DOI:
10.1039/D5FO03588K
(Paper)
Food Funct., 2026,
17, 461-474
Hypoglycemic effects under in vitro digestion of brewer's spent yeast β-glucan concentrate added to a rice extrudate
Received
22nd August 2025
, Accepted 18th November 2025
First published on 12th December 2025
Abstract
This study aimed to evaluate the potential hypoglycemic properties of brewer's spent yeast β-glucan concentrate (β-GC) through the study of its inhibitory effect on dipeptidyl peptidase IV (DPP-IV), α-amylase, and α-glucosidase enzymes either alone or incorporated into an extruded rice product subjected to simulated gastrointestinal digestion. Moreover, the hypoglycemic effect on 2D mouse jejunal organoids of bioaccessible compounds from extruded rice products to which are added β-glucans was studied. The β-GC showed DPP-IV, α-amylase, and α-glucosidase inhibitory activities increased by the presence of peptides and phenolic acids. The kinetic analysis of α-amylase and DPP-IV inhibition showed that β-GC inhibited these enzymes in a non-competitive mode, while for α-glucosidase, it was competitive. Extruded product with β-GC (ERB) showed a lower degree of starch hydrolysis than that observed for extruded rice (ER). The estimated glycemic index value for ERB was 12% lower than that found for ER (61.2 ± 0.2 vs. 69.5 ± 0.1%, respectively). The ERB-digested products had lower IC50 values for α-amylase, α-glucosidase, and DPP-IV enzymes than those of β-GC, indicating a hypoglycemic-promoting effect on the food matrix, which was associated with the release of phenolic acids and bioactive peptides during in vitro digestion. Moreover, phenolic acids and mannose-linked peptides dialyzed from ERB enhanced the hypoglycemic properties of β-glucan through the inhibition of α-glucosidase and DPP-IV enzymes and the reduction of lactase, sucrose-isomaltase, and glucose transporter 2-gene expression in organoids, which confirmed their hypoglycemic properties.
1. Introduction
Brewer's spent yeast (BSY) is the second most important byproduct of the brewing industry after brewer's spent grain.1 BSY is mostly composed of yeast cells,2 whose main components are β-glucans and mannoproteins.3 BSY β-glucans are homopolysaccharides comprising D-glucose monomers linked by β-(1,3) and, to a lesser extent, β-(1,6) glycosidic bonds.4,5 As is known, these carbohydrates are types of dietary fiber,6 with many health-beneficial properties, such as prebiotic and antidiabetic effects.7,8
The strategy of controlling the activity of digestive enzymes related to carbohydrate catabolism is considered an effective method to modulate starch digestion and the glycemic response of starch-rich foods, such as cereal-extruded products.9,10 A few years ago, most non-digestible polysaccharides were considered physical inhibitors of starch digestion, preventing enzymatic attack in a steric manner, thereby reducing the glycemic index.11 Today, it is known that many indigestible polysaccharides can inhibit digestive enzymes directly. In this regard, Zhang et al.9 reported that β-glucan from hulled barley inhibited α-amylase enzyme activity by a non-competitive mechanism. Moreover, it was found that the Shiitake mushroom polysaccharides, mainly composed of β-glucans, inhibited α-glucosidase enzyme activity by a non-competitive mechanism. However, to date, the inhibition mechanism of β-glucans on the dipeptidyl peptidase IV (DPP-IV) enzyme has not been studied. As is known, this enzyme degrades the incretin hormones glucagon-like peptide 1 (GLP-1) and glucose-dependent insulinotropic peptide (GIP), which promote insulin secretion. Thus, DPP-IV inhibition can be used as a strategy in the treatment of diabetes.12 In addition, the inhibition mechanisms of BSY β-glucans on α-amylase and α-glucosidase enzymes have not been studied.
On the other hand, it was reported that food components could modify the bioactivity of β-glucans through different non-covalent interactions such as electrostatic forces.13 In this sense, it was reported that proteins and β-glucans in barley-based foods interact through electrostatic forces, forming macromolecular complexes.14 Additionally, BSY β-glucans may contain residual mannoproteins and phenolic compounds such as ferulic acid.8,15 Aquino et al.12 found that the mannose-linked peptides released from mannoproteins after simulated gastrointestinal digestion acted as strong inhibitors of the α-glucosidase enzyme, whereas the non-glycosylated peptide fraction exhibited high DPP-IV inhibitory properties. In addition, ferulic acid exhibited strong α-amylase and α-glucosidase inhibitory activity.16 Therefore, these bioactive compounds from β-glucan concentrate and those released during the gastrointestinal digestion of food matrix could modify the inhibitory activity of this polysaccharide on α-amylase, α-glucosidase, and DPP-IV enzymes. The aims of this work were: (i) to evaluate the inhibitory mechanism of brewer's spent yeast β-glucan concentrate on DPP-IV, α-amylase, and α-glucosidase, (ii) to develop an extruded rice product containing these β-glucans and to study the effect of this food matrix on DPP-IV, α-amylase, and α-glucosidase inhibitory activity after a simulated digestive process, and (iii) to evaluate the hypoglycemic effect of bioaccessible compounds from extruded rice product containing β-glucans on 2D mouse jejunal organoids.
2. Materials and methods
2.1. Raw materials and reagents
BSY was provided by Okcidenta (Santa Fe, Santa Fe, Argentina). The rice flour was provided by Adecoagro (Franck, Santa Fe, Argentina). Pepsin from porcine gastric mucosa (P7000; 250 U mg solid), pancreatin from porcine pancreas (P1750; 4× USP), DPP-IV enzyme (D4943), α-glucosidase enzyme (G5003), dithiothreitol (D0632), 2,4,6-Tris(2-pyridyl)-s-triazine (T1253), 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (A3219), 4-nitrophenyl α-D-glucopyranoside (N1377), Gly-Pro-p-nitroanilide (G0513), maltose (47
267), glucose (47
267), caffeic acid (≥98.0% HPLC, C0625), ferulic acid (≥99.0%, W518301), p-sinapic acid (≥98.0%, D7927), gallic acid (97.5–102.5%, 67
384), protocatechuic acid (≥97.0% HPLC, 08
992), 4-hydroxybenzoic acid (≥98.0% HPLC, PHL83051), vanillic acid (≥97.0% HPLC, 94
770), HPLC peptide standard mixture containing angiotensin II, Gly-Tyr, Leu encephalin, Met encephalin, Val-Tyr-Val (H2016), o-phthaldialdehyde (P1378), methanol and acetonitrile HPLC grade were obtained from Merck (Buenos Aires, Argentina). Sodium hydroxide, hydrochloric acid, sulfuric acid, and other reagents were of analytical grade and obtained from Cicarelli Laboratorios (San Lorenzo, Santa Fe, Argentina).
2.2. Brewers’ spent yeast β-glucan concentrate
In order to obtain a β-glucan concentrate (β-GC), BSY was dispersed in phosphate buffer (50 mmol L−1, pH 5.0) for 4 h at 90 °C according to Li and Karboune.17 The dispersion was then centrifuged at 3000g for 30 min at 4 °C, and the β-glucans in the supernatant were precipitated with 75 mL per 100 mL of ethanol for 24 h at 4 °C and pH 10.0.18 The precipitated BSY β-glucans were washed until neutral pH and then air-dried in an oven at 50 °C.
β-Glucan content was determined using Megazyme® K-YBGL. Protein, moisture, and ash contents were determined according to AOAC methods.19 The peptide content (free amine groups) of β-GC was measured according to Nielsen et al.,20 using a calibration curve of L-serine (0–0.95 mmol L−1) and expressed as mmol per 100 g. The RNA content of β-GC was measured after acid hydrolysis according to Aquino et al.18 Analyses were performed in triplicate.
The analysis of free and bound phenolic compounds of β-GC was performed according to Cian et al.21 with slight modifications. Briefly, one gram of the samples was placed into 15 mL centrifuge tubes. Five milliliters of 80% methanol:20% water, and 0.5% acetic acid were added, and the mixture was sonicated for 30 minutes (Arcano, China). The mixture was then centrifuged at 5000g for 20 min (Cavour VT 3216, Buenos Aires, Argentina), and the resulting supernatants were collected into 50 mL centrifuge tubes. The pellet extractions were repeated once. After centrifugation, supernatants were combined and used for analysis. The resulting pellets were used for the extraction of bound phenolic compounds. Pellets were resuspended in 5 mL of water, homogenized, and centrifuged at 5000g for 20 min, and supernatants were discarded. A 10 mL aliquot of 2 mol L−1 NaOH was added to each tube, and samples were incubated for 2 h with agitation (Decalab-fbr, Buenos Aires, Argentina). Then, the pH of the samples was adjusted to 2.0 with 12 mol L−1 HCl, and 10 mL of ethyl acetate was added. Samples were vigorously shaken, centrifuged at 5000g for 20 min, and the organic phase was recovered. The procedure was repeated once, and the combined ethyl acetate aliquots were evaporated until dryness using a rotary evaporator (Buchi, Flawil, Switzerland). Dry samples were resuspended in 1 mL of methanol and reserved for analysis. All extractions were made in triplicate. Phenolic compounds were separated on a 100 mm × 3.0 mm, 2.7 μm particle size Poroshell 120 column (Agilent, USA), using an LC-40B XR high-performance liquid chromatograph with a diode array detector (SPD M40) and Lab Solutions for data processing and control software (Shimadzu Co., Kyoto, Japan), according to Garzón et al.22 with modifications. Extracts were filtered through a Millipore 0.20 μm pore size filter and separated at 35 °C and at 0.4 mL min−1 flow, using a mobile phase gradient of 0.1% formic acid (A) and acetonitrile (B) at 5–6% B for 2 min, 6–7% B for 4 min, 7% B for 7 min, 7–9% B for 9 min, 9% B for 12 min, 9–12% B for 16 min, 12–14% B for 17 min, 14–16% B for 18 min, 16–18% B for 22 min, 18–25% B for 28 min, 25–28% B for 30 min, 28–30% B for 38 min, 30–100% B for 40 min, 100% B for 45 min, 100–5% B for 47 min, and 5% B for 52 min. Peak identification was performed by comparing retention times and spectral characteristics with external standards. Phenolic compound standards were dissolved in methanol, and calibration curves of caffeic acid (0.2–10.0 mg L−1, limit of detection, LOD = 0.58 mg L−1, limit of quantification, LOQ = 1.75 mg L−1), p-coumaric acid (0.2–10.0 mg L−1, LOD = 0.60 mg L−1, LOQ = 1.82 mg L−1), ferulic acid (0.2–10.0 mg L−1, LOD = 0.48 mg L−1, LOQ = 1.45 mg L−1), and sinapic acid (0.2–10.0 mg L−1, LOD = 0.44 mg L−1, LOQ = 1.32 mg L−1) were prepared and used for quantification through the external standard method. Analyses were performed in triplicate. Free, bound, and total phenolic compounds of samples were expressed as mg per 100 g dry basis.
Fast peptide liquid chromatography (FPLC) of β-GC was performed according to Cian et al.23 using a Knauer Azura® system (Germany). For peptide analysis, a Superdex 30 10/300 6L (GE Life Sciences, Piscataway, NJ, USA) was used. Molecular mass of peptide fractions was estimated using molecular weight standards (Sigma Chemical Co., St Louis, MO, USA). Moreover, the ratio between a peak area and the total area of the chromatogram was calculated using Origin software version 7.5 (OriginLab®, Northampton, Massachusetts, USA).
Infrared spectra of β-GC, mannoproteins, and ferulic acid were acquired using a Shimadzu IR Prestige-21 infrared spectrometer (Kyoto, Japan). The solid sample was dried in an oven for 24 h at 80 °C. Then, it was diluted in KBr (1% of the sample in KBr) and placed in the appropriate sample holder. Measurements were performed at room temperature. Spectra were obtained in the 400–4000 cm−1 range by accumulation of 60 scans at 8 cm−1 resolution. FTIR spectra were recorded using IR solution software, version 1.3 (Shimadzu, Japan). Before sample collection, a background spectrum was recorded and subtracted from the sample spectra. All experiments were performed in duplicate.
The evaluation of α-amylase and α-glucosidase inhibitory activities of β-GC was performed according to Donkor et al.24 In addition, the method proposed by Wang et al.25 was used to evaluate the inhibitory activity of DPP-IV. Briefly, 25 μL of samples in 100 mmol L−1 Tris buffer (pH 8.0) was added with 25 μL of 1.59 mmol L−1 Gly-Pro-p-nitroanilide in Tris buffer and incubated at 37 °C for 20 min. Then, 50 μL of 0.01 U mL−1 DPP-IV was added, and the reaction mixture was incubated at 37 °C for 60 min. The reaction was stopped by adding 100 μL of 1 mol L−1 sodium acetate buffer (pH 4.0). The absorbance of the resulting solution was measured at 385 nm with an Asys UVM 340 Microplate Reader (BMG LABTECH, Offenburg, Germany). The DPP-IV inhibition rate was calculated according to Wang et al.25 The concentration of the sample needed to inhibit 50% of enzyme activity was defined as the IC50 value. To determine the IC50 value of these enzymes, serial dilutions of samples from 0 to 2 mg of solids mL−1 were prepared. Moreover, the IC50 value was calculated according to Aquino et al.12
To remove peptides and phenolic compounds from the β-GC and to assess the α-amylase, α-glucosidase, and DPP-IV inhibitory effect of this polysaccharide with a low level of impurities, β-GC was dialyzed against double-distilled water for 8 h using a 6 kDa cut-off membrane. This process was repeated three times. The retained fraction (>6.0 kDa) was named as β-glucan-enriched concentrate (β-GEC), and its chemical composition was determined as above. The inhibitory activities and the IC50 values for these enzymes were determined as mentioned before.
The kinetic analysis of enzymes was performed using the Michaelis–Menten equation. For α-amylase, different substrate concentrations (0.5–10.0 mg mL−1 starch) were incubated with the enzyme solution with and without β-GC or β-GEC. For α-glucosidase, different substrate concentrations (1.2–10.0 mmol L−1p-nitrophenyl α-D-glucopyranoside) were incubated with the enzyme solution with and without β-GC or β-GEC. For DPP-IV, different substrate concentrations (0.8–10.0 mmol L−1 Gly-Pro-p-nitroanilide) were incubated with the enzyme solution with and without β-GC or β-GEC. In all cases, the concentration of β-GC used in the assay corresponded to the IC50 value (Table 3). Then, the experimental data were fitted with GraphPad Prism software version 6.07 (GraphPad Software, La Jolla, San Diego, CA, USA) using the Michaelis–Menten equation. Vmax and Km parameters were provided by the same software, taking into account all the experimental plots. All determinations were performed in triplicate.
2.3. Extruded rice products
Extruded rice products were produced using rice flour with a particle size <590 μm. Samples were conditioned 1 h before extrusion by adjusting the moisture content to 15 g per 100 g. Two kg of samples were prepared for extruded rice product (ER) and extruded rice product combined with BSY β-glucan concentrate (β-GC) at 14 g per 100 g of rice flour (ERB). The level of BSY β-glucan was selected taking into account the hypoglycemic properties of corn extrudates combined with mushroom β-glucans (5–10 g per 100 g) according to Brennan et al.10 Extrusion was carried out using a Jinan Kelid Machinery Co. Ltd (China) closed barrel twin screw extruder, with four independent temperature sectors comprising electric heaters and water circulation cooling to adjust the temperature values within a range of 80 to 300 °C, screw diameter of 30 mm, L/D ratio of 20, and cylindrical die diameter of 4.8 mm. The screw rate was set at 40 Hz and the outlet temperature at 120 °C.
Protein, moisture, crude fat, and ash contents were determined according to AOAC methods.19 Total starch and total dietary fiber (TDF) contents of the samples were determined using Megazyme® K-DSTRS and K-TDFR kits, respectively. Non-starch carbohydrates were calculated by subtracting the sum of protein, crude fat, ash, total starch, and TDF from 100. The mannose and reducing carbohydrate contents of ER and ERB were measured after acid hydrolysis using a Megazyme kit (MANGL 04/20) and the Somogyi–Nelson assay, respectively.18,26 Moreover, the RNA content of ER and ERB was measured as above. Analyses were performed in triplicate.
The analysis of free and bound phenolic compounds in ER and ERB was performed as described in section 2.2, using water as the extractant and adding 1 mg of α-amylase (Alphalase AP4, Novozymes, Bagsværd, Denmark) per gram of sample. Extracts were incubated at 75 °C for 60 min before the centrifugation step, and then the protocol was followed as explained. Analyses were performed in triplicate, and phenolic compounds of samples were expressed as mg per 100 g dry basis.
The estimated glycemic index (eGI) of ER and ERB during 180 min was determined according to Goñi et al.27 To monitor starch degradation, Megazyme® K-DSTRS was used, and the degree of starch hydrolysis was calculated for a 100 mg sample. Then, the area under the curve (AUC) of the degree of starch hydrolysis vs. time (90 min) was determined using Graphpad Prism 6.07 software (GraphPad, Software Inc., San Diego, CA, USA). The hydrolysis index (HI) was obtained from the ratio between the AUC of the sample and the AUC of the reference food (white bread, AUC: 12
934) and expressed as a percentage.28 Then, the eGI was calculated as follows:
where eGI is the estimated glycemic index and HI is the hydrolysis index.
The expansion (ratio between the diameter of the extruded material and the diameter of the die) and specific volume (ratio between the volume of the extruded material and its weight in dry base, mL g−1) of ER and ERB were determined.
Texture analysis of ER and ERB was performed according to Brennan et al.10 For this, extruded products were air-dried in an oven at 50 °C until a moisture content of 6 g per 100 g was reached. Product hardness was measured with a TA-XT Plus texture analyzer (Stable Micro Systems Ltd, Godalming, UK) using a P/35 probe (35 mm diameter). The analysis was set up with the following parameters: 5 mm s−1 pre-test speed; 2 mm s−1 test speed; 10 mm s−1 post-test speed; 2 mm distance, trigger force at 0.1 kg (determined by preliminary investigations to avoid false force recording). Numerical strength values were measured using Exponent software (version 6.1.1.0). All measurements were performed 20 times.
For hydration properties, the samples were milled using a cyclone sample mill (Belt Drive UD3010 UDY Corporation, Colorado, USA) with a sieve of 1 mm. Then, the water absorption (WA, mL water per g solids) and swelling power (SP, %) of ER and ERB at 25 °C were determined according to Albarracín and Drago.29 All determinations were performed in triplicate.
2.4. Simulated gastrointestinal digestion of extruded rice products
Simulated gastrointestinal digestion (SGID) of ER and ERB was performed according to Aquino et al.30 Briefly, 1 g of extruded rice products was dispersed in 10 mL of ultrapure water. Then, the pH of the dispersions was adjusted to 2.0 with 2.8 mol L−1 HCl, and 0.8 mL of pepsin (16 g of pepsin solution per 100 mL of 0.1 mol L−1 HCl) was added. The samples with pepsin were incubated at 37 °C for 2 h under constant agitation in a water bath. After pepsin digestion, dialysis bags (cut-off: 6–8 kDa) containing 10 mL of 0.15 mol L−1 NaHCO3 buffer were placed in each flask, and samples were incubated for 50 min in a shaking water bath at 37 °C. Then, 6.25 mL of pancreatin solution (0.4 g per 100 mL pancreatin in 0.1 mol L−1 NaHCO3) was added to each flask, and the incubation continued for another 2 h. The dialysates corresponding to the in vitro intestinal phase (named ER-D and ERB-D) were transferred to flasks, weighed, and frozen at −20 °C until analysis. The undialyzed digested samples (named ER-DG and ERB-DG), i.e., the residues obtained after SGID that remain outside the dialysis bags, were centrifuged at 12
000g for 20 min at 20 °C. The supernatants were divided into aliquots and frozen at −20 °C until analysis. For analysis, the supernatants were thawed rapidly (∼10 min) and used. The entire procedure was performed in triplicate.
They were fractionated in aliquots before freezing and were defrosted only once at the time of the analysis. Once defrosted (∼10–15 min), they were used quickly.
2.5. Characterization and bioactive properties of gastrointestinal digestion products
The mannose, peptide, and reducing carbohydrate contents of ER-D and ERB-D were measured as above. The total content of dialyzed peptides was expressed as mmol. The dialyzability of the reducing carbohydrates (DRC) was calculated as follows:
The maltose and glucose contents of ER-D and ERB-D were determined by HPLC according to Van de Velde et al.31 For this purpose, a high-performance liquid chromatograph, LC-40B XR, with a refractive index detector (RID-20A) was used. Separation was performed on a Eurokat Ca column (Knauer, Germany) of 300 mm length × 8 mm inner diameter employing bi-distilled water as the mobile phase under isocratic conditions at a flow rate of 0.15 mL min−1 at 80 °C. External calibration curves were plotted using standard compounds of maltose and glucose within a concentration range of 1200–5000 mg L−1. The dialyzability of maltose or glucose was calculated as the ratio of the total maltose or glucose content in the dialyzed sample to the total starch content of the extruded sample and expressed as g of maltose or glucose per 100 g of total starch. All determinations were made in triplicate.
Fast peptide liquid chromatography (FPLC) and the analysis of free phenolic compounds of ER-D and ERB-D were performed as above. Total phenolic compounds of dialysates and digested samples were expressed as µg. Moreover, the dialyzability of phenolic compounds was calculated according to Heinen et al.32
The α-amylase activity of ER-DG and ERB-DG was measured according to Donkor et al.24 One unit (U) of α-amylase activity was defined as the amount of enzyme that released 1 μmol of glucose equivalent per minute.33 The α-amylase activity was estimated using a calibration curve for glucose over a concentration range of 0 to 17 mmol L−1 and it was expressed as U mL−1. Moreover, the α-amylase, α-glucosidase, and DPP-IV inhibitory activities and the IC50 value of ER-DG, ER-D, ERB-DG, and ERB-D were determined as mentioned before. All determinations were made in triplicate.
2.6. Hypoglycemic effect of bioaccessible compounds on 2D mouse jejunal organoids
Standard (3D) organoid culture from mouse jejunum was performed according to Cian et al.34 Experiments with organoids were authorized by the Committee on Animal Experimentation of the Junta of Andalusia (Spain, ref 17/02/2022/015). Organoid monolayers (2D) were generated from 3D organoids 5 days after seeding according to Cian et al.34 To evaluate the regulation of gene expression, 2D organoids were treated with ER-D and ERB-D (0.1 g solids per L) under basal conditions. After 24 h of incubation, organoids underwent RNA extraction. Total RNA from tissue was isolated according to Cian et al.34 One microgram of RNA per sample was retro-transcribed using an iScript Select cDNA Synthesis kit (Biorad Laboratories, California, USA). Specific DNA sequences were amplified with a Biorad CFX connect real-time PCR device (Alcobendas, Madrid, Spain). Primers used are shown in Table 1. Results were expressed as 2−ΔΔCt using Ppib, Hprt and 18S as reference genes.
Table 1 Primers used in the RT-qPCR analysis
| Gene |
Forward 5′-3′ |
Reverse 3′-5′ |
|
18s
|
TGGTGGAGCGATTTGTCTGG |
ACGCTGAGCCAGTCAGTGTACG |
|
Hprt
|
AGGGATTTGAATCACGTTTG |
TTTACTGGCAACATCAACAG |
|
Lct
|
TTCCTATCAGGTTGAAGGTG |
GTCATTCCCAATCTTCAGTG |
|
Ppib
|
CAAATCCTTTCTCTCCTGTAG |
TGGAGATGAATCTGTAGGAC |
|
Slc2a2
|
TTGTGCTGCTGGATAAATTC |
AAATTCAGCAACCATGAACC |
|
Sis
|
GAAGATAACTCTGGCAAGTC |
GTCCAATGAGCTCTTGATATTG |
2.7. Statistical analysis
Results were expressed as the mean ± standard deviation, and they were analyzed by analysis of variance (one-way ANOVA). The statistical differences among samples were determined using Tukey's Honestly Significant Difference test with a level of significance α of 0.05, using Statgraphics Centurion XV 15.2.06 software (StatPoint Technologies, Inc., Warrenton, Virginia, USA). Graphpad Prism 6.07 software (GraphPad, Software Inc., San Diego, CA, USA) was used to analyze the RT-qPCR data. RT-qPCR data are given as relative expression (fold change) of organoids treated with samples versus the control (organoids without sample), assigned a mean value of 1.
3. Results and discussion
3.1. Characterization of BSY β-glucan concentrate
The β-glucan content of β-GC (Table 2) was higher than that reported by Pérez-Bassart et al.35 for the β-glucan extract obtained from the Pleurotus ostreatus mushroom by aqueous heat treatment and subsequent ethanol precipitation (47.62 ± 4.05 g per 100 g), indicating a relatively high purity. However, the protein and peptide contents in β-GC were not negligible (Table 2). Thus, precipitation with ethanol co-precipitated proteins and peptides, which were displayed by FPLC gel filtration. The β-GC peptide profile revealed six main peaks of >7.0 kDa, 625 Da, 510 Da, 402 Da, 306 Da, and 212 Da (Fig. 1A). The peak >7 kDa corresponds to proteins, and its proportion with respect to the total area of the chromatogram was 50.9%. Moreover, the proportion of 510 Da peptides was 31.9%, indicating a high content of low MW species in β-GC. These low MW compounds are either inherent to the yeasts or incorporated by them from the wort. In this regard, it was reported that the thermal treatment of BSY promotes yeast autolysis by activating endogenous proteases, releasing low-MW peptides.36 Moreover, it was observed that the use of ethanol to obtain yeast β-glucan by precipitation also contributes to the co-precipitation of proteins, peptides, and phenolic compounds, either bound by non-covalent interactions or by the formation of macromolecular aggregates due to protein denaturation.37 In this regard, ferulic and p-sinapic acids were found in β-GC (Table 2). In addition, 88% of ferulic acid and 93% of p-sinapic acid were in their free forms (data not shown), indicating that these phenolic acids interact mainly through non-covalent bonds with the β-glucans and proteins/peptides. Note that phenolic compounds are incorporated by yeasts mainly from malted barley.38 On the other hand, the RNA content of β-GC was 2.24 ± 0.2 g per 100 g, which indicates that ethanol contributes to nucleic acid precipitation from BSY extract. It was reported that ethanol decreases the repulsive forces of the nucleic acid chains, which reduces the solvation layer, favoring the RNA precipitation.18
 |
| | Fig. 1 FPLC gel filtration profile of β-glucan concentrate (A), FT-IR spectrum of β-glucan concentrate (B), Michaelis–Menten plots of α-amylase enzyme in the absence (●) or presence of β-glucan concentrate (◆) or the β-glucan-enriched concentrate (▲) (C), Michaelis–Menten plots of α-glucosidase enzyme in the absence (●) or presence of β-glucan concentrate (◆) or the β-glucan-enriched concentrate (▲) (D), and Michaelis–Menten plots of DPP-IV enzyme in the absence (●) or presence of β-glucan concentrate (◆) or the the β-glucan-enriched concentrate (▲) (E). | |
Table 2 Chemical composition of β-glucan concentrate (β-GC) and β-glucan-enriched concentrate (β-GEC)
| Components |
β-GC
|
β-GEC
|
| Results are expressed as mean value ± standard deviation (n = 3). Different letters within a row indicate significant differences between samples (p < 0.05) according to Tukey's honestly significant difference test. β-GC: β-glucan concentrate. β-GEC: β-glucan-enriched concentrate obtained after dialysis using a 6 kDa cut-off membrane. d.w.: dry weight. |
| β-Glucan (g per 100 g d.w.) |
63.0 ± 2.3a |
85.1 ± 3.6b |
| Protein (g per 100 g d.w.) |
5.2 ± 0.2b |
0.1 ± 0.0a |
| Peptide (mmol per 100 g d.w.) |
0.183 ± 0.01b |
0.022 ± 0.00a |
| Total ferulic acid (µg per 100 g d.w.) |
221.1 ± 22.3b |
0.37 ± 0.03a |
| Total p-sinapic acid (µg per 100 g d.w.) |
228.4 ± 60.1b |
15.65 ± 0.54a |
As shown in Fig. 1B, the FTIR profile of β-GC exhibited the characteristic bands at 1068, 991, and 864 cm−1 of β-glucans. In this regard, the anomeric region of carbohydrates at 864 cm−1 represents the β-1,3-linkage of the β-glycosidic bond and can be attributed to CH deformation. The β-1,6-glucan and mannan bands overlap, because they appear at 991 and 988 cm−1, respectively. The band representing α-linked glucans is located at 1122 cm−1 and can be attributed to low levels of α-glucan, which is common in yeast β-glucan extracted with organic solvents such as ethanol.39 A shoulder at 1161 cm−1 was observed and represents the 1,3/1,6-glucan characteristic band. These results are consistent with the FTIR analysis reported by Bikmurzin et al.39 for different β-glucan fractions obtained from yeasts using organic solvent precipitation. The 1736 cm−1 band, which represents the C
O stretching in the FTIR spectrum of yeast β-glucan, can be overlapped with the characteristic ferulic acid band of 1701–1662 cm−1 (C
O).40 On the other hand, the presence of proteins in β-GC was confirmed by the FITR spectrum, since β-GC showed a band at 1651 cm−1 that was associated with yeast mannoprotein residues,41 which produce acylamino (glycoprotein) vibrations and can also overlap with ferulic acid bands between 1653 and 1458 cm−1 (C
C aromatic ring).40
On the other hand, the peptide content of β-GEC was lower than that obtained for β-GC (Table 2). Similarly, the total ferulic and p-sinapic acid contents of β-GEC were lower than that found for β-GC (Table 2). Therefore, the dialysis process efficiently reduced the content of peptides by 8 times and phenolic acids (by ∼600 and 15 times for ferulic and p-sinapic acids, respectively) in β-GC. In this regard, the β-glucan content in β-GEC was higher than that obtained for β-GC (Table 2).
The β-GC exhibited α-amylase, α-glucosidase, and DPP-IV inhibitory activity, the inhibition value at 1 mg solids per mL for α-amylase, α-glucosidase, and DPP-IV enzymes being 80.1 ± 2.7, 82.1 ± 3.1, and 55.3 ± 1.1% respectively. Analogously, β-GEC also exhibited α-amylase, α-glucosidase, and DPP-IV inhibitory activity, the inhibition values at 1 mg solids per mL being 68.2 ± 1.8, 69.4 ± 2.2, and 49.5 ± 1.2% for α-amylase, α-glucosidase, and DPP-IV enzymes, respectively. Therefore, the presence of peptides and phenolic acids increased the inhibitory properties of β-glucans against these enzymes. It has been reported that ferulic acid has strong α-amylase inhibitory activity and p-sinapic acid has strong α-glucosidase inhibitory activity.16,42 Moreover, mannose-linked peptides from BSY mannoproteins exhibited α-glucosidase inhibitory properties, and non-glycosylated peptides effectively inhibit the DPP-IV enzyme.12 Thus, the presence of low MW peptides (625–212 Da) and free phenolic acids in β-GC could contribute to the inhibitory properties of β-glucans against these enzymes. This effect was corroborated by the IC50 values obtained for the α-amylase, α-glucosidase, and DPP-IV enzymes, where β-GC presented lower IC50 values than those obtained for β-GEC (Table 3).
Table 3 Enzyme kinetic analysis of α-amylase, α-glucosidase and DPP-IV enzymes inhibited by β-GC or β-GEC
| |
Sample concentration (IC50) |
K
appm
|
V
appmax
|
| |
(mg solids per mL) |
(mg mL−1) |
(µmol min−1 L−1) |
| α-Amylase |
0 |
3.084 ± 0.215a |
80.27 ± 0.31c |
| α-Amylase + β-GC |
0.58 ± 0.01a |
2.965 ± 0.091a |
35.9. ± 0.11a |
| α-Amylase + β-GEC |
0.70 ± 0.01b |
2.793 ± 0.252a |
60.69 ± 0.24b |
| |
(mg solids per mL) |
(mmol L−1) |
(µmol min−1 L−1) |
|
K
appm: Michaelis constant. Vappmax: maximum reaction velocity. DPP-IV: dipeptidyl peptidase IV enzyme. Results are expressed as mean value ± standard deviation (n = 3). Different letters within the same column for each enzyme indicate significant differences between samples (p < 0.05) according to Tukey's honestly significant difference test. β-GC: β-glucan concentrate. β-GEC: β-glucan-enriched concentrate obtained after dialysis using a 6 kDa cut-off membrane. |
| α-Glucosidase |
0 |
7.656 ± 0.551a |
2.57 ± 0.18a |
| α-Glucosidase + β-GC |
0.16 ± 0.00a |
11.141 ± 0.668b |
2.59 ± 0.11a |
| α-Glucosidase + β-GEC |
0.25 ± 0.01b |
10.228 ± 0.312b |
2.62 ± 0.05a |
| |
| DPP-IV |
0 |
1.288 ± 0.039a |
1.29 ± 0.03c |
| DPP-IV + β-GC |
0.45 ± 0.00a |
1.308 ± 0.019a |
0.69 ± 0.03a |
| DPP-IV + β-GEC |
0.63 ± 0.02b |
1.284 ± 0.026a |
0.85 ± 0.04b |
The kinetic analysis of α-amylase inhibition showed that β-GC inhibited the enzyme via a non-competitive mode (Fig. 1C). As shown in Table 3, there was no significant difference in Kappm without inhibitor or in the presence of β-GC, while the Vappmax value for α-amylase activity was reduced with the addition of β-GC (p < 0.05). In addition, β-GEC inhibited the α-amylase in a non-competitive mode (Fig. 1C and Table 3). Thus, the presence of peptides and phenolic acids did not modify the α-amylase inhibition mechanism of β-glucans. This result agrees with that reported by Zhang et al.9 for β-glucan extracted from hulled barley, which inhibited this enzyme in a non-competitive mechanism. As is known, a non-competitive inhibitor binds to functional groups of the enzyme located in a different place from the active site, causing allosteric changes, which reduce enzymatic activity.30 Thus, the β-glucan of β-GC would bind to the allosteric site of α-amylase, causing a conformational change and reducing its activity.
Regarding the α-glucosidase inhibitory mechanism, there was no significant difference in Vappmax without inhibitor or in the presence of β-GC or β-GEC (p > 0.05) (Table 3). However, the Kappm value for α-glucosidase activity was reduced with the addition of β-GC or β-GEC (p < 0.05), indicating that the β-GC and β-GEC inhibited this enzyme via a competitive mechanism (Fig. 1D). In this sense, it has been reported that β-glucan isolated from yeast can act as a competitive inhibitor against this enzyme due to its structural similarity with natural substrates, allowing it to bind to the active site of this enzyme.43 Moreover, ferulic acid was found to exert a competitive inhibition mechanism against α-glucosidase.44 Thus, the presence of phenolic acids in β-GC could contribute to the inhibition mechanism observed for β-glucans.
Finally, the β-GC inhibited the DPP-IV enzyme by a non-competitive mode (Fig. 1E). As shown in Table 3, the Vappmax of DPP-IV with β-GC was lower than that obtained for the free enzyme (p < 0.05), while there was no significant difference in Kappm without inhibitor or in the presence of β-GC (p < 0.05). In agreement, the β-GEC inhibited the enzyme in a non-competitive mode (Fig. 1E). As shown in Table 3, the Vappmax value for DPP-IV activity was reduced with the addition of β-GEC (p < 0.05), while the Kappm was not affected. BSY peptides were reported to inhibit DPP-IV enzyme non-competitively.12 Thus, the low MW peptides (625–212 Da) of β-GC could also contribute to this inhibitory mechanism. Besides, it has been shown that the binding of cinnamic acid derivatives through hydrogen bonds to DPP-IV produces conformational changes in the enzyme, decreasing its substrate binding capacity (non-competitive mechanism).45 Thus, the presence of BSY peptides and phenolic acids in β-GC could contribute to the inhibition mechanism observed for β-glucans. This is the first report that demonstrates the mechanism of inhibition of BSY β-glucans on the DPP-IV enzyme.
3.2. Extruded products and physicochemical characterization
The chemical composition of the extruded products is shown in Table 4. There were no differences in moisture, protein, lipid, and carbohydrate contents between extrudates (p < 0.05). However, ERB presented lower total starch content and a 2.4-fold increase in TDF content than ER (p < 0.05). These results can be attributed to the effect of replacing rice flour with BSY β-glucan concentrate. In agreement, Brennan et al.10 reported that the addition of mushroom β-glucan extracts at a 10% replacement level to extruded white wheat products increased the TDF content by 1.8-fold. On the other hand, the mannose content of ERB was higher than that found for ER (p < 0.05) due to the presence of residual mannoproteins in the β-glucan concentrate obtained from BSY. As is known, these glycoproteins contain mannose residues in a proportion ranging from 50 to 95% of carbohydrates and may be covalently linked to the structural β-glucans from the yeast cell wall.17,46 Moreover, the ERB presented around 0.3 g per 100 g RNA content, which could be associated with the β-glucan production process. Note that the BSY β-glucans were obtained by ethanolic precipitation at alkaline pH, which leads to RNA and protein co-precipitation.18 However, this RNA content of ERB is acceptable for human consumption.47
Table 4 Chemical composition of extruded products
| Components |
ER (g per 100 g d.w.) |
ERB (g per 100 g d.w.) |
| Chemical composition expressed as mean ± SD (n = 3). Different letters within a row indicate significant differences between samples (p < 0.05). Calculated by difference. Mannose content was subtracted from the total carbohydrate content calculated by difference. g per 100 g wet weight. N.D.: not detected (limit of detection – LOD = 0.05 g RNA per 100 g d.w.). ER: extruded rice product. ERB: extruded rice product combined with β-glucan concentrate (β-GC). d.w.: dry weight. |
| Protein |
7.84 ± 0.40 |
8.43 ± 0.10 |
| Crude lipid |
0.55 ± 0.02 |
0.60 ± 0.04 |
| Total starch |
80.00 ± 2.42b |
67.30 ± 1.33a |
| Total dietary fiber |
3.32 ± 0.11a |
7.94 ± 0.19b |
| Ash |
0.65 ± 0.01a |
7.43 ± 0.22b |
| Carbohydratesa |
6.46 ± 0.11 |
5.42 ± 0.16 |
| RNA |
N.D. |
0.31 ± 0.00 |
| Mannoseb |
1.18 ± 0.13a |
2.57 ± 0.12b |
| |
| Moisturec |
9.29 ± 0.28 |
9.65 ± 0.30 |
As shown in Table 5, the main free and bound phenolic compound in both extruded products was ferulic acid, reaching more than 80% of the total phenolic content. Moreover, the free ferulic acid content in ERB was higher than that obtained for ER (0.433 ± 0.041 vs. 0.333 ± 0.001 mg per 100 g, respectively). As mentioned, β-GC contains residual ferulic and p-sinapic acids.8,38 Thus, the increase in the free phenolic content of ERB can be attributed to the addition of β-GC to the extruded rice product.
Table 5 Free and bound phenolic compounds of extruded products
| Compound |
|
Free (mg per 100 g d.w.) |
Bound (mg per 100 g d.w.) |
Total (mg per 100 g d.w.) |
| Data expressed as mean ± SD (n = 3). Different letters within the same column for a particular phenolic compound indicate significant differences between samples (p < 0.05). ER: extruded rice product. ERB: extruded rice product combined with β-glucan concentrate (β-GC). d.w.: dry weight. |
| Caffeic acid |
ER
|
0.012 ± 0.004a |
0.007 ± 0.001a |
0.019 ± 0.005a |
|
ERB
|
0.008 ± 0.002a |
0.006 ± 0.002a |
0.014 ± 0.002a |
| |
|
p-Coumaric acid |
ER
|
0.059 ± 0.001b |
0.110 ± 0.030a |
0.169 ± 0.029a |
|
ERB
|
0.020 ± 0.000a |
0.092 ± 0.001a |
0.114 ± 0.026a |
| |
| Ferulic acid |
ER
|
0.333 ± 0.001a |
5.697 ± 0.285a |
6.030 ± 0.285a |
|
ERB
|
0.433 ± 0.002b |
4.785 ± 0.109a |
5.275 ± 0.201a |
| |
|
p-Sinapic acid |
ER
|
0.158 ± 0.005a |
0.0026 ± 0.007a |
0.185 ± 0.012a |
|
ERB
|
0.127 ± 0.008a |
0.022 ± 0.005a |
0.149 ± 0.014a |
| |
| Total |
ER
|
0.563 ± 0.000a |
5.839 ± 0.248a |
6.403 ± 0.248a |
|
ERB
|
0.588 ± 0.051a |
4.905 ± 0.117a |
5.552 ± 0.160a |
Table 6 shows the physicochemical properties of the extruded products. ERB exhibited lower expansion and specific volume than ER (p < 0.05). These results may be due to the addition of β-GC to the extrudates, resulting in an increase in the TDF content of the product. In this regard, it was reported that during the extrusion process, the fiber reduces the degree of cooking and consequently the expansion of the products.48 Furthermore, it has been shown that the addition of dietary fiber to extruded products produces an increase in apparent density, with a consequent reduction in specific volume.49 On the other hand, it was reported that the inclusion of fiber in cereal-based extrudates increases the hardness of the obtained products due to greater water retention, leading to denser, heavier, and harder extruded products.50 In line with this, the hardness (force required to compress the samples) of ERB was higher than that found for ER (Table 6). Moreover, the water absorption and swelling power of ERB were higher than those obtained for ER (p < 0.05), probably due to the high water-binding capacity of β-glucans.51 It has been reported that high molecular weight fibers modified the structure of the product, increasing the water absorption of the extrudates.10
Table 6 Physicochemical characteristics and estimated glycemic index (eGI) of extruded products
| |
ER
|
ERB
|
| Results expressed as mean ± SD (n = 3). Different symbols within a row indicate significant differences between samples (p < 0.05). ER: extruded rice product. ERB: extruded rice product combined with β-glucan concentrate (β-GC). eGI = 39.71 + 0.549 HI. |
| Expansion |
3.09 ± 0.05b |
2.50 ± 0.07a |
| Specific volume (mL g−1) |
7.72 ± 0.32b |
5.32 ± 0.30a |
| Hardness (kgf) |
1.07 ± 0.03a |
1.73 ± 0.05b |
| Water absorption (mL water per g solids) |
6.45 ± 0.01a |
7.36 ± 0.01b |
| Swelling power (%) |
7.52 ± 0.13a |
8.01 ± 0.01b |
| eGIa |
69.5 ± 0.1b |
61.2 ± 0.2a |
3.3. Inhibitory properties of gastrointestinal digestion products on α-amylase, α-glucosidase and dipeptidyl peptidase IV activity
Fig. 2A shows the degree of starch hydrolysis of ER and ERB. The extruded product without β-glucans exhibited a higher degree of starch hydrolysis throughout the reaction time than that observed for ERB (p < 0.05), with the values at 180 min being 90.6 ± 3.8 and 76.4 ± 2.5% for ER and ERB, respectively. In agreement, ER had a higher estimated glycemic index (eGI) than ERB (Table 6). The eGI value obtained for ER was similar to that reported by Liu et al.52 for extruded rice product obtained at 120 °C (70.81 ± 0.78). In addition, the eGI value obtained for ERB was 12% lower than that found for ER, which was in line with the lower dialyzability of reducing carbohydrates in ERB-D (Fig. 2B). Consistent with this result, the addition of fungal β-glucans to extruded corn products reduced the eGI by 15% compared to the control without fungal β-glucans.10 Thus, the reduction of eGI in ERB can be mainly attributed to the presence of β-GC. It was reported that an extruded barley product with highly soluble β-glucan content hindered the complete gelatinization of the starch, reducing its rate of digestion.53 Moreover, it was postulated that these polysaccharides hinder starch digestion by increasing viscosity and forming external physical barriers between enzymes and cleavage sites, affecting enzyme activity.28,54 Kim et al.55 studied the relationship between oat β-glucan and in vitro starch digestion. These authors found that the eGI value was negatively correlated with the β-glucan content, since an increase in the β-glucan content produced an increase in viscosity, which led to lower starch digestibility. In addition, the β-GC inhibited the α-amylase enzyme via a non-competitive mechanism (Fig. 1C). Thus, the lower eGI value obtained for ERB with respect to ER could be related to a reduction of α-amylase activity during starch digestion. In this sense, the digested sample obtained from ERB after SGID facilitated lower α-amylase activity than that found for ER (Fig. 2C), which was correlated with the lower dialyzability of maltose and glucose in ERB-D (Fig. 2D). On the other hand, it was reported that phenolic compounds could reduce in vitro digestion of starch by inhibition of digestive enzymes.16,53 In this regard, the phenolic content in ERB-DG was twice that found for ER-DG. As shown in Fig. 2E, the ERB-DG exhibited higher ferulic and p-sinapic acid contents than ER-DG. Thus, the reduction of α-amylase activity in ERB may also be due to the inhibitory effect of phenolic compounds released from β-GC after the SGID. In line with these results, the α-amylase IC50 value of ERB-DG was lower than that obtained for β-GC, indicating that SGID released inhibitory compounds from the food matrix (Fig. 3A). In addition, the α-amylase IC50 value of ERB-DG was lower than that found for ER-DG. Thus, the addition of β-GC to the extruded rice product enhanced the α-amylase inhibitory properties after SGID. In this respect, the α-glucosidase IC50 value of ERB-DG was lower than that obtained for β-GC (Fig. 3A). Moreover, there were no differences between the α-glucosidase IC50 values of β-GC, ER-DG, and ER-D. However, the α-glucosidase IC50 value obtained for ERB-D was the lowest (p < 0.05). These results indicated that the addition of β-GC to the extruded product enhanced the inhibitory activity against this enzyme. Besides, the bioaccessible compounds released after the SGID process from ERB exhibited higher inhibitory activity than those present in the digested product. The same trend was observed for the DPP-IV enzyme. Thus, the bioaccessible phenolic compounds and peptides released from ERB by digestive enzymes exerted higher in vitro α-glucosidase and DPP-IV inhibitory effects than β-GC. Wu et al.56 reported that ferulic acid had potent α-glucosidase and DPP-IV inhibitory properties. In this regard, the phenolic acid dialyzability from ERB-D was higher than that found for ER-D (15.5 ± 0.1 vs. 11.2 ± 0.1%, respectively). Moreover, ERB-D exhibited higher total dialyzed ferulic and sinapic acid contents than ER-D (Fig. 3B). On the other hand, Aquino et al.12 reported that mannose-linked peptides from BSY mannoproteins had strong α-glucosidase inhibitory properties. In this regard, the proportion of mannose content with respect to peptide content in ERB-D was higher than that obtained for ER-D (429.1 ± 6.4 vs. 169.3 ± 3.4 mmol mannose per mol free amino groups, respectively), indicating that mannose-linked peptides from residual mannoproteins of β-GC were bioaccessible. As shown in Fig. 3C, the FPLC profile of ERB-D presented a higher content of low MW peptides than ER-D, which was evidenced in the proportion of 396 Da and 236 Da peak area values with respect to the total area. It has been reported that peptides that inhibit α-glucosidase and DPP-IV enzymes generally have low molecular weight.25,57 Thus, the high inhibitory activity of ERB-D against α-glucosidase and DPP-IV enzymes could also be due to the high content of low molecular weight peptides (396 Da and 236 Da).
 |
| | Fig. 2 Degree of starch hydrolysis of extruded rice products vs. time (A), percentage of dialyzability of reducing sugars from extruded products after simulated gastrointestinal digestion (B), α-amylase activity of gastrointestinal digests obtained from extruded products (C), percentage of dialyzability of maltose and glucose from simulated gastrointestinal digestion of extruded products (D), and ferulic and p-sinapic acid total contents of gastrointestinal digests obtained from extruded products (E). ER: extruded rice; ERB: extruded rice combined with β-glucan concentrate. Different letters associated with the bars indicate significant differences between samples (p < 0.05). | |
 |
| | Fig. 3 Concentration of β-glucan concentrate and gastrointestinal products obtained from extruded rice required to inhibit 50% of α-amylase, α-glucosidase and dipeptidyl peptidase IV (DPP-IV) enzymes (A), total contents of dialyzed ferulic and p-sinapic acid obtained from simulated gastrointestinal digestion of extruded products (B), FPLC gel filtration profile at 1.7 g protein per mL of dialysates obtained from gastrointestinal digestion of extruded products and proportion of molecular weight species with respect to the total area obtained from the FPLC gel filtration profile (C). ER: extruded rice; ERB: extruded rice combined with β-glucan concentrate. Different letters associated with the bars indicate significant differences between samples (p < 0.05). ND: not determined. | |
3.4. Hypoglycemic effect of bioaccessible compounds on 2D mouse jejunal organoids
The organoid system is made up of a very complex variety of cell types, including those that produce mucus. Therefore, its use for evaluating nutrient absorption and effect is more appropriate than using traditional cell lines such as Caco-2.30 Thus, 2D mouse jejunum organoids were used to study how the phenolic compounds and peptides derived from the in vitro gastrointestinal digestion of ER and ERB affected the expression of enzymes that hydrolyze carbohydrates (sucrase-isomaltase and lactase), and the glucose transporter GLUT2 (encoded by Slc2a2). As shown in Fig. 4A and B, both ER-D and ERB-D reduced the gene expression of lactase and sucrase-isomaltase (α-glucosidase) enzymes, which are encoded by the Lct and Sis genes, respectively. However, ERB-D had a higher suppressive effect than that observed for ER-D, indicating a strong hypoglycemic effect for this dialysate. As is known, these enzymes are found along the brush border of the enterocyte and are responsible for breaking down sugars into monosaccharides, facilitating their absorption.58,59 The negative regulation exerted by ERB-D on the Lct and Sis genes was consistent with the in vitro results obtained for the α-glucosidase inhibition assay. Moreover, ERB-D inhibited the gene expression of Slc2a2 (Fig. 4C). This gene codes for glucose transporter 2 (GLUT2), responsible for glucose transport in the apical membrane of the intestinal epithelium.60 Thus, ERB-D also downregulated the glucose uptake in mouse jejunum organoids.
 |
| | Fig. 4 Expression of enterocyte genes in mouse jejunum organoids treated with dialyzates obtained from gastrointestinal digestion of extruded products measured by qRT-PCR: Lct (A), Sis (B), and Slc2a2 (C) gene expression. Data are representative of two different experiments (n = 4). ER: extruded rice; ERB: extruded rice combined with β-glucan concentrate. Different letters associated with the bars indicate significant differences between samples (p < 0.05). | |
4. Conclusions
Our data indicate that BSY β-glucans exhibit dipeptidyl peptidase IV, α-amylase, and α-glucosidase inhibitory activity. Moreover, the inhibition mechanism of BSY β-glucans controlling the dipeptidyl peptidase IV and α-amylase enzymes was non-competitive, while for the α-glucosidase enzyme it was competitive. In all cases, the presence of peptides and phenolic acids in BSY β-glucan concentrate enhanced the inhibitory activity of β-glucans, without affecting the inhibition mechanism for these enzymes. On the other hand, the addition of BSY β-glucan concentrate to extruded rice products reduced in vitro starch hydrolysis and the potential glycemic index, probably due to the α-amylase inhibitory properties of β-glucans and ferulic acid. Moreover, this hypoglycemic effect was enhanced by α-glucosidase and DPP-IV inhibitory properties of bioaccessible phenolic acids and mannose-linked peptides, which were released during the SGID. This additional effect was confirmed in a mouse jejunal organoid model, where the dialysate of extruded product containing β-glucans down-regulated the expression of genes related to carbohydrate catabolism and glucose uptake. This is the first report demonstrating the mechanism of inhibition exerted by yeast β-glucans on the DPP-IV enzyme. This mechanism differs from both the well-known effects of hydrocolloids and the previously described actions of β-glucans, which are associated with increased viscosity and the physical hindrance of digestive enzymes. It is important to note that β-glucan is a soluble dietary fiber and that β-glucan-enriched food could not induce hypoglycemia under normal physiological conditions. However, in vivo studies are needed to confirm these effects at metabolic levels.
Author contributions
Marilin E. Aquino and Raúl E. Cian: formal analysis; investigation; methodology. Silvina R. Drago, Fermín Sanchez de Medina, Olga Martínez-Augustín, and Raúl E. Cian: data curation; investigation; methodology; validation; writing – review & editing. Franco Van de Velde: phenolic compounds, carbohydrate analysis, writing – review & editing. Raúl E. Cian, Fermín Sánchez de Medina, and Olga Martínez-Augustin: resources and funding acquisition. All authors read and approved the final manuscript.
Conflicts of interest
The authors declare that there is no conflict of interest.
Abbreviations
| AUC | Area under the curve |
| BSY | Brewer's spent yeast |
| DPP-IV | Dipeptidyl peptidase IV |
| DRC | Dialyzability of reducing carbohydrates |
| eGI | Estimated glycemic index |
|
ER
| Extruded rice product |
|
ERB
| Extruded rice product combined with BSY β-glucans |
|
ERB-D
| Dialysate obtained from ERB after SGID |
|
ERB-DG
| Residue obtained from ERB after SGID |
|
ER-D
| Dialysate obtained from ER after SGID |
|
ER-DG
| Residue obtained from ER after SGID |
| HI | Hydrolysis index |
|
β-GEC
| β-Glucan-enriched concentrate obtained after dialysis processes |
| SGID | Simulated gastrointestinal digestion |
| TDF | Total dietary fiber |
|
β-GC
| β-Glucan concentrate |
Data availability
Data for this article, including an Excel file, are available from the CONICET repository at https://hdl.handle.net/11336/277211.
Acknowledgements
This work was supported by ANPCyT – Argentina (Project PICT-2020-Serie A-1985) and Agencia Santafesina de Ciencia Tecnología e Innovación – Argentina (Res. 132/23-Project PEICID-2022-133); by grants PID2020-112768RB-I00 and PID2023-151294OB-I00 funded by MICIU/AEI/10.13039/501100011033; by the Instituto de Salud Carlos III (ISCIII), PI21/00952, co-funded by the European Union; by grants A-AGR-468-UGR20 and P20-00695 funded by the Consejería de Universidad, Investigación e Innovación of Junta de Andalucía and by “ERDF A way of making Europe”. The Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd) is funded by the Instituto de Salud Carlos III, Spain.
References
- A. D. C. Brito, J. S. Jisaka, A. C. R. Pereira and C. J. Steel, Thermoplastic extrusion technology as a tool for adding value to brewer's by-products, LWT, 2023, 189, 115487, DOI:10.1016/j.lwt.2023.115487
.
- G. V. Marson, M. T. da C. Machado, R. J. S. de Castro and M. D. Hubinger, Sequential hydrolysis of spent brewer's yeast improved its physico-chemical characteristics and antioxidant properties: A strategy to transform waste into added-value biomolecules, Process Biochem., 2019, 84, 91–102, DOI:10.1016/j.procbio.2019.06.018
.
- M. Amorim, J. O. Pereira, D. Gomes, C. D. Pereira, H. Pinheiro and M. Pintado, Nutritional ingredients from spent brewer's yeast obtained by hydrolysis and selective membrane filtration integrated in a pilot process, J. Food Eng., 2016, 185, 42–47, DOI:10.1016/j.jfoodeng.2016.03.032
.
- V. Mishra, V. Tripathi, P. Yadav and M. P. Singh, Beta glucan as an immune stimulant in tumor microenvironment—Insight into lessons and promises from past decade, Int. J. Biol. Macromol., 2023, 234, 123617, DOI:10.1016/j.ijbiomac.2023.123617
.
- C. Barton, K. Vigor, R. Scott, P. Jones, H. Lentfer, H. J. Bax, D. H. Josephs, S. N. Karagiannis and J. F. Spicer, Beta-glucan contamination of pharmaceutical products: How much should we accept?, Cancer Immunol. Immunother., 2016, 65, 1289–1301, DOI:10.1007/s00262-016-1875-9
.
- I. Avramia and S. Amariei, Spent Brewer’s yeast as a source of insoluble β-glucans, Int. J. Mol. Sci., 2021, 22, 1–26, DOI:10.3390/ijms22020825
.
- A. Jaeger, E. Arendt, E. Zannini and A. Sahin, Brewer's spent yeast (BSY), an underutilized brewing by-product, Fermentation, 2020, 6, 123, DOI:10.3390/fermentation6040123
.
- H. J. Lee, B. R. Park and L. S. Chewaka, A comparative study of composition and soluble polysaccharide content between brewer's spent yeast and cultured yeast cells, Foods, 2024, 13, 1567, DOI:10.3390/foods13101567
.
- H. Zhang, Z. Li, F. Xie, G. Wang, Z. Song and L. Ai, Inhibitory mechanism of arabinoxylan and β-glucan from hull-less barley on α-amylase activity: A comparison study, Food Hydrocolloids, 2024, 153, 109994, DOI:10.1016/j.foodhyd.2024.109994
.
- M. A. Brennan, E. Derbyshire, B. K. Tiwari and C. S. Brennan, Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks, Plant Foods Hum. Nutr., 2013, 68, 78–82, DOI:10.1007/s11130-012-0330-0
.
- H. Zhang, S. Sun and L. Ai, Physical barrier effects of dietary fibers on lowering starch digestibility, Curr. Opin. Food Sci., 2022, 48, 100940, DOI:10.1016/j.cofs.2022.100940
.
- M. E. Aquino, S. R. Drago, F. Sánchez de Medina, O. Martínez-Augustin and R. E. Cian, Anti-diabetic properties of brewer's spent yeast peptides. In vitro, in silico and ex vivo study after simulated gastrointestinal digestion, Food Funct., 2024, 15, 3778–3790, 10.1039/D3FO04040B
.
- A. Singla, O. P. Gupta, V. Sagwal, A. Kumar, N. Patwa, N. Mohan, N. Ankush, D. Kumar, O. Vir, J. Singh, L. Kumar, C. Lal and G. Singh, Beta-glucan as a soluble dietary fiber source: Origins, biosynthesis, extraction, purification, structural characteristics, bioavailability, biofunctional attributes, industrial utilization, and global trade, Nutrients, 2024, 16(6), 900, DOI:10.3390/nu16060900
.
- C. Zielke, Y. Lu and L. Nilsson, Aggregation and microstructure of cereal β-glucan and its association with other biomolecules, Colloids Surf., A, 2019, 560, 402–409, DOI:10.1016/j.colsurfa.2018.10.042
.
- S. F. Reis, P. A. R. Fernandes, V. J. Martins, S. Gonçalves, L. P. Ferreira, V. M. Gaspar, D. Figueira, D. Castelo-Branco, J. F. Mano, M. A. Coimbra and E. Coelho, Brewer's spent yeast cell wall polysaccharides as vegan and clean label additives for mayonnaise formulation, Molecules, 2023, 28, 3540, DOI:10.3390/molecules28083540
.
- Y. Zheng, J. Tian, W. Yang, S. Chen, D. Liu, H. Fang, H. Zhang and X. Ye, Inhibition mechanism of ferulic acid against α-amylase and α-glucosidase, Food Chem., 2020, 317, 126346, DOI:10.1016/j.foodchem.2020.126346
.
- J. Li and S. Karboune, A comparative study for the isolation and characterization of mannoproteins from Saccharomyces cerevisiae yeast cell wall, Int. J. Biol. Macromol., 2018, 119, 654–661, DOI:10.1016/j.ijbiomac.2018.07.102
.
- M. E. Aquino, S. R. Drago, L. P. Schierloh and R. E. Cian, Identification of bioaccessible glycosylated neuroprotective peptides from brewer's spent yeast mannoproteins by in vitro and in silico studies, Food Res. Int., 2025, 116188, DOI:10.1016/j.foodres.2025.116188
.
-
Official Methods of Analysis, ed. W. Horwitz, Association of Official Analytical Chemists – AOAC, Washington, DC, 18th edn, 2005 Search PubMed
.
- P. Nielsen, D. Petersen and C. Dambmann, Improved method for determining food protein degree of hydrolysis, J. Food Sci., 2001, 66, 642–646, DOI:10.1111/j.1365-2621.2001.tb04614.x
.
- R. E. Cian, O. Martínez-Augustin and S. R. Drago, Bioactive properties of peptides obtained by enzymatic hydrolysis from protein byproducts of Porphyra columbina, Food Res. Int., 2012, 49, 364–372, DOI:10.1016/j.foodres.2012.07.003
.
- A. G. Garzón, R. L. Torres and S. R. Drago, Changes in phenolics, gamma aminobutiric acid and antioxidant, antihypertensive and hypoglycaemic properties during ale White sorghum (Sorghum bicolor, (L.). Moench) brewing process, Int. J. Food Sci. Technol., 2019, 54, 1901–1908 CrossRef
.
- R. E. Cian, P. Salgado, A. Mauri and S. R. Drago,
Pyropia columbina phycocolloids as microencapsulating material improve bioaccessibility of brewers’ spent grain peptides with ACE-I inhibitory activity, Int. J. Food Sci. Technol., 2020, 55, 1311–1317, DOI:10.1111/ijfs.14397
.
- O. N. Donkor, L. Stojanovska, P. Ginn, J. Ashton and T. Vasiljevic, Germinated grains–Sources of bioactive compounds, Food Chem., 2012, 135, 950–959, DOI:10.1016/j.foodchem.2012.05.058
.
- T. Y. Wang, C. H. Hsieh, C. C. Hung, C. L. Jao, P. Y. Lin, Y. L. Hsieh and K. C. Hsu, A study to evaluate the potential of an in silico approach for predicting dipeptidyl peptidase-IV inhibitory activity in vitro of protein hydrolysates, Food Chem., 2017, 234, 431–438, DOI:10.1016/j.foodchem.2017.05.035
.
- M. Somogyi, Notes on sugar determination, J. Biol. Chem., 1952, 195, 19–23, DOI:10.1016/S0021-9258(19)50870-5
.
- I. Goñi, A. Garcia-Alonso and F. Saura-Calixto, A starch hydrolysis procedure to estimate glycemic index, Nutr. Res., 1997, 17, 427–437, DOI:10.1016/S0271-5317(97)00010-9
.
- N. K. Sulung, N. Aqilah, S. M. Aziss, N. F. Kutbi, A. A. Ahadaali, N. A. Zairi, I. I. Mahmod, A. A. B. Sajak, S. Sultana and A. Azlan, Validation of in vitro glycaemic index (eGI) and glycaemic load (eGL) based on selected baked products, beverages, and canned foods, Food Chem. Adv., 2023, 3, 100502, DOI:10.1016/j.focha.2023.100502
.
- M. Albarracín and S. R. Drago, Comparison of isolation methods and physicochemical characteristics of starches isolated from red and white sorghum hybrids, Starch/Stärke, 2020, 72, 2000023, DOI:10.1002/star.202000023
.
- M. E. Aquino, F. Sánchez de Medina, S. R. Drago, O. Martínez-Augustin and R. E. Cian, Gastrointestinal digestion and colonic fermentation of brewer's spent yeast peptides modulate their antioxidant properties and effect on intestinal barrier, Food Biosci., 2024, 60, 104294, DOI:10.1016/j.fbio.2024.104294
.
- F. Van de Velde, M. P. Méndez-Galarraga, M. Albarracín, A. G. Garzón, M. Aquino, R. E. Cian, G. Vinderola and S. R. Drago, Exploring the effects of barley (Hordeum vulgare L.) germination on chemical composition, phytic acid, and potential malt prebiotic properties, J. Food Compos. Anal., 2025, 138, 107016, DOI:10.1016/j.jfca.2024.107016
.
- G. D. Heinen, A. G. Garzón, R. E. Cian and S. R. Drago, Gastrointestinal and colonic bioaccessibility of calcium and ferulic acid from microcapsules made with brewer spent grain arabinoxylans, Int. J. Biol. Macromol., 2025, 292, 139237, DOI:10.1016/j.ijbiomac.2024.139237
.
- A. M. Saeed, E. H. El-Shatoury and H. A. E. Sayed, Statistical factorial designs for optimum production of thermostable α-amylase by the degradative bacterium Parageobacillus thermoglucosidasius Pharon1 isolated from Sinai, J. Genet. Eng. Biotechnol., 2021, 19, 24, DOI:10.1186/s43141-021-00123-4
.
- R. E. Cian, M. Tena-Garitaonaindia, F. Sánchez de Medina and O. Martínez-Augustin, Casein Glycomacropeptide Regulates Gene Expression in Intestinal Epithelial Cells: Effect of Simulated Gastrointestinal Digestion and Peptide Microencapsulation, J. Agric. Food Chem., 2025, 73(7), 4105–4115, DOI:10.1021/acs.jafc.4c10146
.
- Z. Pérez-Bassart, D. A. Méndez, A. Martínez-Abad, A. López-Rubio and M. J. Fabra, Emulsifying properties of β-glucan-rich extracts obtained from Pleurotus ostreatus whole mushroom and stipes, Food Hydrocolloids, 2024, 153, 109961, DOI:10.1016/j.foodhyd.2024.109961
.
- M. Schottroff, K. M. Jaeger, A. Malvis Romero, M. Schneeberger and A. Liese, From Waste to Value: Extraction of Protease Enzymes from Brewer's Spent Yeast, Foods, 2025, 14, 503, DOI:10.3390/foods14030503
.
- Z. Pérez-Bassart, C. Bäuerl, M. J. Fabra, A. Martínez-Abad, M. C. Collado and A. López-Rubio, Composition, structural properties and immunomodulatory activity of several aqueous Pleurotus β-glucan-rich extracts, Int. J. Biol. Macromol., 2023, 253, 127255, DOI:10.1016/j.ijbiomac.2023.127255
.
- P. A. Horn, A. L. B. Zeni, N. Cavichioli, E. Winter, K. Z. S. Batista, L. Vitali and E. A. de Almeida, Chemical profile of craft brewer's spent yeast and its antioxidant and antiproliferative activities, Eur. Food Res. Technol., 2023, 249, 2001–2015, DOI:10.1007/s00217-023-04268-z
.
- R. Bikmurzin, R. Bandzevičiūtė, A. Maršalka, A. Maneikis and L. Kalėdienė, FT-IR method limitations for β-glucan analysis, Molecules, 2022, 27(14), 4616, DOI:10.3390/molecules27144616
.
- X. Xiao, J. Qiao, J. Wang, J. Kang, L. He, J. Li, Q. Guo and S. W. Cui, Grafted ferulic acid dose-dependently enhanced the apparent viscosity and antioxidant activities of arabinoxylan, Food Hydrocolloids, 2022, 128, 107557, DOI:10.1016/j.foodhyd.2022.107557
.
- H. Z. Liu, L. Liu, H. Hui and Q. Wang, Structural characterization and antineoplastic activity of Saccharomyces cerevisiae mannoprotein, Int. J. Food Prop., 2015, 18(2), 359–371, DOI:10.1080/10942912.2013.819364
.
- Y. Ma, J. Sun and B. L. Xiao, A study of the mechanism of α-glucosidase inhibition by rapeseed polyphenols, LWT, 2025, 223, 117716, DOI:10.1016/j.lwt.2025.117716
.
- A. M. Marcobal, B. R. McConnell, R. A. Drexler, K. M. Ng, M. X. Maldonado-Gomez, A. M. Conner, C. G. Vierra, N. Krishnakumar, H. M. Gerber, J. K. A. Garcia, J. P. Cerney and M. J. Amicucci, Highly soluble β-glucan fiber modulates mechanisms of blood glucose regulation and intestinal permeability, Nutrients, 2024, 16(14), 2240, DOI:10.3390/nu16142240
.
- C. Ye, R. Zhang, L. Dong, J. Chi, F. Huang, L. Dong, M. Zhang and X. Jia, α-Glucosidase inhibitors from brown rice bound phenolics extracts (BRBPE): Identification and mechanism, Food Chem., 2022, 372, 131306, DOI:10.1016/j.foodchem.2021.131306
.
- S. Adisakwattana, Cinnamic acid and its derivatives: mechanisms for prevention and management of diabetes and its complications, Nutrients, 2017, 9(2), 163, DOI:10.3390/nu9020163
.
- J. Li and S. Karboune, Characterization of the composition and the techno-functional properties of mannoproteins from Saccharomyces cerevisiae yeast cell, Food Chem., 2019, 297, 124867, DOI:10.1016/j.foodchem.2019.05.141
.
- G. V. Marson, R. J. S. de Castro, M. P. Belleville and M. D. Hubinger, Spent brewer's yeast as a source of high added value molecules: a systematic review on its characteristics, processing and potential applications, World J. Microbiol. Biotechnol., 2020, 36, 95, DOI:10.1007/s11274-020-02866-7
.
- R. E. Cian, M. S. Caballero, N. Sabbag, R. J. González and S. R. Drago, Bio-accessibility of bioactive compounds (ACE inhibitors and antioxidants) from extruded maize products added with a red seaweed Porphyra columbina, LWT, 2014, 55, 51–58, DOI:10.1016/j.lwt.2013.08.011
.
- J. Delić, P. Ikonić, M. Jokanović, T. Peulić, B. Ikonić, V. Banjac, S. Vidosavljević, V. Stojkov and M. Hadnađev, Sustainable snack products: Impact of protein- and fiber-rich ingredients addition on nutritive, textural, physical, pasting and color properties of extrudates, Innovative Food Sci. Emerging Technol., 2023, 87, 103419, DOI:10.1016/j.ifset.2023.103419
.
- S. A. Alam, S. Pentikäinen, J. Närväinen, K. Katina, K. Poutanen and N. Sozer, The effect of structure and texture on the breakdown pattern during mastication and impacts on in vitro starch digestibility of high fibre rye extrudates, Food Funct., 2019, 10, 1958–1973, 10.1039/C8FO02188K
.
- A. Lante, E. Canazza and P. Tessari, Beta-glucans of cereals: Functional and technological properties, Nutrients, 2023, 15, 2124, DOI:10.3390/nu15092124
.
- R. Liu, Z. Geng, T. Li, M. Zhang, C. Zhang, T. Ma, Z. Xu, S. Xu, H. Liu, X. Zhang and L. Wang, Effects of different extrusion temperatures on the physicochemical properties, edible quality and digestive attributes of multigrain reconstituted rice, Food Funct., 2024, 15, 6000–6014, 10.1039/D4FO00044G
.
- P. G. Boakye, A. Y. Okyere, R. Bharathi, T. Murai and G. A. Annor, Physicochemical and nutritional properties of extruded products from cereals of the Triticeae tribe–A review, Food Chem. Adv., 2023, 3, 100379, DOI:10.1016/j.focha.2023.100379
.
- B. Ma, T. Feng, S. Zhang, H. Zhuang, D. Chen, L. Yao and J. Zhang, The inhibitory effects of Hericium erinaceus β-glucan on in vitro starch digestion, Front. Nutr., 2021, 7, 621131, DOI:10.3389/fnut.2020.621131
.
- J. Kim, S. M. Lee, I. Y. Bae, H. G. Park, H. G. Lee and S. Lee, (1–3)(1–6)–β–Glucan–enriched materials from Lentinus edodes mushroom as a high–fibre and low–calorie flour substitute for baked foods, J. Sci. Food Agric., 2011, 91, 1915–1919, DOI:10.1002/jsfa.4409
.
- M. Wu, Q. Yang, Y. Wu and J. Ouyang, Inhibitory effects of acorn (Quercus variabilis Blume) kernel-derived polyphenols on the activities of α-amylase, α-glucosidase, and dipeptidyl peptidase IV, Food Biosci., 2021, 43, 101224, DOI:10.1016/j.fbio.2021.101224
.
- Y. Zhang, F. Wu, Z. He, X. Fang and X. Liu, Optimization and molecular mechanism of novel α-glucosidase inhibitory peptides derived from camellia seed cake through enzymatic hydrolysis, Foods, 2023, 12, 393, DOI:10.3390/foods12020393
.
- L. Viswanathan and S. S. Rao, Intestinal disaccharidase deficiency in adults: evaluation and treatment, Curr. Gastroenterol. Rep., 2023, 25, 134–139, DOI:10.1007/s11894-023-00870-z
.
- B. Gericke, N. Schecker, M. Amiri and H. Y. Naim, Structure-function analysis of human sucrase-isomaltase identifies key residues required for catalytic activity, J. Biol. Chem., 2017, 292, 11070–11078, DOI:10.1074/jbc.M117.791939
.
- P. Solverson, Anthocyanin bioactivity in obesity and diabetes: The essential role of glucose transporters in the gut and periphery, Cells, 2020, 9, 2515, DOI:10.3390/cells9112515
.
|
| This journal is © The Royal Society of Chemistry 2026 |
Click here to see how this site uses Cookies. View our privacy policy here.