Dietary kaempferol attenuates aging-related cognitive decline through gut microbiota modulation and intestinal barrier strengthening with suppression of neuroinflammation in mice

Abstract

Kaempferol, a natural dietary flavonoid, has shown neuroprotective potential. However, its mechanisms of protection against age-related cognitive decline, especially those mediated via the gut–brain axis, are not fully understood. This study investigated the role of kaempferol in alleviating D-galactose-induced brain aging and elucidated its functional mechanisms related to gut microbiota composition, microbial metabolite production, and intestinal barrier integrity. An aging mouse model was induced by D-galactose and subsequently treated with kaempferol. Results revealed that kaempferol significantly ameliorated anxiety-like behaviors and spatial working memory deficits in D-galactose-treated mice. In the hippocampus, it reduced neuronal loss, upregulated synaptic plasticity-related genes (Bdnf and Snap25), and suppressed neuroinflammation through inhibition of microglial activation and the TLR4/Myd88 signaling pathway. Importantly, kaempferol restored intestinal barrier integrity, as indicated by increased expression of colonic MUC2 and tight junction proteins (Zo-1 and Occludin). It also markedly reshaped gut microbiota composition by enriching beneficial genera such as Faecalibaculum and Akkermansia, which correlated with elevated fecal propionate and butyrate levels, and a reduction in serum LPS. Our findings demonstrate that kaempferol mitigates D-galactose-induced cognitive impairment by modulating gut microbiota, increasing beneficial SCFA production, enhancing gut barrier function, and subsequently inhibiting systemic and neuroinflammation. This study provides mechanistic support for kaempferol as a dietary intervention strategy to promote brain health via the gut–brain axis.

---

Introduction

Global population aging has intensified, rendering cognitive decline and anxiety disorders associated with senescence critical public health challenges.^1,2 Aging induces characteristic neuropathological changes in critical brain regions, such as the hippocampus and prefrontal cortex, which are essential for learning, memory, and emotional regulation.³ These alterations encompass neuronal loss, neuroinflammation (e.g., microglial hyperactivation, elevated pro-inflammatory cytokines), impaired synaptic plasticity, and exacerbated oxidative stress.^4–6 Collectively, these pathologies drive core neurodegenerative features of aging, culminating in neuropsychiatric symptoms such as memory deficits, diminished learning capacity, and anxiety-like behaviors that severely compromise health and quality of life.^3,7 Consequently, mitigating brain aging and preventing related disorders are imperative for elderly populations.

Aging affects not only the central nervous system (CNS) but also disrupts the gut ecosystem, which is increasingly acknowledged for its role in neurodegeneration and mood regulation.⁸ Aging leads to notable gut microbiota dysbiosis, marked by a decline in beneficial microflora, reduced microbial diversity, and lower production of essential metabolites, especially short-chain fatty acids (SCFAs).⁹ Critically, aging often compromises intestinal barrier integrity, inducing a “leaky gut” state.¹⁰ This pathology facilitates translocation of pathogen-associated molecular patterns (e.g., lipopolysaccharide, LPS) into systemic circulation, triggering chronic low-grade inflammation.¹¹ Peripheral inflammation spreads to the CNS via the microbiota-gut–brain axis, intensifying neuroinflammation, oxidative stress, and hypothalamus–pituitary–adrenal (HPA) axis dysregulation.¹² Thus, restoring gut microbiota homeostasis, SCFAs levels, and intestinal barrier function represents a promising therapeutic strategy against aging-related neuropsychiatric disorders.

Kaempferol is a naturally occurring dietary flavonoid found in a variety of fruits, vegetables, and medicinal herbs, and it demonstrates a wide range of biological activities.¹³ Previous research targeting aging and age-related neurodegenerative diseases has identified kaempferol through a machine learning-guided cross-species screening platform of naturally occurring compounds. This research demonstrated that oral administration of kaempferol at a dosage of 100 mg kg⁻¹ successfully traverses the blood–brain barrier and significantly enhances cognitive function in APP/PS1 mice.¹⁴ Higher dietary intake of kaempferol is clinically associated with a slower decline in global cognition and various cognitive domains.¹⁵ Preclinically, kaempferol ameliorates cognitive impairment induced by lead exposure or sleep deprivation.^16,17 Kaempferol exhibited bidirectional modulation of gut ecology by alleviating experimental colitis through restoration of gut microbiota, suppression of the LPS-TLR4-NF-κB pathway, and enhancement of intestinal barrier integrity, thereby reducing permeability and systemic translocation of pro-inflammatory mediators.^18,19 Furthermore, kaempferol enhances biological performance, particularly in aging-related processes, via hormesis.²⁰ By mitigating peripheral and central inflammation and oxidative damage, kaempferol emerges as a novel, pleiotropic candidate for counteracting age-associated cognitive and affective decline.²¹ Nevertheless, its precise mechanisms of action through the microbiome-gut–brain axis in aging models remain incompletely defined.

This study utilized a D-galactose-induced accelerated aging mouse model to evaluate the potential of kaempferol in ameliorating cognitive deficits and neuropathology—including synaptic plasticity impairment, neuronal damage, and neuroinflammation. The study also explored the impact of compounds on gut microbiota composition and SCFAs production. These findings establish a mechanistic foundation for the therapeutic efficacy of kaempferol against age-related cognitive decline via the gut–brain axis.

Materials and methods

Animal and experimental design

Twenty-one male C57BL/6J mice, aged 8 weeks, were obtained from Beijing Huafukang Biotechnology Co., Ltd. They were housed under standard conditions: temperature at 22–24 °C, relative humidity at 50 ± 10%, and a 12-hour light–dark cycle (lights on from 7:00 to 19:00). Mice were provided unrestricted access to food and water. Mice were categorized into three groups: (1) control (CON), (2) D-galactose (D-gal), and (3) D-galactose combined with kaempferol (D-gal + Kaem).

After a one-week acclimatization period. The CON group received daily intraperitoneal (i.p.) administration of physiological saline (0.9% NaCl). The D-gal group was administered daily i.p. injections of D-galactose (500 mg kg⁻¹). The D-gal + Kaem group (D-gal + Kaem) received daily i.p. injections of D-galactose (500 mg kg⁻¹). Additionally, due to the poor water solubility of kaempferol, it was suspended in a 0.5% sodium carboxymethyl cellulose (CMC-Na) aqueous solution for oral gavage administration (D-gal + Kaem group). The CON and D-gal groups were given equal volumes of 0.5% CMC-Na. The injection volume for all i.p. administrations was 0.1 mL per mouse, while the gavage volume for all oral treatments was 0.2 mL per mouse. After the 10-week treatment period, behavioral tests were conducted on all mice across the groups. At 8:00 a.m. on the final day of the experiment, all mice were anesthetized with 10% chloral hydrate. The fecal samples from each mouse were collected and stored at −80 °C for microbial sequencing. The colon and hippocampus were promptly collected. A portion of the tissue was fixed in 4% paraformaldehyde for sectioning and morphological analysis, while another portion was frozen at −80 °C for molecular analysis. The Institutional Animal Care and Use Committee of Beijing Shenrui Biotechnology Co., Ltd approved all experiments in accordance with their Guide to the Care and Use of Laboratory Animals (Approval No. SR202403012).

Open-field test (OFT)

The open field featured a 50 × 50 cm base segmented into 25 equal 5 × 5 cm sectors by white lines. The squares were divided into central and peripheral sectors, with the central sector comprising the 9 central squares (3 × 3) and the peripheral sector consisting of squares adjacent to the surrounding wall. The animals were positioned in the central sector, and their activity was recorded on video for 8 minutes for subsequent analysis. The behavioral parameters assessed included total distance (mm), mean velocity (mm s⁻¹), immobility time (s), central zone residence time (s), and movement time in the central zone (s). The OFT was meticulously sanitized with alcohol between tests. Behavioral tracking and data acquisition utilized the SuperMaze video analysis system from Shanghai Softmaze Information Technology Co., Ltd, China.

Y-maze test

The Y-maze test is a behavioral experiment used to assess spatial memory and cognitive function in subjects. It involves a Y-shaped apparatus with three arms, where subjects are placed to explore. The test measures spontaneous alternation behavior, which is the tendency of subjects to enter a less recently visited arm, indicating memory retention and cognitive flexibility. Spatial working performance was evaluated using a standardized Y-maze apparatus. The maze featured three identical arms radially extending at 120° angles from a central starting point. Individual mice were positioned at the central junction and permitted unrestricted exploration for an 8-minute session. Behavioral tracking and data acquisition utilized the SuperMaze video analysis system (Shanghai Xinruan Information Technology Co., Ltd, China). An alternation event was operationally defined as consecutive entries into all three distinct arms in any sequential order. The spontaneous alternation percentage was computed using the formula: Alternation (%) = [number of alternations/(total arm entries − 2)] × 100.

Hematoxylin and eosin (H&E) staining

Colon samples were promptly fixed in 4% paraformaldehyde, paraffin-embedded, and sectioned into 5-μm slices. The sections underwent histological examination using H&E staining. Sections were examined microscopically after mounting.

Alcian blue and periodic acid-Schiff (AB-PAS)

The AB-PAS staining procedure was conducted to identify and differentiate acidic and neutral mucins. Samples were first treated with alcian blue to stain acidic mucins, followed by a periodic acid-Schiff reaction to highlight neutral mucins. Colon tissue slices were stained using AB-PAS reagents (G1285, Solarbio, Beijing, China) following the manufacturer's instructions. Goblet cell counts were determined by averaging the number of goblet cells in 30 randomly selected intact crypts for each group.

Immunohistochemical staining

Paraffin sections of the colon were dewaxed using xylene and subsequently dehydrated with a series of graded ethanol solutions. The sections were incubated overnight at 4 °C with rabbit anti-Zo-1 (1 : 200, 21773-1-AP, Proteintech), rabbit anti-Mucin-2 (MUC2) (1 : 2000, 27675-1-AP, Proteintech), and rabbit anti-Occludin (1 : 700, GB111401-100, Servicebio) primary antibodies. The sections were rinsed in 0.01M PBS (pH 7.4) and incubated with biotinylated goat anti-rabbit IgG (1 : 300, GB23303, Servicebio) for 2 hours at room temperature. The sections were stained with hematoxylin and subsequently mounted. In all cases, control slides lacking the primary antibody were evaluated. Immunoreactive cells presented with yellow-brown staining in the cytoplasm. For each sample, positive cells were randomly selected from five cross-sections, with a minimum of 30 fields counted per group. ImageJ software was utilized to measure the integrated optical density (IOD).

Immunofluorescence staining

Paraffin sections of the hippocampus were dewaxed using xylene and subsequently dehydrated with a series of graded ethanol solutions. Then, the sections were incubated with Iba1 rabbit monoclonal antibody (ab178846, 1 : 500, abcam, US), NeuN rabbit polyclonal antibody (26975-1-AP, 1 : 200; Proteintech, China). Allow to incubate at 4 °C overnight. Following incubation, slides were rinsed with PBS and treated with secondary antibodies (GB21303, 1 : 300, Servicebio, China) for 50 minutes. Sections are sealed using DAPI (4′,6-diamidino-2-phenylindole). Immunofluorescence staining images were captured using the Nikon C1 Inverted Microscope based on Nikon Eclipse Ti (Nikon Instruments, Melville, NY). Positive areas were also quantified by ImageJ.

Real-time reverse transcription-polymerase chain reaction (RT-PCR)

RNA was extracted from the colon or hippocampus using the FastPure® Cell/Tissue Total RNA Isolation Kit V2 (RC112; Vazyme). cDNA was synthesized using HiScript III All-in-one RT SuperMix Perfect for qPCR (R333; Vazyme). RT-PCR amplification was performed using the ChamQ Universal SYBR qPCR Master Mix (Q711; Vazyme). Each sample was tested twice. SI Table S1 contains the RT-PCR primers.

Enzyme-linked immunosorbent assay (ELISA)

ELISA was employed to quantify specific proteins. This method involves the use of antibodies to detect and measure antigens in a sample, providing a sensitive and specific means of analysis. Plasma samples were collected to measure LPS concentrations using a competitive ELISA (MK3418A; MEI KE; China). Tests were conducted following the manufacturer's guidelines. Each sample was tested twice. Both the intra-assay and inter-assay coefficients of variation (CV) were less than 15%.

Gut microbiota analysis

Fecal samples were collected and preserved at −80 °C for DNA high-throughput sequencing. DNA was extracted from mouse feces using the FastDNATM SPIN Kit (MP Bio, USA). The Thermo Scientific Nanodrop 2000 (Waltham, USA) was used to assess the concentration and purity of the extracts. DNA templates were amplified using PCR with specific primers 338F (ACTCCTACGGGAGGCAGCAG) and downstream 806R (GGACTACHVGGGTWTCTAAT). PCR products were detected via 2% agarose gel electrophoresis and subsequently purified and quantified using the Qubit 4.0 system (Thermo Fisher Scientific, Waltham, MA, USA). After paired-end sequencing on the Illumina MiSeq PE300 platform, raw reads were quality-filtered, merged, and demultiplexed using Fastp (version 0.20.0). Chimeric sequences were identified and removed using the USEARCH (version 11.0) algorithm. High-quality, non-chimeric sequences were clustered into operational taxonomic units (OTUs) at a 97% similarity threshold using UPARSE. Taxonomy was assigned against the SILVA database (version 138) using the RDP classifier. An average of 60 543 high-quality reads per sample were obtained. Data analysis was performed using the Majorbio online platform (cloud.majorbio.com).

SCFAs analysis

A 25 mg fecal sample was weighed into a 2 mL grinding tube and subjected to cryogenic grinding, followed by sonication and centrifugation. Then, 200 μL of n-butanol solvent containing an internal standard was added for extraction. The mixture was vortexed for 10 s, subjected to low-temperature sonication for 10 min, and centrifuged at 13 000g for 5 min at 4 °C. The resulting supernatant was transferred to an injection vial for instrumental analysis. Targeted metabolomic analysis of SCFAs was performed using an Agilent 8890B-5977B/7000D gas chromatography-mass spectrometry (GC-MS) system. The concentrations of SCFAs—including acetate, propionate, butyrate, isobutyrate, valerate, isovalerate, and caproate—were calculated based on standard curves and converted to their actual contents in the samples.

Statistical analysis

Data were presented as mean ± standard error and analyzed with GraphPad Prism 9 (GraphPad Software, La Jolla, CA, USA). Experiments were conducted with a minimum of five independent biological replicates and two independent technical replicates. Group differences were assessed using one-way ANOVA with LSD post-hoc analysis. The Kruskal–Wallis test was used to analyze microbial differences among groups at the genus level. P-Values below 0.05 were deemed statistically significant.

Results

Kaempferol alleviated anxiety-like behavior and spatial working memory deficits caused by D-galactose in mice

Eight-week-old C57BL/6J mice were administered intraperitoneal injections of D-galactose for a duration of 10 weeks, alongside kaempferol treatment supplementation administered concurrently via gavage (Fig. 1A–B). To investigate the alleviating effect of kaempferol on cognitive impairment in D-galactose-treated mice, the OFT and Y-maze tests were performed. In the 8-minute OFT session, compared to the control mice, D-galactose-treated mice exhibited a significant decrease in total distance (p = 0.001), mean velocity (p = 0.001), residence and movement time in the central zone (p < 0.001), along with a significant increase in immobility time (p < 0.001), indicating pronounced anxiety-like behavior (Fig. 1C–I). However, kaempferol intervention significantly increased total distance (p < 0.001), residence (p = 0.002), and movement (p < 0.001) time in the central zone, while significantly decreasing immobility time in D-galactose-treated mice (p < 0.001) (Fig. 1D–I). The Y-maze test, used to evaluate spatial working memory, revealed that D-galactose-treated mice showed a significantly reduced percentage of spontaneous alternation behavior compared to control mice (p = 0.03) (Fig. 1J). Kaempferol treatment led to a partial improvement in spontaneous alternation behavior in mice treated with D-galactose (p > 0.05) (Fig. 1J). These findings indicate that kaempferol intervention significantly reduced anxiety-like behavior and partially enhanced spatial working memory in mice treated with D-galactose.

Fig. 1 Effects of kaempferol on cognitive deficits in mice treated with D-galactose. (A) Chemical structures of kaempferol. (B) Schematic diagram of a phased protocol for animal experiments. (C) Schematic diagram of the OFT test. (D) Representative trajectory images for each group of the OFT test. (E) Total distance in the OFT test (n = 7). (F) Mean velocity in the OFT test (n = 7). (G) Immobility time in the OFT test (n = 7). (H) Residence time in the central zone in the OFT test (n = 7). (I) Movement time in the central zone in the OFT test (n = 7). (J) Spontaneous alternation (%) in the Y-maze test (n = 7). Data are presented as mean ± SEM and were analyzed using one-way ANOVA with LSD's test. *p < 0.05, **p < 0.01, ***p < 0.001.

Kaempferol alleviated neuronal loss and neuroinflammatory responses induced by D-galactose

Within the intricate network of the CNS, neurons and glial cells serve as fundamental units. The integrity of their cellular structure and the maintenance of their physiological homeostasis are critical for the efficient execution of diverse neurological functions. To investigate the effects of kaempferol on neuronal and microglial functions in D-galactose-treated mice, we utilized immunofluorescence staining to evaluate the neuronal marker NeuN and the microglial marker Iba1. Analysis of representative images and quantitative data indicated a significant reduction in NeuN-positive cells in the hippocampal CA1 (p = 0.02) and CA3 (p = 0.04) regions of D-galactose-treated mice compared to controls. However, kaempferol intervention induced a non-significant increase in NeuN-positive cells within these hippocampal regions (Fig. 2A–C). As synaptic proteins reflect the connectivity state between neurons, we further evaluated the mRNA expression levels of several key synaptic proteins using RT-PCR. The study found significant downregulation of mRNA expression levels for brain-derived neurotrophic factor (Bdnf), post-synaptic density protein 95 (Psd95), and synaptosomal-associated protein 25 (Snap25) in the hippocampus were significantly downregulated in D-galactose-treated mice relative to controls (p < 0.05) (Fig. 2D). Conversely, kaempferol intervention partially upregulated the mRNA expression levels of Bdnf (p = 0.098) and Snap-25 (p = 0.03) (Fig. 2D).

Fig. 2 Effects of kaempferol on neuronal degeneration and neuroinflammatory responses in mice treated with D-galactose. (A) Representative images of NeuN immunofluorescence staining in the hippocampal CA1 and CA3. (B) No. of NeuN + cell in the hippocampal CA1 region (n = 3). (C) No. of NeuN + cell in the hippocampal CA3 region (n = 3). (D) The mRNA levels of Bdnf, Psd-95 and Snap-25 in the hippocampus (n = 5). (E) Representative images of Iba1 immunofluorescence staining in the hippocampal CA1, CA3 and DG. (F) No. of Iba1 + cell in the hippocampal CA1 region (n = 3). (G) No. of Iba1 + cell in the hippocampal CA3 region (n = 3). (H) No. of Iba1 + cell in the hippocampal DG region (n = 3). (I) The mRNA levels of Tnf-α and Il-6 in the hippocampus (n = 5). (J) The mRNA levels of Tlr4 and Myd88 in the hippocampus (n = 5). Data are presented as mean ± SEM and were analyzed using one-way ANOVA with LSD's test. *p < 0.05, **p < 0.01.

Neuroinflammation is crucial in the development of cognitive impairment associated with aging. As the resident immune cells of the CNS, microglia serve as key effector cells in neuroinflammation. Immunofluorescence analysis revealed a significant increase in the number of Iba1-positive cells in the hippocampal CA1 (p = 0.003) and DG (p = 0.04) regions of D-galactose-treated mice compared to controls (Fig. 2E–H), while no significant change was observed in the CA3 region (Fig. 2G). Notably, kaempferol intervention significantly reduced the number of Iba1-positive cells in the CA1 region (p = 0.006) and induced a partial reduction in the DG region (p = 0.06) compared to D-galactose-treated mice (Fig. 2F and H). RT-PCR analysis indicated no significant differences in hippocampal Tnf-α and Il-6 mRNA levels across the treatment groups (Fig. 2I). Concurrently, we examined the expression levels of Tlr4 and Myd88 to investigate alterations in key molecules of inflammation-associated signaling pathways. Kaempferol intervention suppressed hippocampal Tlr4 (p = 0.03) and Myd88 expression in D-galactose-treated mice (Fig. 2J).

Kaempferol improved intestinal barrier injury induced by D-galactose

To assess the impact of kaempferol on colonic morphology in D-galactose-treated mice, we first performed HE staining. The results revealed that compared to control mice, D-galactose-treated mice exhibited inflammatory cell infiltration and mucosal damage, while kaempferol intervention partially ameliorated these histopathological alterations (Fig. 3A). Goblet cells regulate glycosylation and produce mucus, thereby preventing direct contact between bacteria and intestinal epithelial cells. Therefore, to evaluate goblet cells and MUC2 levels, we conducted AB-PAS staining (Fig. 3A) and IHC staining (Fig. 3C). Quantitative analysis demonstrated that D-galactose-treated mice exhibited a significant reduction in both goblet cell numbers (p = 0.002) and the IOD of MUC2 staining (p = 0.007) in the colon compared to controls (Fig. 3B and D). Conversely, kaempferol intervention significantly upregulated MUC2 expression (p = 0.03) and partially restored goblet cell numbers (p = 0.06) (Fig. 3B and D).

Fig. 3 Effects of kaempferol on intestinal structure and barrier integrity in mice treated with D-galactose. (A) Representative images of H&E and alcian blue staining of the colon (scale bar = 100 μm). (B) Number of goblet cells (n = 6). (C) Representative images of MUC2, Occludin and Zo-1 immunohistochemistry staining of the colon (scale bar = 100 μm). (D) IOD of MUC2 (n = 6). (E) IOD of Occludin (n = 6). (F) IOD of Zo-1 (n = 6). (G) The mRNA levels of Occludin, Claudin1, Tnf-α, Il-6, Tlr4 and Myd88 in the colon (n = 5). Data are presented as mean ± SEM and were analyzed using one-way ANOVA with LSD's test. *p < 0.05, **p < 0.01, ***p < 0.001.

Compromised intestinal barrier integrity plays an important role in the pathological progression of neuroinflammation and cognitive deficits. Hence, we assessed colonic tight junction proteins using IHC staining. Quantitative analysis revealed a significant reduction in the IOD of Occludin (p = 0.02) and Zo-1 (p < 0.001) in D-galactose-treated mice compared to controls (Fig. 3E and F). Conversely, kaempferol supplementation significantly increased the IOD of Zo-1 (p = 0.03) and partially restored Occludin levels (p = 0.09) (Fig. 3E and F). In parallel with hippocampal findings, we concurrently evaluated the expression levels of inflammatory mediators in colonic tissues. RT-PCR results demonstrated significantly upregulated mRNA levels of Tnf-α, Tlr4, and Myd88 in D-galactose-treated mice relative to controls (p < 0.05) (Fig. 3G). Kaempferol intervention effectively reversed these alterations (p < 0.05) (Fig. 3G). These results indicated that kaempferol alleviated impaired intestinal barrier integrity and suppressed inflammatory responses in D-galactose-treated mice.

The effect of kaempferol on the microbiota composition of D-galactose in mice

Following oral administration, kaempferol undergoes microbial metabolism catalyzed by the gut microbiota. We therefore hypothesized that its potential cognitive benefits in aging mice might be attributed to modulation of gut microbiota or microbiota-derived metabolites. We examined structural alterations in gut microbiota after kaempferol treatment by performing 16S rRNA gene sequencing on fecal samples to test this hypothesis. A total of 1312, 1392, and 1698 operational taxonomic units (OTUs) were detected in the CON, D-gal, and D-gal + Kaem groups, respectively (Fig. 4A). The rarefaction curves reached a clear plateau, indicating sufficient sequencing coverage (SI Fig. S1). Alpha diversity analysis (including Ace, Chao, Shannon, and Simpson indices) revealed high microbial richness and even distribution across groups, with no significant intergroup differences (Fig. 4B–E).

Fig. 4 Effects of kaempferol on gut microbiota composition in mice treated with D-galactose. (A) Venn diagram. (B–E) Simpson, Shannon, Chao and Ace index (n = 7). (F) Unweighted pair-group method with arithmetic mean (UPGMA) analysis (at the genus level, n = 7). (G) Principal component analysis (PCA) (n = 7). (H) PCoA score plot (n = 7). (I) Nonmetric multidimensional scaling (NMDS) score plot (n = 7). (J) Circos diagram of genus species in the fecal microbe of the CON, D-gal, and D-gal-Kaem groups. (K) Ternary plot analysis. (L) The co-occurrence network analysis of microbial community at the genus level (CON group). (M) The co-occurrence network analysis of microbial community at the genus level (D-gal group). (N) The co-occurrence network analysis of microbial community at the genus level (D-gal + Kaem group).

β-Diversity analysis was subsequently performed to assess intergroup community similarity. UPGMA clustering demonstrated that the D-gal + Kaem group clustered with the CON group, while both groups distinctly separated from the D-gal group (Fig. 4F). Principal coordinates analysis (PCoA) revealed a notable distinction between D-gal and CON groups (PERMANOVA: R² = 0.647, p = 0.001), while the D-gal + Kaem group showed a trend towards a community structure similar to the CON group (Fig. 4H). Principal component analysis (PCA) and non-metric multidimensional scaling (NMDS) were employed to validate these findings, both demonstrating consistent patterns of group separation (Fig. 4G and I). At the genus level, the predominant taxa included norank_f__Muribaculaceae, Lactobacillus, Lachnospiraceae_NK4A136_group, Ileibacterium, norank_o__Clostridia_UCG-014, and Akkermansia (Fig. 4J). Ternary plot analysis indicated distinct genus-specific distribution patterns: norank_f__Muribaculaceae and Ileibacterium were predominantly distributed in the CON group, Lactobacillus was enriched in the D-gal group, while Akkermansia showed highest abundance in the D-gal + Kaem group (Fig. 4K).

Microbial co-occurrence networks were constructed using the top 50 enriched genera per group to examine ecological interactions essential for host health (Fig. 4L–N). All groups exhibited significant inter-generic correlations, with green edges indicating negative correlations and red edges indicating positive correlations. The thickness of the edges is proportional to the magnitude of the correlation coefficient. The D-gal group exhibited the most complex interactions, with norank_f__Lachnospiraceae displaying the highest degree centrality (Degree = 12). In the CON group, Roseburia had the highest connectivity (Degree = 12), while Aerococcus was the central hub in the D-gal + Kaem network (Degree = 7) (Fig. 4L and M).

Core microbiota mining and functional prediction analysis

After conducting a macro-level evaluation of gut microbiota across different groups, we utilized linear discriminant analysis effect size (LEfSe) to accurately pinpoint bacterial taxa with significantly different abundances (Fig. 5A). Specifically, the relative abundances of g__norank_f__Muribaculaceae (Fig. 5B), g__Parasutterella (Fig. 5G), and g__Dubosiella (Fig. 5H) were significantly higher in CON mice than in D-galactose-treated mice, while g__Bilophila (Fig. 5D) was markedly enriched in the D-gal group. Notably, kaempferol supplementation upregulated the relative abundances of g__norank_f__Muribaculaceae (Fig. 5B), g__Faecalibaculum (Fig. 5E), g__Bifidobacterium (Fig. 5F), and g__Dubosiella (Fig. 5H), while downregulating g__Bilophila (Fig. 5D) compared to the D-gal group. Furthermore, relative to CON group, kaempferol significantly increased the abundances of g__Akkermansia (Fig. 5C), g__Faecalibaculum (Fig. 5E), g__Bifidobacterium (Fig. 5F), and g__Acetitomaculum (Fig. 5I). Using PICRUSt2 based on KEGG database, we predicted functional alterations in bacterial communities. At KEGG Level 2, predominant functional pathways included carbohydrate metabolism, amino acid metabolism, and energy metabolism (Fig. 5J). Level 3 analysis further revealed significant associations with LPS biosynthesis, longevity-regulating pathway – multiple species, glycosphingolipid biosynthesis-ganglio series, and axon regeneration pathways (Fig. 5K).

Fig. 5 Effects of kaempferol on gut microbiota imbalance in mice treated with D-galactose. (A) Taxonomic cladogram obtained from LEfSe sequence analysis. Lighted by colored circles and shaded areas. (B–I) Relative abundance of g__norank_f__Muribaculaceae, g__Akkermansia, g__Bilophila, g__Faecalibaculum, g__Bifidobacterium, g__Parasutterella, g__Dubosiella, g__Acetitomaculum in the colon microbiota based on the LefSe results (n = 7). (J) KEGG Pathway Level 2. (K) KEGG Pathway Level 3. *p < 0.05, **p < 0.01, ***p < 0.001.

Impact of kaempferol on fecal metabolites in D-galactose-induced mice

Within the gut–brain axis, gut microbiota could exert regulatory effects through their metabolites. Based on this premise, we further conducted targeted GC-MS to analyze fecal SCFAs. The results revealed that compared to controls, D-galactose-treated mice exhibited decreased levels of propionate and butyrate (p > 0.05), alongside a significantly increased level of isovalerate (p < 0.001) (Fig. 6B, C and F). Notably, kaempferol supplementation significantly elevated levels of propionate (p = 0.02), butyrate (p = 0.04), and isobutyrate (p = 0.03) in D-galactose-treated mice (Fig. 6B–D). Other SCFAs showed no significant differences among groups (Fig. 6A, E and G). Furthermore, we assessed serum LPS levels via ELISA. The study found that D-galactose-treated mice exhibited significantly elevated serum LPS levels compared to controls (p < 0.001), which were significantly reduced by kaempferol intervention (p < 0.001) (Fig. 6H).

Fig. 6 Effects of kaempferol on the metabolites in mice treated with D-galactose. (A) The colon acetate concentration (n = 5). (B) The colon propionate concentration (n = 5). (C) The colon butyrate concentration (n = 5). (D) The colon isobutyrate concentration (n = 5). (E) The colon valerate concentration (n = 5). (F) The colon isovalerate concentration (n = 5). (G) The colon hexanoate concentration (n = 5). (H) The content of LPS in serum (n = 7). (I) Correlation analysis between the gut microbiota, metabolites, and cognitive function parameters. The calculation method for correlation coefficient is spearman. Red represented a positive correlation, while purple indicated a negative correlation. Data are presented as mean ± SEM and were analyzed using one-way ANOVA with LSD's test. *p < 0.05, **p < 0.01, ***p < 0.001.

To elucidate associations between gut microbiota, metabolites, and cognitive function parameters, we performed Spearman correlation analysis. As illustrated in Fig. 6I, g__Faecalibaculum showed significant positive correlations with total distance, mean velocity, residence and movement time in the central zone in the OFT, as well as propionate and butyrate levels. Conversely, it exhibited significant negative correlations with total immobility time in the OFT. Butyrate demonstrated significant positive correlations with total distance, mean velocity, residence and movement time in the central zone, acetate, propionate, g__Dubosiella, and g__Faecalibaculum. It also showed a significant negative correlation with immobility time. Serum LPS levels were significantly negatively correlated with residence and movement time in the central zone, g__norank_f__Muribaculaceae, and g__Parasutterella, while exhibiting a significant positive correlation with g__Bilophila.

Discussion

This study demonstrates that oral administration of kaempferol ameliorates D-galactose-induced cognitive dysfunction by upregulating hippocampal Bdnf and Snap25 expression, reducing neuronal loss, and suppressing neuroinflammation, thereby exerting neuroprotective effects. Kaempferol improved intestinal barrier integrity, altered gut microbiota composition (notably increasing the relative abundance of g__Faecalibaculum and g__Akkermansia), and elevated propionate and butyrate levels. Correlation analyses established significant associations among g__Faecalibaculum, propionate/butyrate, and cognitive parameters. Collectively, these findings indicate that kaempferol mitigates cognitive decline via gut–brain axis mechanisms involving improved intestinal barrier function, microbial homeostasis restoration, and subsequent neuroinflammation attenuation with synaptic plasticity recovery.

Numerous human studies suggested that dietary flavonoid supplementation may be associated with enhanced cognitive performance. A meta-analysis of 26 studies with 269 574 participants showed that each additional 100 mg day⁻¹ of dietary flavonoids was linked to a 2% decrease in cognitive impairment risk.²² A 20-year prospective cohort study involving 77 000 middle-aged and older adults found that daily intake of colorful fruits and vegetables significantly reduced cognitive decline and dementia incidence, likely due to their high flavonoid content.²³ As a naturally occurring flavonoid, kaempferol is abundantly present in the rhizomes of kaempferia galanga, as well as in dietary sources including broccoli, strawberries, and grapes. This compound exhibits multifaceted bioactivities–encompassing antioxidant, anti-inflammatory, and neuroprotective properties–positioning it as a functionally significant dietary component.²⁴ To mechanistically investigate the therapeutic potential of kaempferol in ameliorating age-associated cognitive impairment, we established an accelerated aging model using D-galactose-induced senescence in mice.²⁵ In this study, we used daily intraperitoneal injections of 500 mg kg⁻¹D-galactose for 10 weeks to model aging-related cognitive impairment, based on its proven effectiveness in previous research. A recent study has demonstrated that administering 500 mg kg⁻¹ of D-galactose to mice for 10 consecutive weeks induces brain and liver damage, as well as significant cognitive dysfunction.²⁶ Another study found that flavonoids from Shiliangcha (Chimonanthus salicifolius) reduced brain aging in D-galactose-induced senescent mice by modulating gut microbiota, using the same 500 mg kg⁻¹D-galactose aging model.²⁷ Behavioral evaluations with OFT and Y-maze tests demonstrated that D-galactose administration induced anxiety-like behaviors and impaired spatial working memory, as evidenced by decreased central zone movement time and spontaneous alternation percentage. Notably, kaempferol supplementation significantly alleviated anxiety-like behaviors and partially restored spatial working memory. The neuroprotective efficacy of kaempferol was further corroborated in Parkinson's disease models, where it prevented dopaminergic neurodegeneration by enhancing mitophagy.²⁸ Collectively, these findings demonstrate significant neuroprotective effects of kaempferol against D-galactose-induced anxiety-like behaviors and spatial working memory impairment.

Maintenance of cognitive health requires coordinated interplay between neurons and neuroglia.²⁹ The hippocampus serves as a critical hub not only for learning and memory but also for stress responses and emotional regulation.³⁰ Hippocampal neuronal loss, predominantly in CA1 and CA3, represents a hallmark feature observed during AD progression.³¹ Notably, BDNF regulates synaptic plasticity in both the peripheral and CNS.³² Our study found that kaempferol treatment partially reversed hippocampal neuronal loss and increased Bdnf and Snap25 expression in D-galactose-treated mice. It concurrently suppressed microglial activation in the hippocampus and reduced pro-inflammatory cytokine levels by inhibiting the Tlr4-Myd88 signaling pathway. Previous studies indicated that kaempferol reduces microglia-mediated neuroinflammation by inhibiting MAPKs-NF-κB signaling and pyroptosis after secondary spinal cord injury.³³ Similarly, in DSS-induced murine colitis models, kaempferol exerts protective effects through LPS/TLR4 pathway inhibition.¹⁸ Collectively, these findings indicate that kaempferol ameliorates D-galactose-induced neuroinflammation and neuronal degeneration.

Flavonoids undergo complex biotransformation processes mediated by diverse enzymes and metabolites within the small and large intestines. These compounds regulate critical physiological functions, including nutrient metabolism, hormone secretion, and microbial ecology.³⁴ The gut–brain axis, a crucial pathway linking the intestine to the CNS, requires the inclusion of the microbiota-gut perspective for a thorough evaluation of brain function.³⁵ The intestinal barrier, which includes a mucus layer, epithelial barrier, and gut-vascular barrier, is essential for defending against external threats.³⁶ In older populations, changes in microbiota and weakened barrier function allow pro-inflammatory metabolites and bacterial products to enter systemic circulation. This cascade ultimately triggers systemic inflammation that disrupts blood–brain barrier integrity and potentiates neuroinflammation.^37,38 Kaempferol enhanced intestinal barrier integrity by upregulating tight junction proteins (Occludin, Zo-1) and MUC2 expression, while decreasing pro-inflammatory cytokines, thereby alleviating D-galactose-induced barrier disruption. These findings were corroborated by serum LPS quantification, where ELISA revealed significantly elevated LPS levels in D-galactose-treated mice versus controls, an increase effectively attenuated by kaempferol supplementation. Consistent with our results, prior studies confirmed that kaempferol alleviates experimental colitis via suppression of the LPS-TLR4-NF-κB axis.¹⁸ Collectively, kaempferol exerts marked improvement on intestinal barrier impairment in D-galactose-treated models.

Previous studies confirmed that kaempferol remodels gut microbiota across murine models.³⁹ The lipophilic characteristics of kaempferol facilitate its absorption in the small intestine through mechanisms such as passive diffusion, facilitated diffusion, or active transport.⁴⁰ Studies have shown that, following oral administration, kaempferol undergoes phase II glucuronidation in vivo, resulting in the production of primary metabolites, including KMP-3-O-glucuronide.⁴¹ After absorption, kaempferol is subject to metabolic transformations in the liver, leading to the formation of glucuronide and sulfo-conjugates.⁴² In the small intestine, intestinal conjugation enzymes play a role in this metabolic process.⁴³ Additionally, in the colon, the bacterial microflora metabolizes kaempferol and its glycosides, leading to the release of aglycones and the production of various compounds, including 4-methylphenol, phloroglucinol, and 4-hydroxyphenylacetic acid.^24,44 Our β-diversity analysis revealed distinct separation between microbial communities of D-galactose-treated and control mice. Treatment with kaempferol shifted the microbiota composition in D-galactose-exposed mice toward control-like clustering. The intestinal microflora of the elderly population was evaluated, which showed a decrease in beneficial bacteria and an increase in harmful bacteria.⁴⁵ Our results revealed a significant increase in the relative abundance of g__Bilophila in D-galactose-treated mice, which was effectively reversed by kaempferol intervention. Bilophila are recognized as opportunistic pathobionts, under intermittent hypoxic conditions, Bilophila proliferates in the gut, consequently impairing hippocampal function and elevating the risk of cognitive impairment.⁴⁶ Furthermore, we observed significant enrichment of g__Akkermansia, g__Faecalibaculum, and g__Bifidobacterium in kaempferol-supplemented D-galactose-exposed mice. Akkermansia, a keystone commensal bacterium utilizing mucin as its sole carbon and nitrogen source, plays significant therapeutic roles in intestinal inflammation, functional gastrointestinal disorders, and neurological conditions.⁴⁷Faecalibaculum, recognized as a next-generation probiotic, exerts anti-inflammatory effects primarily through butyrate production.⁴⁸Bifidobacterium could improve functional gastrointestinal disorders by metabolizing carbohydrates such as lactose and oligosaccharides to produce acetic acid and lactic acid.⁴⁹ The analysis showed that kaempferol intervention increased the presence of SCFA-producing bacteria in mice treated with D-galactose. It is reported that gut microbiota exert an impact on the brain through neurotransmitters, hormones, metabolites, and their own components via the gut–brain axis.⁵⁰ Therefore, we quantified SCFAs concentrations in fecal samples using targeted metabolomics. Following kaempferol administration, D-galactose-treated mice exhibited significantly elevated levels of propionate, butyrate, and isobutyrate relative to D-galactose-only controls. Previous studies have found that propionate supplementation or Akkermansia administration significantly improves cognitive function and mitochondrial bioenergetics in AD disease models.⁵¹ Our team previously demonstrated that melatonin ameliorates cognitive deficits in sleep-deprived mice by modulating gut microbial homeostasis and upregulating butyrate production.⁵² SCFAs can affect the CNS through both direct and indirect mechanisms.⁵³Propionate and butyrate have been demonstrated to traverse the BBB through specific monocarboxylate transporters. Upon entry into the brain, these compounds act as histone deacetylase inhibitors, thereby exerting a direct influence on synaptic plasticity within hippocampal neurons.⁵⁴ Notably, SCFAs, with butyrate being particularly significant, enhance the function of the intestinal barrier and inhibit the production of peripheral pro-inflammatory cytokines. This action reduces the translocation of inflammatory mediators, such as LPS, into systemic circulation, thereby diminishing the effects of peripheral inflammation on the brain and preventing microglia-mediated neuroinflammation.⁵⁵ Correlation analyses confirmed the mediatory role of SCFAs in gut–brain axis signaling, where propionate exhibited significant positive correlations with g__Bifidobacterium, g__Faecalibaculum, and movement time in the central zone, while butyrate showed positive associations with g__Dubosiella, g__Faecalibaculum, and movement time in the central zone. Conversely, serum LPS demonstrated significant negative correlations with movement time in the central zone. Collectively, kaempferol restores gut microbial homeostasis in D-galactose-treated mice by selectively enriching beneficial taxa linked to gut–brain health, with propionate and butyrate functioning as key signaling molecules that mediate cognitive improvement.

In this study, we primarily investigated the ameliorative effects of a continuous 10-week intervention on cognitive dysfunction in mice induced by D-galactose. Our research did not evaluate the persistence of kaempferol's effects following the cessation of treatment. Nonetheless, it is noteworthy that the mechanisms of action identified in our study—including modulation of the dynamically changing gut microbiota, maintenance of intestinal barrier integrity, and suppression of chronic neuroinflammation—strongly indicate that the benefits are likely associated with sustained intake. This concept is consistent with health promotion strategies based on dietary patterns, such as the Mediterranean diet, rather than short-term pharmacological interventions.⁵⁶ The gut microbiota may gradually return to its pre-intervention state after supplementation is discontinued. Therefore, to sustain a gut microenvironment and systemic physiological state conducive to cognitive health, long-term or periodic dietary intake may be necessary. In future research endeavors, we intend to incorporate post-intervention follow-up assessments to comprehensively assess the duration of kaempferol's efficacy. This approach aims to establish a theoretical foundation for its potential clinical application. While the present findings of this study do not establish a causal relationship between gut microbiota and cognitive function, the administration of sinapine has notably ameliorated disturbances in intestinal microbiota, damage to the intestinal barrier, reduction in synaptic proteins, and cognitive function impairment in mice induced by D-galactose. Future research will involve conducting a fecal microbiota transplantation experiment to elucidate the potential role of gut microbiota in this process.

Collectively, our study demonstrates that kaempferol intervention modulates gut microbiota composition and enhances SCFAs production, thereby suppressing neuroinflammation, reducing pro-inflammatory cytokine levels, and upregulating synaptic protein expression. These coordinated mechanisms alleviate anxiety-like behaviors and spatial working memory deficits induced by D-galactose in mice. Our research demonstrates that kaempferol can serve as a dietary approach to alleviate cognitive decline related to aging (Fig. 7).

Fig. 7 Schematic diagram of the potential mechanism by which kaempferol ameliorates neuroinflammation and cognitive impairment induced by D-galactose. A feasible mechanism is that kaempferol attenuated cognitive impairment in D-galactose-treated mice through modulating gut microbiota metabolism, enhancing intestinal barrier function, and suppressing neuroinflammation and synaptic dysfunction.

Abbreviations

AB-PAS	Alcian blue and periodic acid-Schiff
Bdnf	Brain-derived neurotrophic factor
CNS	Central nervous system
ELISA	Enzyme-linked immunosorbent assay
HPA	Hypothalamic–pituitary–adrenal
H&E	Hematoxylin and eosin
IOD	Integrated optical density
IL-6	Interleukin-6
LEfSe	Linear discriminant analysis effect size
LPS	Lipopolysaccharide
MUC2	Mucin-2
NMDS	Non-metric multidimensional scaling
OTUs	Operational taxonomic units
Psd95	Post-synaptic density protein 95
PCoA	Principal coordinates analysis
PCA	Principal component analysis
SCFA	Short-chain fatty acid
TNF-α	Tumor necrosis factor alpha

Author contributions

Xintong Wang: conceptualization, funding acquisition, investigation, visualization, writing – original draft; Wen Zhang: investigation, methodology, formal analysis; Huihui Wang: writing – review & editing; Yuzhen Zhao: investigation, methodology; Pengjie Wang: supervision; Ran Wang: methodology; Yanan Sun: supervision, conceptualization; Fazheng Ren: conceptualization, funding acquisition, project administration, resources, writing – review & editing; Yixuan Li: conceptualization, funding acquisition, project administration, resources, writing – review & editing.

Conflicts of interest

The authors declare no conflict of interest.

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on request.

Supplementary information (SI) is available. See DOI: https://doi.org/10.1039/d5fo03583j.

Acknowledgements

This research was funded by the 111 project of the Education Ministry of China (No. B18053) and the China Postdoctoral Science Foundation (2023M733794; 2024T171009).

References

1. J. Gong, et al., Nowcasting and forecasting the care needs of the older population in China: analysis of data from the China Health and Retirement Longitudinal Study (CHARLS), Lancet Public Health, 2022, 7, e1005–e1013.
2. M. Nakanishi, et al., Associations among age at menopause, depressive symptoms, and cognitive function, Alzheimer's Dementia, 2025, 21, e70063.
3. E. E. Smith, et al., Systemic determinants of brain health in ageing, Nat. Rev. Neurol., 2024, 20, 647–659.
4. L. Wang, et al., Spatial transcriptomics of the aging mouse brain reveals origins of inflammation in the white matter, Nat. Commun., 2025, 16, 3231.
5. N. Zhang and P. Jing, Red Cabbage Anthocyanins Attenuate Cognitive Impairment By Attenuating Neuroinflammation and Regulating Gut Microbiota in Aging Mice, J. Agric. Food Chem., 2023, 71, 15064–15072.
6. E. Tönnies and E. Trushina, Oxidative Stress, Synaptic Dysfunction, and, Alzheimer's Disease, J. Alzheimer's Dis., 2017, 57, 1105–1121.
7. S. Jin, et al., The mechanisms, hallmarks, and therapies for brain aging and age-related dementia, Sci. Bull., 2024, 69, 3756–3776.
8. M. Li, et al., Aged Gut Microbiota Contributes to Cognitive Impairment and Hippocampal Synapse Loss in Mice, Aging Cell, 2025, 24, e70064.
9. J. Lee, et al., Young versus aged microbiota transplants to germ-free mice: increased short-chain fatty acids and improved cognitive performance, Gut Microbes, 2020, 12, 1–14.
10. S. Ahmadi, et al., Metformin Reduces Aging-Related Leaky Gut and Improves Cognitive Function by Beneficially Modulating Gut Microbiome/Goblet Cell/Mucin Axis, J. Gerontol., Ser. A, 2020, 75, e9–e21.
11. M. E. Caetano-Silva, et al., Aging amplifies a gut microbiota immunogenic signature linked to heightened inflammation, Aging Cell, 2024, 23, e14190.
12. G. Agirman, K. B. Yu and E. Y. Hsiao, Signaling inflammation across the gut-brain axis, Science, 2021, 374, 1087–1092.
13. S. Jin, L. Zhang and L. Wang, Kaempferol, a potential neuroprotective agent in neurodegenerative diseases: From chemistry to medicine, Biomed. Pharmacother., 2023, 165, 115215.
14. C. Xie, et al., Amelioration of Alzheimer's disease pathology by mitophagy inducers identified via machine learning and a cross-species workflow, Nat. Biomed. Eng., 2022, 6, 76–93.
15. T. M. Holland, et al. Association of Dietary Intake of Flavonols With Changes in Global Cognition and Several Cognitive Abilities, Neurology, 2023, 100, e694–e702.
16. M. Wang, Y. Xia, S. Ai, X. Gu and H.-L. Wang, Kaempferol improves Pb-induced cognitive impairments via inhibiting autophagy, J. Nutr. Biochem., 2024, 125, 109556.
17. Y.-Y. Du, et al., Therapeutic Potential of Kaempferol against Sleep Deprivation-Induced Cognitive Impairment: Modulation of Neuroinflammation and Synaptic Plasticity Disruption in Mice, ACS Pharmacol. Transl. Sci., 2023, 6, 1934–1944.
18. Y. Qu, et al., Kaempferol Alleviates Murine Experimental Colitis by Restoring Gut Microbiota and Inhibiting the LPS-TLR4-NF-κB Axis, Front. Immunol., 2021, 12, 679897.
19. Y. Bian, et al., Kaempferol reduces obesity, prevents intestinal inflammation, and modulates gut microbiota in high-fat diet mice, J. Nutr. Biochem., 2022, 99, 108840.
20. E. J. Calabrese, et al., Kaempferol, a widely ingested dietary flavonoid and supplement, enhances biological performance via hormesis, especially for ageing-related processes, Mech. Ageing Dev., 2025, 225, 112065.
21. Z. Hua, et al., Kaempferol exerts antioxidant effects in age-related diminished ovarian reserve by regulating the HSP90/NRF2 pathway, Chem. Biol. Drug Des., 2024, 103, e14385.
22. J. Godos, et al., Dietary (Poly)phenols and Cognitive Decline: A Systematic Review and Meta-Analysis of Observational Studies, Mol. Nutr. Food Res., 2024, 68, e2300472.
23. T.-S. Yeh, et al., Long-term Dietary Flavonoid Intake and Subjective Cognitive Decline in US Men and Women, Neurology, 2021, 97, e1041–e1056.
24. S. P. Bangar, et al., Kaempferol: A flavonoid with wider biological activities and its applications, Crit. Rev. Food Sci. Nutr., 2023, 63, 9580–9604.
25. K. F. Azman and R. Zakaria, D-Galactose-induced, accelerated aging model: an overview, Biogerontology, 2019, 20, 763–782.
26. Q. Ma, et al., Crateva unilocularis Buch. shoots attenuate D-galactose-induced brain injury and cognitive disorders of mice through the PI3K/Akt/Nrf2 pathway, Food Funct., 2022, 13, 3465–3480.
27. S. Liu, et al., Flavonoids from Shiliangcha (Chimonanthus salicifolius) Alleviate Brain Aging in d-Galactose-Induced Senescent Mice through Gut Microbiota, J. Agric. Food Chem., 2025, 73, 16890–16905.
28. X. Han, et al., Kaempferol alleviates LD-mitochondrial damage by promoting autophagy: Implications in Parkinson's disease, Redox Biol., 2021, 41, 101911.
29. K. R. Taylor and M. Monje, Neuron–oligodendroglial interactions in health and malignant disease, Nat. Rev. Neurosci., 2023, 24, 733–746.
30. H.-J. Shi, S. Wang, X.-P. Wang, R.-X. Zhang and L.-J. Zhu, Hippocampus: Molecular, Cellular, and Circuit Features in Anxiety, Neurosci. Bull., 2023, 39, 1009–1026.
31. P. Yeapuri, et al., Amyloid precursor protein and presenilin-1 knock-in immunodeficient mice exhibit intraneuronal Aβ pathology, microgliosis, and extensive neuronal loss, Alzheimer's Dementia, 2025, 21, e70084.
32. B. Lu, G. Nagappan and Y. Lu, BDNF and Synaptic Plasticity, Cognitive Function, and Dysfunction, in Neurotrophic Factors, ed. G. R. Lewin and B. D. Carter, Springer, Berlin, Heidelberg, 2014, pp. 223–250.
33. Z. Liu, et al., Pretreatment with kaempferol attenuates microglia-mediate neuroinflammation by inhibiting MAPKs–NF–κB signaling pathway and pyroptosis after secondary spinal cord injury, Free Radicals Biol. Med., 2021, 168, 142–154.
34. K. Murota, Y. Nakamura and M. Uehara, Flavonoid metabolism: the interaction of metabolites and gut microbiota, Biosci. Biotechnol. Biochem., 2018, 82, 600–610.
35. J. S. Loh, et al., Microbiota–gut–brain axis and its therapeutic applications in neurodegenerative diseases, Signal Transduction Targeted Ther., 2024, 9, 37.
36. C. Chelakkot, J. Ghim and S. H. Ryu, Mechanisms regulating intestinal barrier integrity and its pathological implications, Exp. Mol. Med., 2018, 50, 1–9.
37. L. Best, et al., Metabolic modelling reveals the aging-associated decline of host–microbiome metabolic interactions in mice, Nat. Microbiol., 2025, 10, 973–991.
38. I. M. Rea, et al., Age and Age-Related Diseases: Role of Inflammation Triggers and Cytokines, Front. Immunol., 2018, 9, 586.
39. S. Zhang, et al., Kaempferol Alleviates Carbon Tetrachloride-Induced Liver Fibrosis in Mice by Regulating Intestinal Short-Chain Fatty Acids, Int. J. Mol. Sci., 2025, 26, 6666.
40. A. Madhu, G. Gupta, B. Arali, D. K. Chellappan and K. Dua, Anti-psychotic activity of aqueous root extract of Hemidesmus indicus: a time bound study in rats, https://www.eurekaselect.com, https://www.eurekaselect.com/article/80399.
41. L. Aa, et al., Rebalancing of the gut flora and microbial metabolism is responsible for the anti-arthritis effect of kaempferol, Acta Pharmacol. Sin., 2020, 41, 73–81.
42. S. Yodogawa, T. Arakawa, N. Sugihara and K. Furuno, Glucurono- and Sulfo-Conjugation of Kaempferol in Rat Liver Subcellular Preparations and Cultured Hepatocytes, Biol. Pharm. Bull., 2003, 26, 1120–1124.
43. V. Crespy, et al., The splanchnic metabolism of flavonoids highly differed according to the nature of the compound, Am. J. Physiol.: Gastrointest. Liver Physiol., 2003, 284, G980–G988.
44. M. A. J. Shaikh, et al., Current update on psyllium and alginate incorporate for interpenetrating polymer network (IPN) and their biomedical applications, Int. J. Biol. Macromol., 2021, 191, 432–444.
45. Y. Pu, et al., Gut microbial features and circulating metabolomic signatures of frailty in older adults, Nat. Aging, 2024, 4, 1249–1262.
46. C. A. Olson, et al., Alterations in the gut microbiota contribute to cognitive impairment induced by the ketogenic diet and hypoxia, Cell Host Microbe, 2021, 29, 1378–1392.e6.
47. A. Ioannou, M. D. Berkhout, S. Y. Geerlings and C. Belzer, Akkermansia muciniphila: biology, microbial ecology, host interactions and therapeutic potential, Nat. Rev. Microbiol., 2025, 23, 162–177.
48. Y. G. Cao, et al., Faecalibaculum rodentium remodels retinoic acid signaling to govern eosinophil-dependent intestinal epithelial homeostasis, Cell Host Microbe, 2022, 30, 1295–1310.e8.
49. M. Derrien, F. Turroni, M. Ventura and D. van Sinderen, Insights into endogenous Bifidobacterium species in the human gut microbiota during adulthood, Trends Microbiol., 2022, 30, 940–947.
50. K. Socała, et al., The role of microbiota-gut-brain axis in neuropsychiatric and neurological disorders, Pharmacol. Res., 2021, 172, 105840.
51. Z. Wang, et al., Akkermansia muciniphila and its metabolite propionic acid maintains neuronal mitochondrial division and autophagy homeostasis during Alzheimer's disease pathologic process via GPR41 and GPR43, Microbiome, 2025, 13, 16.
52. X. Wang, Z. Wang, J. Cao, Y. Dong and Y. Chen, Gut microbiota-derived metabolites mediate the neuroprotective effect of melatonin in cognitive impairment induced by sleep deprivation, Microbiome, 2023, 11, 17.
53. I. Mukhopadhya and P. Louis, Gut microbiota-derived short-chain fatty acids and their role in human health and disease, Nat. Rev. Microbiol., 2025, 23, 635–651.
54. E. R. Mann, Y. K. Lam and H. H. Uhlig, Short-chain fatty acids: linking diet, the microbiome and immunity, Nat. Rev. Immunol., 2024, 24, 577–595.
55. H. Wang, et al., Gut microbiota is causally associated with poststroke cognitive impairment through lipopolysaccharide and butyrate, J. Neuroinflammation, 2022, 19, 76.
56. K. Zhu, et al., Proteomic signatures of healthy dietary patterns are associated with lower risks of major chronic diseases and mortality, Nat. Food, 2025, 6, 47–57.

---