Open Access Article
Tyler L.
Bissoondial
,
Anthony J.
Pellicano
,
Itzhak D.
Goldberg
and
Prakash
Narayan
*
Department of Preclinical Research, Angion Biomedica Corp., USA. E-mail: pnarayan@angion.com
First published on 3rd November 2021
Emerging evidence suggests that microRNA dysregulation plays an important role in nonalcoholic steatohepatitis. Using a model of diet-induced liver disease that progresses to fibrosis and hepatocellular carcinoma, we identify a set of 22 microRNA with robust correlation with liver enzyme levels and liver collagen content. These disease-asssociated miRs play pivotal roles in steatosis, extracellular matrix deposition and liver cancer, and may form the basis for identification of therapeutic strategies against this form of liver disease.
Micro ribonucleic acids (microRNAs (miRs)) are small, non-protein coding, single-stranded RNAs of ∼22 nucleotides in length that regulate diverse biological aspects, including cell proliferation, differentiation, cell death, as well as organ development and the maintenance of organ physiology.9 In the context of NASH, dysregulated miRs play a pivotal role in fatty acid oxidation and metabolism pathways, inflammation, matrix deposition and progression to HCC.10 Altered hepatic miR profiles have been described in experimental and human NASH.10,11 Hepatocyte death can occur with ballooning degeneration that then releases several miRs into circulation and amplifies their potential to further propagate disease.12 Nevertheless, of the miRs reportedly dysregulated in NASH, it remains to be determined which, if any, are associated with disease. We utilize a model of diet-induced NASH and correlate liver enzyme levels and the amount of liver collagen deposition, each a continuous variable informing disease severity, to identify a subset of miRs associated with disease. Targeting these miRs may form the basis for effective therapies against NASH.
Hepatic gpat1 expression level was measured by two-step qPCR and normalized to peptidylprolyl isomerase A (ppia) level. The designed primer sequences (Table 1) were produced using Oligo Sigma services (Millipore-Sigma; Massachusetts, US).
| Gene | Forward | Reverse |
|---|---|---|
| gpat1 | CAATGAAACGCACACAAGGC | AACACTGGTGGCAAACATGC |
| ppia | GTGTTCTTCGACATCACG | AAGTTTTCTGCTGTCTTTGG |
Correlation of differentially expressed miRs with the AST, ALT and liver HYP, each a continuous variable informing disease severity, was performed using (GraphPad Prism Version 9.1.1). Two-tailed Pearson and Spearman (nonparametric) correlations were performed to compute correlation coefficients. R values (<−0.6 or >0.6) with p < 0.05 and ρ (<−0.6 or >0.6) were selected (Fig. 1a). A receiver operating characteristic (ROC) curve, i.e., true positive rate (sensitivity) vs. false positive rate (1-specificity), was generated using GraphPad Prism.
iDEP (iDEP.93 (sdstate.edu)), a web-based tool for analysing RNA seq data, was utilized for creating data visualizations.
| mmu-miR-122-3p | mmu-miR-137-3p | mmu-miR-22-5p | mmu-miR-200a-5p | mmu-miR-340-5p | mmu-miR-30e-3p | mmu-miR-125b-5p | mmu-miR-708-5p | mmu-miR-155-5p |
| mmu-miR-532-5p | mmu-miR-101a-3p | mmu-miR-361-3p | mmu-miR-154-3p | mmu-miR-425-3p | mmu-miR-409-5p | mmu-miR-376b-5p | mmu-miR-5100 | mmu-miR-1839-5p |
| mmu-miR-500-3p | mmu-miR-592-5p | mmu-miR-148a-3p | mmu-miR-203-3p | mmu-miR-23a-5p | mmu-miR-181b-5p | mmu-miR-376c-5p | mmu-miR-26a-2-3p | mmu-miR-7a-1-3p |
| mmu-miR-582-5p | mmu-miR-342-3p | mmu-miR-802-3p | mmu-miR-379-5p | mmu-miR-205-5p | mmu-miR-25-3p | mmu-miR-222-3p | mmu-miR-27a-5p | mmu-miR-29b-3p |
| mmu-miR-122b-3p | mmu-miR-16-5p | mmu-miR-136-5p | mmu-miR-223-5p | mmu-miR-125b-1-3p | mmu-miR-22-3p | mmu-miR-378d | mmu-miR-26a-5p | mmu-miR-542-5p |
| mmu-miR-122b-5p | mmu-miR-101b-3p | mmu-miR-127-5p | mmu-miR-374b-5p | mmu-miR-181d-5p | mmu-miR-149-5p | mmu-miR-223-3p | mmu-miR-181a-5p | mmu-miR-802-5p |
| mmu-miR-182-5p | mmu-miR-128-3p | mmu-miR-337-5p | mmu-miR-451a | mmu-miR-365-3p | mmu-miR-17-5p | mmu-miR-194-2-3p | mmu-miR-880-3p | mmu-miR-146a-5p |
| mmu-miR-30b-5p | mmu-miR-676-3p | mmu-miR-195b | mmu-miR-193a-3p | mmu-miR-144-3p | mmu-miR-362-5p | mmu-miR-154-5p | mmu-miR-503-5p | mmu-miR-146b-5p |
| mmu-miR-1948-3p | mmu-miR-429-3p | mmu-miR-326-3p | mmu-miR-181c-5p | mmu-miR-29c-3p | mmu-miR-150-5p | mmu-miR-33-3p | mmu-miR-134-5p | mmu-miR-32-5p |
| mmu-miR-194-5p | mmu-miR-369-3p | mmu-miR-183-5p | mmu-miR-376b-3p | mmu-miR-425-5p | mmu-miR-3068-3p | mmu-miR-342-5p | mmu-miR-301a-3p | mmu-miR-743b-3p |
| mmu-miR-33-5p | mmu-miR-200c-3p | mmu-miR-99b-5p | mmu-miR-3071-3p | mmu-miR-541-5p | mmu-miR-15b-5p | mmu-miR-126a-5p | mmu-miR-1195 | |
| mmu-miR-3065-5p | mmu-miR-30a-5p | mmu-miR-19b-3p | mmu-miR-15a-5p | mmu-miR-199a-5p | mmu-miR-322-5p | mmu-miR-126b-3p | mmu-miR-141-3p | |
| mmu-miR-125a-3p | mmu-miR-132-3p | mmu-miR-214-3p | mmu-miR-501-3p | mmu-miR-377-3p | mmu-miR-140-5p | mmu-miR-340-3p | mmu-miR-187-3p | |
| mmu-miR-200b-3p | mmu-miR-30f | mmu-miR-195a-5p | mmu-miR-409-3p | mmu-miR-125a-5p | mmu-miR-181c-3p | mmu-miR-195a-3p | mmu-miR-26b-5p | |
| mmu-miR-30c-5p | mmu-miR-20a-5p | mmu-miR-190a-5p | mmu-miR-455-5p | mmu-miR-411-5p | mmu-miR-221-5p | mmu-miR-338-3p | mmu-miR-27b-5p | |
| mmu-miR-200a-3p | mmu-miR-192-5p | mmu-miR-127-3p | mmu-miR-376a-3p | mmu-miR-136-3p | mmu-miR-188-5p | mmu-miR-18b-5p | mmu-miR-130a-3p | |
| mmu-miR-200b-5p | mmu-miR-652-3p | mmu-miR-130b-3p | mmu-miR-203-5p | mmu-miR-7a-5p | mmu-miR-20b-5p | mmu-miR-505-5p | mmu-miR-375-3p | |
| mmu-miR-24-3p | mmu-miR-199a-3p | mmu-miR-376c-3p | mmu-miR-142a-3p | mmu-miR-34a-5p | mmu-let-7i-5p | mmu-miR-18a-5p | mmu-miR-369-5p | |
| mmu-miR-122-5p | mmu-miR-199b-3p | mmu-miR-144-5p | mmu-miR-30e-5p | mmu-miR-351-5p | mmu-let-7j | mmu-let-7e-5p | mmu-miR-210-3p | |
| mmu-miR-1948-5p | mmu-miR-497a-5p | mmu-miR-382-5p | mmu-let-7i-3p | mmu-miR-30a-3p | mmu-miR-700-3p | mmu-miR-203b-5p | mmu-miR-5620-3p |
Both principal component analysis (PCA) and multidimensional scaling (MDS) plots revealed distinct clustering of DE miRs by cohort, with volcano plot analysis revealing the distribution of upregulated vs. downregulated DE miRs (Fig. 1f). The majority of these miRs fell within a log2 fold-change of −4 and 4 vs. the sham cohort. Additional insight was gained by heatmap representation of DE miRs which demonstrated that FFD resulted in both up- and down-regulation of hepatic miRs with clustering further stratified by the magnitude fold-change in up- or downregulation (Fig. 1f).
| Change | miR | HYP | AST | ALT | HYP | AST | ALT |
|---|---|---|---|---|---|---|---|
| r | r | r | ρ | ρ | ρ | ||
| Down | mmu-miR-122-3p | −1 | −1 | −1 | −1 | −1 | −1 |
| Down | mmu-miR-122b-5p | −1 | −1 | −1 | −1 | −1 | −1 |
| Down | mmu-miR-101a-3p | −1 | −1 | −1 | −1 | −1 | −1 |
| Down | mmu-miR-33-5p | −1 | −1 | −1 | −1 | −1 | −1 |
| Up | mmu-miR-132-3p | 0.6 | 0.8 | 0.9 | 0.9 | 0.7 | 0.8 |
| Down | mmu-miR-3065-5p | −1 | −1 | −1 | −1 | −1 | −1 |
| Up | mmu-miR-676-3p | 0.7 | 0.7 | 0.8 | 0.8 | 0.7 | 0.8 |
| Up | mmu-miR-342-3p | 0.6 | 0.8 | 0.8 | 0.9 | 0.7 | 0.8 |
| Up | mmu-miR-652-3p | 0.7 | 0.7 | 0.9 | 0.9 | 0.7 | 0.9 |
| Down | mmu-miR-101b-3p | −1 | −1 | −1 | −1 | −1 | −1 |
| Up | mmu-miR-326-3p | 0.6 | 0.8 | 0.9 | 0.8 | 0.9 | 0.9 |
| Down | mmu-miR-193a-3p | −1 | −1 | −1 | −1 | −1 | −1 |
| Up | mmu-miR-125b-1-3p | 0.7 | 0.7 | 0.8 | 0.8 | 0.6 | 0.9 |
| Down | mmu-miR-29c-3p | −1 | −1 | −1 | −1 | −1 | −1 |
| Up | mmu-miR-34a-5p | 0.8 | 0.6 | 0.8 | 0.6 | 0.9 | 0.9 |
| Up | mmu-miR-351-5p | 0.6 | 0.8 | 0.8 | 0.8 | 0.7 | 0.9 |
| Up | mmu-miR-150-5p | 0.7 | 0.6 | 0.8 | 0.9 | 0.6 | 0.7 |
| Up | mmu-miR-15b-5p | 0.6 | 0.7 | 0.8 | 0.8 | 0.8 | 0.9 |
| Up | mmu-let-7i-5p | 0.8 | 0.6 | 0.8 | 0.9 | 0.7 | 0.8 |
| Up | mmu-let-7j | 0.8 | 0.6 | 0.8 | 0.8 | 0.8 | 0.8 |
| Down | mmu-miR-29b-3p | −1 | −1 | −1 | −1 | −1 | −1 |
| Up | mmu-miR-155-5p | 0.8 | 0.6 | 0.7 | 0.8 | 0.7 | 0.8 |
Having identified a set of DE miRs whose expressions correlated against AST, ALT and liver HYP, qPCR analysis was undertaken to determine whether certain mRNA governed by a few of these miRs are subjected to modification. Evaluating all the mRNA regulated by each of these miRs is beyond the scope of this project and analysis was therefore limited to two miRs and a few of their targets.
miR-29b-3p plays a pivotal role in collagen accumulation (Fig. 1g).17 miR-29b-3p is downregulated in the FFD cohort (Fig. 1g) and qPCR analysis of hepatic homogenates revealed increased col1a1/a2 and col3a1 (Fig. 1g). Furthermore, each of col1a1, col1a2 and col1a3 exhibited a direct correlation with liver HYP content (Fig. 1h), a key component of collagens, further supporting the notion of an inverse relation between miR-29b-3p level and collagen deposition.
A number18 of studies suggest that a reduction in hepatic miR-122-3p is associated with increased lipid accumulation. Livers from the FFD cohort exhibited reduced miR-122-3p (Fig. 1i), and in addition to exhibiting steatosis, exhibited increased hepatic gpat1, a key intermediate in the synthesis of triacylglycerol and glycerophospholipids (Fig. 1i).
In addition to regulating lipid metabolism, miR-122-3p is a tumour suppressor.19 At sacrifice (17 months), several livers from the FFD (17 months) cohort exhibited tumours, a finding consistent with previous reports from this laboratory.13–16 By contrast, no tumours were evident in the sham cohort. To confirm that these tumours were indeed HCC, microscopic examination of liver sections housing tumours was conducted. Livers that presented with tumours on gross observation showed a trabecular growth pattern of atypical hepatocytes and clusters of multinucleated hepatocytes evident in H&E-stained sections (Fig. 1j). A distinct margin was observed between the cancerous and noncancerous parenchyma. The receiver operator characteristic curve indicated that the hepatic miR-122-3p level is a relatively good diagnostic for HCC with an area under ROC of 0.84, a sensitivity of 80% with a specificity of 78% (Fig. 1j).
In addition to the sheer size of the NASH pandemic, findings that NASH can necessitate liver replacement and can progress to HCC even in the absence of scarring are cause for alarm.1–7 Equally disconcerting is a clinical trial landscape dotted with failures.8 Indeed, absent a paradigm shift in understanding and leveraging biological pathways in NASH there is increasing risk of abandoning drug development in this space altogether.
Emerging evidence indicates that miRs play a pivotal role in liver disease.10–12 Alterations in miR levels in response to genetic/epigenetic factors or the local milieu contribute to steatosis. Several differentially expressed miRs have been reported in plasma samples of NAFLD patients and even more dramatically in NASH, potentially distinguishing NASH from simple steatosis.12 However, of the miRs described in nonclinical and clinical NASH, it is not presently known which are associated with disease progression. Identification of disease-associated elements could spur development of therapeutics that are effective in halting or even reversing NASH.
Using a previously described13–16 model of FFD-induced liver disease, we identified 170 DE miRs. Volcano and PCA plots, and MDS analyses indicated that NASH is associated with a multi-fold change in expression of these miRs with excellent separation of these miRs between healthy and diseased livers. To assign a more distinct role for miRs in NASH we employed Boolean AND-gated logic to identify DE miRs whose levels correlate with liver enzyme levels and liver HYP content. The rationale underlying use of these liver endpoints is multifactorial. Liver enzyme levels are a clinically validated biomarker that inform severity of disease, and are continuous variables not subjected to observer bias. By contrast, NAS, although a clinically relevant endpoint, is not a continuous variable, and is observer dependent. The histopathological liver fibrosis score is also a clinically valid endpoint but not a continuous variable and is also operator-dependent. Liver HYP content on the other hand is a surrogate for liver collagen content, is a quantitative variable, and both continuous and operator independent. Use of rigorous statistical tools identified a subset of 22 miRs that were not only DE but whose expression levels correlated with AST, ALT and liver HYP. Although establishing causality is beyond the scope of this study, the rigorous gating nature of the statistical tests employed does suggest a pivotal role for these miRs in liver disease. Expression levels of miRs were correlated using Boolean AND gates to AST, ALT and liver HYP content using Pearson product moment and Spearman rank criteria. It is therefore not unreasonable to hypothesize that these 22 miRs are NASH-drivers, at least in this model. While it is beyond the scope of this study to comprehensively investigate the role of each of these 22 miRs, a survey of the literature20–22 suggests that they are intimately involved in regulating steatosis, hepatic matrix deposition and progression to HCC. Indeed, evaluation of downstream targets of miR-29b-3p and miR-122-3p support this hypothesis.
In the present study, hepatic miR-29b-3p was reduced in the FFD cohort with concomitant increases in hepatic col1a1, col1a2 and col3a1 mRNA. In fact, a robust inverse (r < −0.90, p < 0.01) relation was observed between this miR and each of these mRNA. Furthermore, hepatic col1a1, col1a2 and col3a1 each correlated directly with liver HYP content, a surrogate for liver collagen deposition. These data are consistent with the role that miR-29 plays in downregulating the expression of several extracellular matrix genes including col1a1 and col3a1. Indeed miR-29 was down-regulated in livers of CCl4-treated mice and in mice that underwent bile duct ligation, a phenomenon that was also observed in in livers from patients with advanced liver fibrosis.17,23,24
A number18 of studies demonstrate that miR-122, the most abundant miRs in the liver, plays a prominent role in the NAFLD continuum. Overexpression of hepatic miR-122 counteracts lipid accumulation;25 appearance of steatohepatitis in miR-122 knockout mice26 indicates a causal role of this miR in NAFLD. Upregulation of expression of enzymes involved in triglyceride biosynthesis and transport likely cause steatosis.18 Consistent with these observations hepatic miR-122 was downregulated in our model, a model accompanied by steatosis and an increase in hepatic gpat1 – which plays a pivotal role in lipid accumulation by shunting fats away from oxidation.14 Numerous studies19,25,26 have reported that hepatic miR-122 is a tumour suppressor. Expression of miR-122 is downregulated in liver samples from HCC and in rodent models of liver cancer, and expression of miR-122 inversely correlated with clinical features, such as development/presence of metastatic disease and patient prognosis.19,25,26 In our model of FFD-induced liver disease, several mice exhibited HCC. Not only was hepatic miR-122 downregulated vs. the sham cohort, but it also served as an excellent diagnostic for the presence of HCC with an area under ROC of 0.84, a sensitivity of 80% and a specificity of 78%. Together these data highlight the importance of these disease-associated miRs in NASH.
There are a few weaknesses associated with this study. All findings are reported at a single time point and in single, albeit clinically relevant model of diet-induced liver disease. It remains to be determined whether these findings are consistently observed at other time points and/or in other models. Second, despite identifying a subset of 22 miRs associated with liver disease-relevant markers, the study does not necessarily confer a disease-driving role for these miRs. Additional studies would be required to demonstrate that these miRs indeed drive NAFLD. Nevertheless, findings from this study are important in that they identify a population of miRs strongly associated with the NAFLD continuum. Targeting these miRs might form the basis for effective therapies against NASH. Indeed, these miRs might serve as a starting point for new therapeutic approaches27 with agomirs or antagomirs that may finally translate to clinical success in NASH.
| This journal is © The Royal Society of Chemistry 2021 |