 48 hours, the viability of the Sr–Fe–TQ gel-treated cells increased to more than 100% and was also greater than the control. The cell viability of the Sr–Fe control-treated cells also showed a similar percentage range to the Sr–Fe–TQ gel at 48 hours. This affirms the cytocompatible nature of the hydrogel. The cell viability percentage of the hydrogels-treated MG-63 cells is shown in Fig. 6A.
image file: d5bm00349k-f6.tif
Fig. 6 [A] Graphical representation of the cell viability percentage of hydrogel-treated MG-63 cells. [B] Graphical representation of the hemocompatibility of the developed hydrogels.

The hemocompatibility of the Sr–Fe–TQ Gel, Sr–Fe control, and the control studied in human RBC showed that all the hydrogel-treated RBC exhibited less than 5% lysis. This indicates the highly hemocompatible nature of the compound. The graphical representation of the hemolysis by the hydrogels is shown in Fig. 6B.

The cell viability percentage and hemocompatibility of the Sr–Fe–TQ gel prove its biocompatible nature and suitability for therapeutic administration.

3.4 Cell adhesion and proliferation potency of the Sr–Fe–TQ gel

The cell adhesion and proliferation efficiency of the hydrogel were studied via live cell fluorescence staining with calcein AM (cytoplasm stain) and DAPI (nuclei stain). MG-63 cells seeded over the hydrogel were stained with calcein AM and DAPI after 72 hours, showing that the hydrogel supported the adhesion and proliferation of the MG-63 cells, which is evident from the fluorescence image as shown in Fig. 7. The adhesion and proliferation potential of the hydrogel affirms its osteoconductive property since calcein readily binds with the calcium in the cells, especially in growing hydroxyapatite (calcium phosphate).29 The fluorescence staining of the MG-63 cells treated with the hydrogels is shown in Fig. 7.
image file: d5bm00349k-f7.tif
Fig. 7 Fluorescence microscopic images of the MG-63 cell treated with hydrogels (scale bar: 50 μm).

3.5 In vitro osteogenic efficacy of the Sr–Fe–TQ gel

The osteogenic efficacy of the hydrogel was evaluated in the MG-63 osteoblast-like cells, revealing that the Sr–Fe–TQ gel-treated cells showed a nearly 10-fold increase in the RUNX2 transcription factor on day 7. The RUNX2 transcription factor initiates the osteogenesis process by inducing the osteogenic differentiation of the osteoprogenitor cells.30 The BGLAP gene responsible for the mineralization potential showed a 2-fold increase in the Sr–Fe–TQ gel on day 7. The Sr–Fe control showed a 10-fold increase in the BGLAP gene, which might be due to the presence of Sr ions, similar to the calcium ions. The gene expression of the Sr–Fe–TQ gel-treated MG-63 cells is shown in Fig. 8A and B.
image file: d5bm00349k-f8.tif
Fig. 8 Gene expression of the hydrogel-treated MG-63 cells: [A] BGLAP, [B] RUNX2 and [C] bone matrix protein expression of hydrogel-treated MG-63 cells.

The osteoblasts secrete various non-collagenous proteins and collagen, which are essential for bone remodeling. This bone matrix protein expression was studied using ELISA in the MG-63 osteoblast-like cells. Osteonectin (SPARC), an essential protein for the collagen–hydroxyapatite binding and mineralization was expressed much higher in the Sr–Fe–TQ gel. SPARC is also responsible for the procollagen processing, collagen deposition, and its self-assembly.31 Osteocalcin (OCN), the abundant non-collagenous protein, was expressed higher in the Sr–Fe–TQ gel than in the Sr–Fe control, but slightly less than the control. OCN is an important marker of calcium deposition. The absence of OCN will result in increased bone mass without resorption, thus leading to an imbalance in bone homeostasis.32 Osteopontin (OPN) protein, which is a key factor for cell adhesion, and osteoclast activation, was expressed higher in the control, followed by Sr–Fe–TQ gel and the Sr–Fe control.33 Osteoprotegerin (OPG) protein, an essential parameter for inhibiting bone resorption, was highly expressed in the Sr–Fe–TQ gel, confirming its interference in the RANK/RANKL/OPG pathway for inhibiting osteoclastogenesis.34 This symbolizes that the hydrogel contributes to inhibiting osteoporosis. Collagen I expression was similar to that of the control. The bone matrix protein expression is shown in Fig. 8C.

3.6 In vitro Sr2+ ion release and degradation of the hydrogel

The Sr2+ ion release from the hydrogels Sr–Fe–TQ gel and Sr–Fe control was studied for 14 days. The Sr–Fe control showed a negligible concentration of Sr2+ on days 1 and 4. On day 7, the concentration of Sr2+ was around 3.7 mg mL−1, which was reduced to almost 0.04 mg mL−1 on day 14. This Sr2+ ion release can be correlated with the BGLAP gene expression on day 7, which shows a 10-fold change in the Sr–Fe control. This BGLAP gene is responsible for the calcium deposition and activation of ALP for mineralization. The Sr–Fe–TQ gel showed a uniform release of Sr2+ ions on days 1 and 4, which is greater than the ions released by the Sr–Fe control. However, on day 7, it did not show a significant release; this can also be correlated with the BGLAP gene expression on day 7, which showed much less fold change than the Sr–Fe control. On day 14, the Sr–Fe–TQ gel showed a significant increase in the release of Sr2+ ions. The Sr2+ ion release at defined time points is given in Fig. 9A.
image file: d5bm00349k-f9.tif
Fig. 9 Graphical representation of [A] in vitro strontium (Sr2+) ion release. [B] Degradation of hydrogels at defined periods.

The degradation patterns of the hydrogels were analyzed for 28 days. The Sr–Fe control showed more than 60% of degradation on day 7, and subsequently increased on days 14, and 21, and showed greater than 95% degradation on day 28. The Sr–Fe–TQ gel, on the other hand, showed a controlled degradation pattern with around 65% degradation on day 28. Hence, the Sr–Fe–TQ gel provides better mechanical support throughout the regeneration of the bone than the Sr–Fe control. The graphical representation of the degradation of hydrogels is given in Fig. 9B.

3.7 Alkaline phosphatase assay

The ALP gene is the key responsible factor for the mineralization process. The ALP enzyme degrades the phosphate-containing matrix vesicles and makes them available for hydroxyapatite formation with the calcium ions to initiate the mineralization.35 The ALP levels of the hydrogel-treated MG-63 cells were observed for 28 days. On day 7, the ALP levels of cells treated with Sr–Fe control and control were greater, which can also be correlated with the Sr2+ ion release on day 7. On day 14, the Sr–Fe–TQ gel showed increased compared to others, which coincides with its Sr2+ ion release profile. However, on day 14, the Sr–Fe control and the control showed ALP secretion that was less than on day 7. On day 21, cells treated with the Sr–Fe–TQ gel showed greater ALP levels than others, symbolizing the onset of mineralization. The ALP levels gradually reduced on day 28. The upregulation of ALP is necessary for the release of the phosphate ions from the matrix vesicles to bind with the calcium ions for hydroxyapatite formation, followed by downregulation to initiate the remodeling phase of bone regeneration. The graphical representation of the ALP secretion by the hydrogel-treated MG-63 cells at different time points is shown in Fig. 10A. ALP staining was conducted on MG-63 cells treated with the hydrogels on days 7, 14, 21, and 28 to assess osteogenic differentiation and mineralization potential. The microscopic images of ALP staining are in agreement with the quantitative colorimetric ALP activity assay. The Sr–Fe–TQ gel group exhibited a marked increase in ALP expression from day 14, which remained consistent through day 21, mirroring the trends observed in the quantitative assay. In contrast, the Sr–Fe control group showed moderate ALP activity on day 7 but the expression on days 14 and 21 was comparatively lower than that of the Sr–Fe–TQ gel. Notably, the ALP staining results also correlate with the in vitro Sr2+ release profile, where the Sr–Fe control demonstrated significant Sr release on day 7, while the Sr–Fe–TQ gel showed substantial release on day 14. The light microscopic images are given in Fig. 10B.
image file: d5bm00349k-f10.tif
Fig. 10 Alkaline phosphatase secretion by the hydrogel-treated MG-63 cells: [A] graphical representation of quantitative ALP secretion at defined times and [B] light microscopic images at defined times.

3.8 Calcium deposition assay

The extracellular calcium deposition was quantitatively determined by the alizarin red staining assay. Calcium ions are released from the vesicular membrane into the extracellular matrix for the formation of hydroxyapatite, with the phosphate ions triggered by the ALP gene.36 The calcium deposition of the hydrogel-treated MG-63 osteoblastic cell lines was studied for 28 days. On day 7, calcium deposition was similar in all groups. On day 14, which is the crucial period for mineralization, the Sr–Fe–TQ gel showed higher deposition than the Sr–Fe control and control. The peak calcium deposition was observed on day 21 for all the groups, in which the Sr–Fe–TQ gel showed the maximum deposition, similar to its ALP secretion, thus affirming the accelerated mineralization in the Sr–Fe–TQ gel-treated MG-63 cells. The graphical representation and the light microscopic images of the calcium deposition of hydrogel-treated MG-63 cells at different time points are given in Fig. 11.
image file: d5bm00349k-f11.tif
Fig. 11 [A] Graphical representation and [B] light microscopic images of calcium deposition by the hydrogel-treated MG-63 cells.

3.9 Radiography

The X-ray of the Sr–Fe–TQ gel in week 2 showed no visible inflammation, indicating the onset of its callus-forming phase. The week 4 X-ray showed a visible reduction in the circumference of the fracture, and bridging was also observed. The X-ray in week 12 showed non-woven bone formation, indicating the bone remodelling phase as shown in Fig. 12.
image file: d5bm00349k-f12.tif
Fig. 12 Radiographic images of the tibial sections of the hydrogel-injected tibias and control.

The X-ray radiograph of the Sr–Fe control-implanted tibial defect showed smoothened ridges of the fracture in week 2 compared to day 0. In week 4, the soft callus formation was observed with the non-woven bone formation. This indicates the onset of the remodeling phase. In week 12, the fracture side was closed, visibly indicating the healing (Fig. 12).

The control tibia showed callus formation in week 2 with the softening of ridges by the resorption, followed by woven bone formation in week 4. The size of the defect was decreased and the onset of remodelling occurred by week 12 (Fig. 12).

3.10 Bone matrix protein expression by enzyme-linked immunosorbent assay

The expression of the bone matrix proteins was investigated using ELISA, with the plasma sample collected from the hydrogel-implanted rabbits and control rabbits in weeks 2, 4, and 12.

Osteonectin/SPARC protein expression of the developed hydrogel-implanted rabbits in week 4 showed a significant increase from week 2, indicating the onset of the mineralization phase in healing.37 In week 12, SPARC expression was reduced when compared to week 4, indicating the remodeling phase of bone healing (Fig. 13).


image file: d5bm00349k-f13.tif
Fig. 13 Graphical representation of bone matrix protein expression in the hydrogel-injected animals and the control.

The bone matrix protein OCN, responsible for calcium deposition, was analyzed. Its expression in Sr–Fe control-implanted rabbits was higher, followed by the Sr–Fe–TQ gel-implanted rabbits, and the control in week 2. In week 4, the Sr–Fe–TQ gel showed increased expression when compared to the others, which showed a further increase in week 12, symbolizing the callus formation stage following the X-ray images. The Sr–Fe control showed a mild increase in the expression of OCN in week 4 and a steep increase in week 12 (Fig. 13).

The protein responsible for osteoclastogenesis (i.e. resorption) was analyzed for 12 weeks. The Sr–Fe control and the Sr–Fe–TQ gel showed increased expression in week 2, indicating that the softened ridges were due to the resorption of the ruffled borders of the defect/fracture. In week 4, the Sr–Fe control showed a further increase in the expression of OPN, highlighting the reason for its smoothened borders of the defect from X-ray images. The Sr–Fe–TQ gel showed significantly decreased expression of OPN in week 4 and steep expression in week 12, depicting the initiation of the remodeling phase in week 12, indicating the activation of osteoclastogenesis, which helps in the resorption of the non-woven bone, resulting in the formation of the woven bone.38 This result coincides with the X-ray images of the hydrogel-implanted tibial region.

OPG protein responsible for the inhibition of osteoclastogenesis was higher in the Sr–Fe control, followed by the Sr–Fe–TQ gel in week 2. In week 4, the expression of the Sr–Fe control-implanted animals were similar to that of the OPN. Thus, preventing the over-resorption of ruffled borders. The OPG expression in week 12 was higher in the Sr–Fe–TQ gel. This coincides with the week 12 OPN expression of the Sr–Fe–TQ gel, indicating the resorption of non-woven bone and the onset of the remodeling phase (Fig. 13).34

The ADAMTS-2 expression, which is the protein responsible for pro-collagen synthesis and collagen binding, was greater in Sr–Fe and the Sr–Fe–TQ gel in week 2. This is similar to the SPARC expression in week 2, except for the Sr–Fe–TQ gel, which showed mildly less ADAMTS-2 expression than SPARC(Fig. 13). SPARC protein helps in the organization of collagen fibers. ADAMTS-2, which is a procollagen N-peptidase, helps in the fibrillar collagen maturation.39

The expression of SPARC and ADAMTS-2 should, therefore, be in equilibrium to initiate the soft callus-forming phase with non-woven bone formation. The type I collagen protein expression of the hydrogels implanted in rabbits was similar to its ADAMTS-2 expression in weeks 2, 4, and 12. The collagen and procollagen expressions were higher in the Sr–Fe–TQ gel in week 4 and also in week 12, indicating the ongoing woven bone formation phase and remodeling phase, respectively. The graphical representation of the hydrogel treated bone matrix protein expression was shown in Fig. 13.

3.11 Micro-CT analysis

The 3D models of the hydrogel-implanted tibias were generated using micro-CT and 3D slicer to determine the defect closure texture analysis,bone volume density, and porosity. The texture analysis of the 3D models generated shows that the Sr–Fe–TQ gel-injected tibia showed better defect closure than the Sr–Fe control and the control tibia with bridging across the defect. The 3D models generated by 3D slicer are shown in Fig. 14.
image file: d5bm00349k-f14.tif
Fig. 14 3D models of tibial sections injected with hydrogels and the control tibia.

The restoration of the bone volume density of the hydrogel-implanted rabbit was studied with the bone volume density of a healthy rabbit of the same weight. The study reveals that the Sr–Fe–TQ gel implants showed increased restoration compared to the Sr–Fe control implants. The porosity was also calculated. The bone volume density and the porosity of the hydrogel-implanted tibias are given in Table 1.

Table 1 Bone volume density and porosity of hydrogel-implanted tibias
S. no. Implanted hydrogel Bone volume density restoration % Porosity
1 Sr–Fe control 97.2971 0.9396
2 Sr–Fe–TQ gel 98.8249 0.92441
5 Control (without implant) 90.19 0.8321
6 Without defect 100 0.9227


3.12 Histopathology

The hydrogel-implanted tibias were stained with hematoxylin and eosin dye to study the pathological features of the defect site and healing. The Sr–Fe–TQ gel showed viable cells and bony trabeculae.40 Connective tissue with surrounding osteocytes and osteoblasts, with occasional osteoclasts, was also observed, indicating the restoration of bone structure.41 The Sr–Fe control showed ischemic structures with mild inflammation. Visible ossification centres with active osteoblasts observed at the defect sites were involved in the remodeling, as shown in the figure. Fibrosis conditions with underlying viable cells were observed in the control tibia (Fig. 15).42
image file: d5bm00349k-f15.tif
Fig. 15 Histopathological staining images of the hydrogel-injected tibia and control tibia (red–ossification center, blue–osteoclasts, yellow–osteocytes, turquoise–connective tissues) (H&E-scale bar: 340 μm and MT-scale bar: 800 μm).

MT staining of the hydrogel-implanted tibia showed fibrosis in the Sr–Fe control, which is in accordance with its increased collagen expression in weeks 4 and 12. The Sr–Fe–TQ gel showed mild fibrosis in week 12, which might be due to the increase in the expression of procollagen and collagen (Fig. 15).

3.13 Immunohistochemistry

Collagen I expression in the hydrogel-implanted tibia was studied. The Sr–Fe control showed normal collagen deposition in week 12. However, the Sr–Fe–TQ gel showed significantly increased collagen I deposition on the tibia, which is also evident from the texture analysis of the micro-CT; this indicate non-woven bone formation in week 12, symbolizing the ongoing bone remodeling. The OPN and OPG bone matrix proteins play a role in the RANK/RANKL/OPG pathway of the calcium sensing receptors.

Osteopontin expression seemed to be reduced in the Sr–Fe control, as well as in the control; this was the same result as that of their OPN expression studied by ELISA. The Sr–Fe–TQ gel showed normal OPN expression. The OPG expression of the Sr–Fe control showed normal expression and the Sr–Fe–TQ gel showed reduced expression in IHC, similar to the results obtained by ELISA, indicating the remodeling phase of bone healing by maintaining the homeostasis (Fig. 16).


image file: d5bm00349k-f16.tif
Fig. 16 Immunohistochemical images of tibial sections injected with hydrogels and control (scale bar: 340 μm).

4. Conclusion

This study presents a minimally invasive strategy for bone regeneration using an injectable chitosan–alginate hydrogel system integrated with an osteoinductive Sr–Fe–TQ nanocomposite. The hydrogel's ability to conform to irregularly shaped defects addresses a critical challenge in conventional implantation surgery, while its mesh-like polymeric network offers osteoconductive support and sustained release of bioactive agents and metal ions for osteoinductivity. The incorporation of the Sr–Fe–TQ nanocomposite significantly enhanced the osteogenic potential of the hydrogel, as confirmed through in vitro assays, demonstrating excellent cytocompatibility, hemocompatibility, and biocompatibility. Sr–Fe–TQ gel also showed the sustained release of Sr2+, thus contributing to the stability of the hydrogel and the induction of osteogenic factors. In vivo studies using a rabbit critical-size defect model revealed that the Sr–Fe–TQ gel promoted superior bone regeneration, achieving nearly complete defect closure and ∼99% bone volume restoration, outperforming the control groups. Collectively, these findings highlight the therapeutic potential of this hybrid hydrogel system as a versatile, injectable, and effective alternative to traditional bone grafting approaches for complex and irregular bone defects.

Author contributions

Grace Felciya S J: conceptualization, methodology, formal analysis, validation, writing – original draft, and fund acquisition. Poornima V: validation, data curation, resource: material synthesis, reviewing, and editing. Deebasuganya G: resource: in vivo experimentation, data curation. Alexandar Vincent Paulraj: resource: micro CT analysis. Nivethitha P M: resource: in vivo experimentation. Uma T S–visualization, project administration, and supervision.

Conflicts of interest

The authors declare no competing financial interest.

Data availability

The data supporting this article have been included as part of the ESI.

Acknowledgements

We acknowledge financial support from CSIR-CLRI (2080) and CSIR Research associateship (31/0006(18695)/2024-EMR-I). We acknowledge CATERS and CSIR-CLRI for the analytical testing.

References

  1. P. M. Chichiricco, P. Matricardi, B. Colaço, P. Gomes, C. Jérôme, J. Lesoeur, J. Veziers, G. Réthoré, P. Weiss, X. Struillou and C. Le Visage, Bioengineering, 2023, 10(1) DOI:10.3390/bioengineering10010094 .
  2. C. Wang, S. Min and Y. Tian, Tissue Eng. Regener. Med., 2023, 20, 829–837,  DOI:10.1007/s13770-023-00569-2 .
  3. W. Li, Y. Wu, X. Zhang, T. Wu, K. Huang, B. Wang and J. Liao, RSC Adv., 2023, 13, 16773–16788,  10.1039/d3ra01700a .
  4. Y. Zhu, H. Gu, J. Yang, A. Li, L. Hou, M. Zhou and X. Jiang, Bioact. Mater., 2024, 35, 274–290 CAS .
  5. M. Liu, X. Zeng, C. Ma, H. Yi, Z. Ali, X. Mou, S. Li, Y. Deng and N. He, Bone Res., 2017, 5 DOI:10.1038/boneres.2017.14 .
  6. G. Tang, Z. Tan, W. Zeng, X. Wang, C. Shi, Y. Liu, H. He, R. Chen and X. Ye, Frontiers in Bioengineering and Biotechnology, 2020 DOI:10.3389/fbioe.2020.587658 .
  7. C. Kibungu, P. P. D. Kondiah, P. Kumar and Y. E. Choonara, Front. Mater., 2021 DOI:10.3389/fmats.2021.681960 .
  8. Z. Feyissa, G. D. Edossa, N. K. Gupta and D. Negera, Heliyon, 2023, 9(9) DOI:10.1016/j.heliyon.2023.e20144 .
  9. W. Wang and K. W. K. Yeung, Bioact. Mater., 2017, 224–247,  DOI:10.1016/j.bioactmat.2017.05.007 .
  10. L. Cianferotti, A. R. Gomes, S. Fabbri, A. Tanini and M. L. Brandi, Osteoporosis Int., 2015, 2055–2071,  DOI:10.1007/s00198-015-3203-1 .
  11. D. Goltzman and G. N. Hendy, Nat. Rev. Endocrinol., 2015, 11, 298–307,  DOI:10.1038/nrendo.2015.30 .
  12. D. Cheshmedzhieva, S. Ilieva, E. A. Permyakov, S. E. Permyakov and T. Dudev, Biomolecules, 2021, 11(11) DOI:10.3390/biom11111576 .
  13. M. Huang, R. G. Hill and S. C. F. Rawlinson, Acta Biomater., 2016, 38, 201–211 CrossRef CAS PubMed .
  14. Y. Chen, W. Xu, Z. Pan, B. Li, X. Mo, Y. Li, J. Wang, Y. Wang, Z. Wei, Y. Chen, Z. Han, C. Lin, Y. Liu, X. Ye and J. Yu, Mater. Today Bio, 2024, 29 DOI:10.1016/j.mtbio.2024.101249 .
  15. G. F. Sekar Jeyakumar, P. Velswamy, D. Gunasekaran, N. Panneerselvam Manimegalai, K. Manikantan Syamala and U. Tiruchirappalli Sivagnanam, Int. J. Biol. Macromol., 2023, 252 DOI:10.1016/j.ijbiomac.2023.126524 .
  16. S. R. Kumar, R. Thangam, R. Vivek, S. Srinivasan and N. Ponpandian, Nanoscale Adv., 2020, 2, 3209–3221 RSC .
  17. W. Ding, Y. Ge, T. Zhang, C. Zhang and X. Yin, NPG Asia Mater., 2024, 16 DOI:10.1038/s41427-024-00533-z .
  18. L. Wei, J. Tan, L. Li, H. Wang, S. Liu, J. Chen, Y. Weng and T. Liu, Int. J. Mol. Sci., 2022, 23(3) DOI:10.3390/ijms23031249 .
  19. P. Jin, M. Xia, M. Hasany, P. Feng, J. Bai, J. Gao, W. Zhang, M. Mehrali and R. Wang, Interdiscip. Mater., 2023, 2, 771–788 CAS .
  20. V. H. G. Phan, H. S. Duong, Q. G. T. Le, G. Janarthanan, S. Vijayavenkataraman, H. N. H. Nguyen, B. P. T. Nguyen, P. Manivasagan, E. S. Jang, Y. Li and T. Thambi, J. Nanobiotechnol., 2023, 21(1) DOI:10.1186/s12951-023-02160-2 .
  21. Z. Jiang, S. Qin, W. Wang, T. Du, Y. Zang, Y. He, X. Dong, H. Liu and G. Ma, Smart Mater. Med., 2024, 5, 207–220 Search PubMed .
  22. X. Zhang, B. Yang, L. Feng, X. Xu, C. Wang, Y. wai Lee, M. Wang, X. Lu, L. Qin, S. Lin, L. Bian and G. Li, Bioact. Mater., 2024, 41, 440–454 CAS .
  23. Y. Zhao, D. Guo, S. Hou, H. Zhong, J. Yan, C. Zhang and Y. Zhou, PLoS One, 2013, 8(7) DOI:10.1371/journal.pone.0069339 .
  24. Q. Wu, L. Hu, R. Yan, J. Shi, H. Gu, Y. Deng, R. Jiang, J. Wen and X. Jiang, Bone Res., 2022, 10(1) DOI:10.1038/s41413-022-00224-x .
  25. A. Stumbras, P. Kuliesius, A. Darinskas, R. Kubilius, V. Zigmantaite and G. Juodzbalys, Regener. Med., 2020, 15, 1535–1549 CrossRef CAS PubMed .
  26. K. L. Ou, P. J. Hou, B. H. Huang, H. H. Chou, T. Sen Yang, C. F. Huang and T. Ueno, Appl. Sci., 2020, 10(18) DOI:10.3390/APP10186239 .
  27. S. F. Almojil and M. A. Othman, Sci. Rep., 2019, 9(1) DOI:10.1038/s41598-019-52031-w .
  28. C. Hu, W. Lu, A. Mata, K. Nishinari and Y. Fang, Int. J. Biol. Macromol., 2021, 177, 578–588,  DOI:10.1016/j.ijbiomac.2021.02.086 .
  29. K. White, R. Chalaby, G. Lowe, J. Berlin, C. Glackin and R. Olabisi, Polymers, 2021, 13(14) DOI:10.3390/polym13142274 .
  30. W. J. Kim, H. L. Shin, B. S. Kim, H. J. Kim and H. M. Ryoo, Exp. Mol. Med., 2020, 52, 1178–1184,  DOI:10.1038/s12276-020-0471-4 .
  31. Y. S. Zhu, Y. Gu, C. Jiang and L. Chen, J. Cell Physiol., 2020, 235, 2220–2231 CrossRef CAS PubMed .
  32. M. S. Carvalho, J. M. S. Cabral, C. L. da Silva and D. Vashishth, MDPI AG, 2021, preprint,  DOI:10.3390/polym13071095 .
  33. K. Marycz, A. Śmieszek, K. Kornicka-Garbowska, A. Pielok, M. Janeczek, A. Lipińska, A. Nikodem, J. Filipiak, P. Sobierajska, J. M. Nedelec and R. J. Wiglusz, Int. J. Nanomed., 2021, 16, 6049–6065 CrossRef PubMed .
  34. X. Ren, Q. Zhou, D. Foulad, A. S. Tiffany, M. J. Dewey, D. Bischoff, T. A. Miller, R. R. Reid, T.-C. He, D. T. Yamaguchi, B. A. C. Harley and J. C. Lee, Sci. Adv., 2019, 5 DOI:10.1126/sciadv.aaw4991 .
  35. S. Vimalraj, Gene, 2020, 754,  DOI:10.1016/j.gene.2020.144855.
  36. T. Hasegawa, H. Hongo, T. Yamamoto, M. Abe, H. Yoshino, M. Haraguchi-Kitakamae, H. Ishizu, T. Shimizu, N. Iwasaki and N. Amizuka, Int. J. Mol. Sci., 2022, 23 DOI:10.3390/ijms23179941 .
  37. E. M. Rosset and A. D. Bradshaw, Matrix Biol., 2016, 52-54, 78–87,  DOI:10.1016/j.matbio.2016.02.001 .
  38. A. Singh, G. Gill, H. Kaur, M. Amhmed and H. Jakhu, Progress in Orthodontics, 2018, 19 DOI:10.1186/s40510-018-0216-2 .
  39. M. Bekhouche and A. Colige, Matrix Biol., 2015, 44–46, 46–53 CrossRef CAS PubMed .
  40. E. Stan, C. O. Muresan, E. Daescu, R. Dumache, V. Ciocan, S. Ungureanu, D. Costachescu and A. Enache, Methods Protoc., 2024, 7 DOI:10.3390/mps7040051 .
  41. R. Florencio-Silva, G. R. D. S. Sasso, E. Sasso-Cerri, M. J. Simões and P. S. Cerri, BioMed Res. Int., 2015 DOI:10.1155/2015/421746 .
  42. Y. Zhang, L. Shen, Z. Mao, N. Wang, X. Wang, X. Huang, Y. Hu, D. Shou and C. Wen, Front. Pharmacol., 2017, 8 DOI:10.3389/fphar.2017.00784 .

Footnote

Electronic supplementary information (ESI) available. See DOI: https://doi.org/10.1039/d5bm00349k

This journal is © The Royal Society of Chemistry 2025
Click here to see how this site uses Cookies. View our privacy policy here.