Chong Li†
abc,
Huilin Liu†d,
Jiao Yangae,
Jianfei Muabc,
Ranran Wangae and
Xin Zhao*abc
aChongqing Collaborative Innovation Center for Functional Food, Chongqing University of Education, Chongqing 400067, China. E-mail: zhaoxin@cque.edu.cn; Tel: +86-23-6265-3650
bChongqing Engineering Research Center of Functional Food, Chongqing University of Education, Chongqing 400067, China
cChongqing Engineering Laboratory for Research and Development of Functional Food, Chongqing University of Education, Chongqing 400067, China
dDepartment of Clinical Nutrition, Chongqing University Three Gorges Hospital, Chongqing 500101, China
eCollege of Biological and Chemical Engineering, Chongqing University of Education, Chongqing 400067, China
First published on 15th September 2020
Soybean milk fermented with Lactobacillus plantarum HFY01 (LP-HFY01) was used for weight and lipid reduction in mice with obesity induced by a high-fat diet. We evaluated the gastrointestinal tolerance in vitro, organ index, body fat rate, pathological changes, serum index, mRNA expression and changes of isoflavones in soybean milk. Results indicated that LP-HFY01 exhibited good tolerance to pH 3.0 artificial gastric juice (69.87 ± 0.04%) and 0.3% bile salt (15.94 ± 0.3%). LP-HFY01-fermented soybean milk reduced the body fat rate and liver index of obese mice (p < 0.05). Organ sections showed that LP-HFY01-fermented soybean milk improved fatty degeneration and liver cell damage caused by a high-fat diet. LP-HFY01-fermented soybean milk inhibited increases in low-density lipoprotein cholesterol (LDL-c), triglyceride (TG), alkaline phosphatase (AKP), and glutamic oxaloacetic transaminase (GOT) and the decrease in high-density lipoprotein cholesterol (HDL-c) in the serum of obese mice, and inhibited CCAAT/enhancer-binding protein-α (C/EBP-α) and peroxisome proliferator-activated receptor-γ (PPAR-γ) mRNA expression, as well as activated cuprozinc-superoxide dismutase (SOD1) and lipoprotein lipase (LPL) mRNA expression in the liver and epididymal fat of obese mice (p < 0.05). Daidzin, glycitin, daidzein, glycitein, genistein, and genistin contents in soybean milk were determined before and after fermentation by high-performance liquid chromatography (HPLC); the daidzin and genistin contents in the fermented soybean milk decreased, whereas the daidzein and genistein contents increased significantly. Therefore, the LP-HFY01-fermented soybean milk strongly inhibits obesity induced by a high-fat diet, and shows good potential for utilization.
Excess energy in the body is converted into triglycerides (TGs) and accumulates in subcutaneous adipocytes or visceral organs through oil droplets, causing liver diseases (e.g., nonalcoholic fatty liver disease or NAFLD) and cardiovascular diseases (e.g., hypertension, hyperlipidemia, coronary heart disease, and diabetes).3 The state of fat cells can be assessed by evaluating the quantity of oil droplets in each adipocyte or the size of fat cells. The World Health Organization listed obesity as a chronic disease in 1996. The data published by the International Agency for Research on Cancer (IARC) in 2002 also indicated that cancer such as esophageal cancer, colon cancer, and breast cancer are related to obesity.4,5 High levels of fatty acid and cholesterol caused by obesity can damage the immune system, reduce the phagocytic function of macrophages, decrease the anti-infective ability of the body, and cause the fatty degeneration of the posterior pituitary gland. Such an effect on the pituitary gland can reduce the secretion of growth and sex hormones, affecting the sexual maturity and growth and the development of the human body.6
People often reduce their energy intake by eating less high-fat and high-sugar foods and increase their physical activity to enhance their energy expenditure and thereby induce the body to achieve a negative energy balance to ultimately realize the effect of weight loss. However, both reduce energy intake and strengthen physical activity need long-term persistence, once the persistence fails, it can disrupt the negative energy balance in the body, preventing weight loss.7 Therefore, the use of different weight-loss drugs (orlistat, lorcaserin, phenylbutylamine, topiramate sustained-release capsules, etc.) has gradually been considered. However, the long-term use of weight-loss drugs can lead to diarrhea, nausea, insomnia, vomiting, and other adverse effects, as well as severe liver injury, acute kidney injury, headache, and other diseases.8,9 Alternatively, the potential risk for infection and the high cost discourage people from taking bariatric surgery (reducing the size of the stomach). To effectively lose weight and prevent diseases without toxic and side effects, natural products, such as tea polyphenols,10 Chinese herbal medicine,11 and probiotic fermented milk12 have been studied. Reports have indicated that probiotics or their fermented milk can reduce serum cholesterol and improve lipid metabolism.13 Therefore, research interest has been directed toward supplementation with probiotic fermentation products to alleviating and treating obesity.14
Soybean milk is an important plant protein resource for humans because of the high quality of plant protein and trace calcium. After fermentation, ingredients become diverse and the effect of weight loss and lipid reduction is improved.15 Probiotics refer to live bacteria preparations and their metabolites, which can improve the intestinal microecological balance and health of the host.16 Lactobacillus plantarum can produce proteases, organic acids, and other substances that can decompose protein, dietary fiber, oligosaccharides, and other macromolecular substances in soybean into small molecules during fermentation of L. plantarum, and realize pre-digestion. Therefore, compared with unfermented soybean milk, L. plantarum-fermented soybean milk can increase the nutritional value of soybean products and degrade small molecular proteins, increase total amino acid content and small peptide content, promote the dual regulation of intestinal peristalsis, diarrhea, and constipation,17 and influences the decrease of blood lipid, improvement of non-alcoholic fatty liver, and reduction of cardiovascular and cerebrovascular diseases.18
In the current study, we selected L. plantarum KFY01 (LP-KFY01), a “probiotic” strain from yak yogurt. We used LP-KFY01 fermented soybean milk as an intervention for obesity induced by a high-fat diet in mice. We also explored the weight loss and lipid-lowering mechanisms of LP-HFY01-fermented soybean milk at the biochemical, molecular and gene levels.
As much as 55.0 g of dry soybeans were soaked in 110.0 mL of water for 12 h; 110.0 mL of water was added to beat into soymilk. The soymilk was filtered into a conical flask by using double gauze, and the conical flask was placed in an autoclave, which was sterilized at 121 °C for 15 min. The sterilized soymilk was cooled on a superclean working table and then subpacked into 10.0 mL of sterilized centrifuge tubes. Each centrifuge tube was filled with 5.0 mL of soymilk and inoculated with 50.0 μL of activated bacterial stock solution. The centrifuge tube was sealed and placed in a 37 °C constant temperature incubator for fermentation for 12 h and then used for gavage the next day.
Product | Ingredient | Mass/% |
---|---|---|
Normal diet | Wheat flour | 25 |
Oatmeal | 25 | |
Corn flour | 25 | |
Soybean flour | 10 | |
Fish meal | 8 | |
Hog bone powder | 4 | |
Yeast powder | 2 | |
Refined salt | 1 | |
High-fat diet | High-fat diet was composed of 90% normal diet, 8.2% lard, 1.5% cholesterol and 0.3% bile salt |
a N: normal group; M: model group; L: L-carnitine group (medication group); LP: Lactobacillus plantarum HFY01-fermented soymilk group; LB: Lactobacillus bulgaricus-fermented soymilk group. S: soymilk group (unfermented soymilk group). | ||||||
---|---|---|---|---|---|---|
Groups | N | M | L | LP | LB | S |
Daily diet | Normal diet | High-fat diet | ||||
Daily oral components | Physiological saline | Physiological saline | L-Carnitine (200 mg kg−1) | LP-HFY01-fermented soymilk | LB-fermented soymilk | Soymilk |
Oral dose | 0.1 mL/10 g |
Primer name | Forward primer (3′ to 5′) | Reverse primer (3′ to 5′) |
---|---|---|
PPAR | CCTCAGGGTACCACTACGGAGT | GCCGAATAGTTC GCC GAA |
SOD1 | AACCAGTTGTGTTGTCAGGAC | CCATGTTTTCTTAGAGTGAGG |
LPL | AGGGCTCTGCCTGAGTTGTA | AGAAATCTCGAAGGCCTGGT |
C/EBP-α | TGGAGAACAGCAACGAGTAC | GCAGTTGCCCATGGCCTTGAC |
β-Actin | GGCATCACACTTTCTACAACG | GGCAGGAACATTAAAGGTTTC |
Strain | Survival rate in pH 3.0 artificial gastric juice (%) | Growth efficiency in 0.3% bile salt (%) |
---|---|---|
a Survival rate (%) = (Na/Nb) × 100, where Nb is the number of live cells at 0 h, Na is the number of live cells at 3 h, and the unit is CFU mL−1. Bile tolerance rate (%) = (A1/A0) × 100, where A1 is OD containing 0.3% (w/v) bile salt, and A0 is OD without 0.3% (w/v) bile salt. | ||
LP-HFY01 | 69.87 ± 0.04 | 15.94 ± 0.3 |
Mouse groups | Body weight | Liver | Epididymal fat | ||
---|---|---|---|---|---|
Weight | Ratio (%) | Weight | Ratio (%) | ||
a The calculation formula is as follows: organ index (%) = organ weight/body weight × 100; body fat rate (%) = fat mass/mouse weight × 100. a–e Mean values with different letters in the same bar graph are significantly different (p < 0.05) as determined using Duncan's multiple range test. | |||||
Normal | 26.785 | 0.937 ± 0.83e | 3.5e | 0.374 ± 0.050d | 1.4d |
Model | 30.842 | 1.2 ± 0.31a | 3.9a | 0.863 ± 0.062a | 2.8a |
L-Carnitine | 27.71 | 0.997 ± 0.041d | 3.6d | 0.443 ± 0.061c | 1.6c |
LP-HFY01-fermented soymilk | 28.387 | 1.051 ± 0.023c | 3.7c | 0.596 ± 0.029b | 2.1b |
LB-fermented soymilk | 28.421 | 1.079 ± 0.091b | 3.8b | 0.767 ± 0.021ab | 2.7ab |
Soymilk | 28.894 | 1.097 ± 0.135b | 3.8b | 0.809 ± 0.032a | 2.8a |
As shown in Fig. 2A–F, the liver in the normal group shows no pathological; no fat cavity is observed, the structure of the liver cells is complete and clear, and the arrangement is orderly. In the model group, many and small fat droplets are present in the liver; some large fat droplets are regular and round, indicating that the dynamic balance of energy is disrupted by the long-term intake of a high-fat diet in mice. Thus, preventing the complete decomposition of triglycerides taken in and storage of fat in the liver results in fatty liver. After gavage intervention, the number of fat cavities in the liver of the L-carnitine group was significantly reduced to a level close to that of the normal group, indicating that the drug treatment exerted a better therapeutic effect than model group. In the LP-HFY01-fermented group and LB-fermented group, the fatty lesions in the liver were alleviated. More fat droplets were observed in the unfermented soybean milk group. This finding suggests that compared with the unfermented soybean milk, LP-HFY01 and LB can improve the accumulation of fat more effectively. The reason could be that LP-HFY01 and LB can improve the composition of soymilk, promote the metabolism of fat, and reduce the accumulation of fat. The area of fat cavities in the liver was analyzed by Image Pro-Plus 6.0 software (Fig. 2G and H), and similar results were obtained (p < 0.05), but the mean diameter of fat cavities in different groups (except the model group) did not change significantly.
As shown in Fig. 3B, compared with the normal group, the model group has a significantly higher LDL content owing to the long-term intake of a high-fat diet. Compared with that in the model group, the LDL content in the L-carnitine group, LP-HFY01-fermented group, LB-fermented group and soymilk group are lower. The LP-HFY01-fermented soymilk can more effectively control the increase in LDL content in serum, compared with the unfermented soybean milk and LB-fermented soymilk. This finding suggests that fermentation with LP-HFY01 can inhibit the increase in LDL content in serum.
As shown in Fig. 3C, in contrast to the normal group, the model group exhibits TG accumulation in the liver, significantly increasing the TG content in the liver. This result suggests the successful establishment of the obesity model. When the LP-HFY01-fermented soymilk, L-carnitine, LB-fermented soymilk, and unfermented soymilk were administered via gavage, the blood damage caused by the high-fat diet was controlled to varying degrees. The L-carnitine group exhibited the largest increase in TG content in the serum. The effects on the unfermented soymilk group, LP-HFY01-fermented group, and LB-fermented group were evident but not as much as that on the L-carnitine group.
As shown in Fig. 3D, the serum AKP content is significantly higher in the model group than in the normal group, indicating that the long-term intake of a high-fat diet can cause liver damage in the model group. The AKP content is lower in the L-carnitine and LB groups than in the model group, even lower than that in the normal group. The increase in AKP content is more greatly inhibited in the LP-HFY01-fermented soymilk group than in the unfermented soymilk group. This result suggests that LP-HFY01-fermented soymilk can effectively reduce liver damage caused by the long-term intake of a high-fat diet.
As shown in Fig. 3E, the GOT enzyme activity in the model group is significantly higher than that in the normal group, indicating that long-term feeding of a high-fat feed can induce an increase in GOT enzyme activity in mouse serum. Compared with other treatment groups, the GOT activity in the LP-HFY01-fermented group decreased more significantly than that in the L-carnitine and LB-fermented groups; GOT content was close to the GOT content in the normal group. The results show that LP-HFY01-fermented soybean milk can inhibit liver damage, and the increase in GOT enzyme activity caused by long-term intake of a high-fat diet.
![]() | ||
Fig. 4 Gene expression in liver tissue. a–e Mean values with different letters in the same bar graph indicate significant differences (p < 0.05) as determined using Duncan's multiple range test. |
The LPL and SOD1 gene expression levels in the liver and adipose tissues in the model group were significantly lower than those in the normal group; compared with that in the model group, the LPL gene expression in the fat and liver tissues in the LP-HFY01- and LB-fermented groups increased to varying degrees; however, the increase in fat was weaker in the LB-fermented group than in the LP-HFY01-fermented group. The SOD1 gene expression in the liver and adipose tissues of the intervention groups, particularly the L-carnitine group, increased to varying degrees; SOD1 expression in the liver and adipose tissues was more strongly alleviated in the LP-HFY01-fermented group than in the unfermented and LB-fermented groups. This result suggests that LPL and SOD1 gene expression is more effectively regulated by LP-HFY01-fermented soybean milk.
![]() | ||
Fig. 6 HPLC assay. (A) Mixed standard chromatograms; (B) soybean milk chromatograms; (C) LB-fermented soybean milk chromatograms; (D) LP-HFY01-fermented soybean milk chromatograms. |
Compared with soybean milk, the LP-HFY01- and LB-fermented soybean milk showed lower daidzin and genistin contents but higher daidzein and genistein contents. Changes in specific component content are listed in Table 6. These changes may be attributable to the fermentation characteristics of the probiotic LP and LB strains. The composition of the six soybean isoflavones is shown in Fig. 7.
Samples | Daidzin | Glycitin | Genistin | Daidzein | Glycitein | Genistein |
---|---|---|---|---|---|---|
Soybean milk | 0.0376 | 0.0077 | 0.0603 | 0.0192 | 0.0057 | 0.0187 |
LB-fermented soybean milk | 0.0023 | 0.0018 | 0.0053 | 0.0390 | 0.0014 | 0.0423 |
LP-HFY01-fermented soybean milk | 0.0209 | 0.0026 | 0.0365 | 0.0707 | 0.0068 | 0.0678 |
![]() | ||
Fig. 7 Chemical structures of the 6 isoflavones. (1) Daidzin; (2) glycitin; (3) genistin; (4) daidzein; (5) glycitein; (6) genistein. |
When the normal human body feeds on large quantities of a high-fat diet, TGs accumulating in the liver cells cannot be completely decomposed and transported. Consequently; they form a round fat drop in the cells to create a fat cavity, damaging the normal structure of the liver cells, which then results in NAFLD.26 This condition is highly associated with obesity. Fat accumulation develops into chronic inflammation of fatty liver, although it can be reversed and recovered by fat metabolism; however, if diets and lifestyle habits are not modified, fatty liver inflammation may worsen and develop into liver fibrosis, cirrhosis, or liver failure.27 Studies have shown that L-carnitine treatment can effectively reduce the fat accumulation and fat cavities, as well as reduce the TG content in the liver.28 The organ index can reflect the health status of the mice, and the body fat rate can directly reflect fat content in mice, that is, the degree of obesity.29 The increase in serum LDL-c is the main risk factor for atherosclerotic cardiovascular and cerebrovascular diseases. The Adult Treatment Panel III (ATP III) of the National Cholesterol Education Program (NECP) in 2001 recognized LDL-c as the cornerstone of blood lipid control and indicated that a decrease in LDL-c can reduce the risk for cardiovascular and cerebrovascular disease in the future.30 The HDL-c level is negatively correlated with the occurrence of coronary heart disease > HDL-c mainly acts as an anti-atherosclerosis by promoting reverse cholesterol transport, as well as anti-oxidant, anti-inflammatory, anti-thrombotic, and other mechanisms.31 AKP and GOT can reflect the degree of liver injury. AKP needs to pass through the liver and then be excreted by bile. Liver damage can cause abnormalities in the excretion process, which can induce high AKP levels; GOT is mainly distributed in the myocardium and then in the liver, skeletal muscles, and kidney tissues. When liver cells are damaged, the cell membrane permeability increases, and GOT in the cytoplasm is released into the blood; subsequently, its serum concentration rises, suggesting damage to the liver parenchyma.32–35 The results of the current study confirm that the high-fat diet-induced model group exhibits apparent obesity, visceral fat accumulation, fat cell enlargement, and significant increases in serum TG and LDL-c contents; meanwhile HDL-c content decreased significantly, indicating that the model was established successfully. In the high-fat diet model group, the epididymal adipocytes increased significantly, accumulation of fat droplets in the liver tissue, and significant increases in AKP and GOT, indicating that a high-fat diet led to significant liver damage in mice.36 In the experiment, unfermented soybean milk can reduce the TG, LDL-c, AKP, and GOT levels while increasing the HDL-c level to improve dyslipidemia, obesity, and liver injury in the model group. L. plantarum is proved to exert significant weight loss and lipid-lowering effects. The synergistic effect of the combined use of both is considerably greater than that of the single use of unfermented soybean milk, and the lipid-lowering effect is significantly enhanced. Meanwhile, the overall effect of the LP-HFY01-fermented soybean milk on weight loss is stronger than that of the LB-fermented soybean milk, which is closer to that of L-carnitine. This lipid-lowering effect, which could be attributable to the probiotic intervention, improved the intestinal flora structure, changed the intestinal permeability, and inhibited the absorption of a high-fat diet.37
Adipose tissue is a complex endocrine system, which secretes active factors and participates in the regulation of the neuro-endocrine–immune network; the abnormal differentiation of adipocytes can cause fat accumulation and leads to endocrine dysfunction of adipocytes, resulting in metabolic diseases.38 Two transcription factors closely related to adipocyte differentiation are the PPAR-γ and C/EBP, the expression of which is closely related to the development of obesity. Peroxisome proliferator-activated receptors are ligand-activated receptors in the nuclear hormone receptor family with 3 subtypes. PPAR-γ is the most adipose tissue-specific and plays an important role in adipocyte differentiation. It can regulate fat metabolism, inflammation, immunity, and cell differentiation. The C/EBP family consists of 3 members. C/EBP-α plays a key role in adipocyte differentiation. It highly expressed in the final stages of adipocyte differentiation. It is associated with PPAR-γ and can activate the expression of fat-specific genes to synthesize, extract, and store long-chain fatty acids, as well as to stop the proliferation of cells, showing a state of complete differentiation.39,40 The current study explored the two main genes that affect adipocyte differentiation. The results show that both LP-HFY01-fermented soybean milk and LB-fermented soybean milk tend to inhibit the growth of adipocytes, reduce the accumulation of intracellular lipids, and inhibit the expression of the genes PPAR-γ and C/EBP-α, which are related to adipocyte differentiation, at the mRNA level; however, the effect of the LP-HFY01-fermented soybean milk is better. LPL is an enzyme that catalyzes the hydrolysis of triglycerides linked to proteins, which are mainly derived from fat cells, muscle cells, and other parenchyma cells. Inactive monomer often changes into active dimer by glycosylation, which act on adipose tissue and striated muscle capillary lumen. They also hydrolyze triglycerides carried by chylous particles and very-low-density lipoprotein to produce fatty acids and monoacylglycerides, which are converted into low-molecular-weight fatty acids for energy supply of tissue oxidation or storage.41 Soybean milk fermented with L. plantarum HFY01 can significantly increase the LPL activity in epididymal adipose tissue and liver tissue, promote the transformation of triglycerides, alleviate the pathological changes in liver tissue. In addition, obesity can enhance the damage caused by oxidative stress. In the experiment, the SOD activity in the fat and liver tissue of the mice fed with a high-fat diet was significantly decreased, which led to adverse effects similar to damage to cell membrane integrity. After the intervention of LP-HFY01-fermented soybean milk, SOD activity in the liver and fat of the mice fed with a high-fat diet was significantly increased, and oxidative damage was improved to a certain extent.
Probiotics can be colonized in the host intestinal tract and reproductive system, which can produce definite health effects, improving the microecological balance of the host and providing benefits. L. plantarum, a kind of lactic acid bacteria, produces organic acid, bacteriocin, hydrogen peroxide, diacetyl, and other natural antibacterial substances after metabolism. These substances can maintain the balance of the intestinal flora, prevent the colonization of pathogenic bacteria and adhesion of toxins, improve the immunity of the organism, promote nutrient absorption and other functions, improve intestinal permeability, enhance immunity, reduce cholesterol level, reduce oxidative stress, relieve lactose intolerance, and inhibit the formation of tumor cells.42–46 The probiotic properties of Lactobacillus-fermented products consumed for an extended period can generally reduce cholesterol content in vivo, according to a study conducted among the Masai tribe of Africa by Mann and Spoerry in the 1970s.47 Yak yogurt is a naturally fermented dairy product in the Tibetan area. Owing to its special natural environment, specifically the large difference between milk fermented with microorganisms and ordinary fermented yogurt, yak yogurt has special flavor and quality; in addition, it contains rich nutritional components, which can inhibit oxidation, reduce cholesterol, and regulate immune response.48 Therefore, we studied yak yogurt in Aba Tibetan and Qiang Autonomous Prefecture of Sichuan Province. We isolated and identified the probiotics in yak yogurt, and labeled one of them as L. plantarum HFY01 (LP-HFY01). The experiment showed that LP-HFY01 exhibits good tolerance to gastric acid and bile salt in vitro and further studied the potential probiotic characteristics of LP-HFY01-fermented soybean milk.
A nutrient-rich plant protein resource, soybean is rich in protein, vitamins, unsaturated fatty acids, soybean isoflavones, and trace elements. The long-term use of soybean or soybean processing can prevent or alleviate cardiovascular disease, fatty liver disease and other diseases. Isoflavones and other bioactive components in common soybean exist in a combined form, which hinders its effective utilization by the body. However, the macromolecular substances in LP-HFY01-fermented soybean milk are hydrolyzed into small molecular substances, and vitamins and other nutrients are increased, facilitating its digestion and absorption by the body; the soybean milk fermented with LP-HFY01 can also remove the original beany smell and add soft acid taste and aroma, enhance the characteristics that render it edible, and produce organic acids that can effectively inhibit the reproduction of spoilage bacteria.49–51 Soybean isoflavones are also known as phytoestrogens for the similarity of their structure to animal estrogens. They affect hormone secretion, metabolic biological activity, protein synthesis, growth factor activity, and cancer chemoprevention.52 Ten kinds of soybean isoflavones have been identified, and these are mainly divided, based on structure, into free aglycones and combined glycosides. Daidzein, genistein, and glycitin belong to the former and exhibit high biological activity and high utilization efficiency. Meanwhile, daidzin and genistin belong to the latter group, characterized by a large molecular weight, hydrophilicity, and difficulty of absorption by the small intestine; however, intestinal microorganisms can degrade them into active and easily absorbed aglycones, although they are poorly hydrolyzed. The adverse situation can be improved by ingesting probiotics.53,54 In this experiment, after the soybean milk was fermented with LP-HFY01, the glycosidic daidzin and genistin (which were not effectively utilized by the body) were hydrolyzed, and aglycone daidzein and genistein (which were not easily absorbed by the body) increased. The fermentation of oral soybean milk with by LP-HFY01 not only provided rich nutrition for the body; it also facilitated β-glucosidase in the hydrolysis of the isoflavone glycoside structure, allowing its direct absorption by the small intestine. Consequently, the biological function of isoflavones was promoted, and their health care function was greatly enhanced. In addition, the changes in the intestinal flora composition are related to diet-induced obesity, insulin resistance, and diabetes. The intervention and regulation of host intestinal flora can selectively increase the number of intestinal probiotics in mice, adjust the balance of the intestinal flora, alleviate obesity and diabetes induced by a high-fat diet, as well as prevent and treat the effects of a metabolic disorder.55 Nutritional components in the unfermented soybean milk had high molecular weight and low digestibility. After being fermented with LP-HFY01 or LB, the digestibility of soybean milk improved and was efficiently used in the intestinal tract. Ingestion of probiotics or their fermented products could modify the colonization of relevant microorganisms in the intestinal tract, form a biological barrier with other anaerobic bacteria, inhibit the colonization of Enterobacter, Enterococcus, and other pathogenic bacteria, and adjust the intestinal microbial balance. It could also ferment in the colon to produce many short-chain fatty acids and regulate the metabolism of blood lipids.56
Footnote |
† These authors contributed equally. |
This journal is © The Royal Society of Chemistry 2020 |