Anna Davydovaa,
Vasilisa Krasitskayab,
Pavel Vorobjevac,
Valentina Timoshenkoa,
Alexey Tupikina,
Marsel Kabilova,
Ludmila Frankbd,
Alya Venyaminovaa and
Mariya Vorobyeva*a
aInstitute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk 630090, Russia. E-mail: maria.vorobjeva@gmail.com
bInstitute of Biophysics SB RAS, Federal Research Center “Krasnoyarsk Science Center SB RAS”, Krasnoyarsk 660036, Russia
cNovosibirsk State University, Pirogova St., 2, 630090 Novosibirsk, Russia
dSiberian Federal University, Krasnoyarsk 660041, Russia
First published on 1st September 2020
We report a novel bioluminescent aptasensor, which consists of 2′-F-RNA aptamer modules joined into a bi-specific aptamer construct. One aptamer module binds the analyte, then after structural rearrangement the second module recruits non-covalently Ca2+-dependent photoprotein obelin from the solution, thus providing a bioluminescent signal. This concept allows using free protein as a reporter, which brings such advantages as no need for aptamer–protein conjugation, a possibility of thermal re-folding of aptamer component with no harm to a protein, and simpler detection protocol. We developed the new 2′-F-RNA aptamer for obelin, and proposed the strategy for engineering structure-switching bi-modular aptamer constructs which bind the analyte and the obelin in a sequential manner. With the use of hemoglobin as a model analyte, we showed the feasibility of utilizing the aptasensor in a fast and straightforward bioluminescent microplate assay. With a proper design of a secondary structure, this strategy of aptasensor engineering might be further extended to bi-specific aptamer-based bioluminescent sensors for other analytes of interest.
Aptamers continue to find numerous applications in molecular engineering for bioanalysis, medical therapeutics, and diagnostics. By their very nature, aptamers are made of nucleic acids, which brings several advantages to the smart design of aptamer-based molecular constructs.
First, the functional activity of an aptamer is determined by its spatial structure. The latter, in turn, relies on intermolecular complementary base-pairing and thus can be regulated by altering the aptamer's length and nucleotide sequence. The ability of aptamers to change their conformation after target binding gives ample opportunities to design biosensing platforms. For instance, a large variety of nanomaterial-assisted aptasensors have been developed, detecting the binding event after a conformational change (see the review4).
Second, aptamers as building blocks are very compatible, so one can combine them in a “Lego-like” manner to obtain complex molecules with tuneable properties depending on the certain research task. More to the point, the design of such joint molecules hangs upon well-established algorithms of nucleic acids' secondary structure prediction.5 So-called multivalent aptamer constructs can comprise several copies of the same aptamer to increase the binding avidity. Otherwise, joining aptamers to different targets opens the widest possibilities to obtain a desired repertoire of functionalities.6 Specifically, bioanalytical systems of this type can combine two aptamer modules: one for the analyte recognition, and the other for recruiting a reporter molecule which, in turn, provides an analytical signal.7–10 Once generated, the aptamer module that non-covalently immobilizes the reporting group could then be used for the engineering of bi-aptameric constructs for different analytes.
In the present study, we aimed to create bioanalytical bi-modular aptamer constructs that recruit Ca2+-regulated photoprotein obelin as a reporter. Obelin is an extraordinarily sensitive, triggerable reporter suitable for different bioluminescent assays.11 Particularly, we have previously demonstrated that obelin covalently attached to the specific aptamer gives a very sensitive and selective reporter for the bioluminescent aptasensor.12–14 So far, bioluminescent proteins are quite rarely used as reporter groups for aptamer-based assays, although they provide excellent analytical response and signal-to-noise ratio. For example, Moutsiopoulou et al. recently reported the aptamer beacon biosensing system comprising structure-switching anti-IFNγ DNA aptamer covalently joined with Gaussia luciferase and its inhibitor.15 However, the covalent joining of the aptamer and the protein, may narrow the possibilities for thermal denaturation and refolding of the aptamer due to the risk of protein deactivation. Here, we propose a fundamentally different approach to the engineering of bioluminescent aptasensors: the non-covalent recruitment of obelin, which does not require chemical conjugation or engineering of a fused protein to incorporate the reporter into the bioanalytical system. Moreover, prior to the obelin addition, the analytical system comprises only the nucleic acid and may undergo denaturation/renaturation steps with no risk of deactivation for the reporter protein. A number of aptamers capable of binding small fluorogens and enhancing their fluorescence have been described to the moment, and successfully employed for RNA imaging.16 Nevertheless, to the best of our knowledge, the only example of an aptamer for a reporter protein is the GFP-binding one.17 We selected and rationally truncated the novel 2′-F-RNA aptamer for obelin, and proposed a strategy for its integration into bi-modular structure-switching construct. The proof of concept for this strategy was demonstrated by the example of bi-functional constructs built of obelin-binding and hemoglobin-binding 2′-F-RNA aptamers which were successfully employed in the microplate bioluminescent assay.
Biotinylated aptamers were synthesized from 3′-aminohexyl containing 2′-F-RNA aptamers by incubation in 0.1 M Na2B4O7 with a 100-fold molar excess of biotin N-hydroxysuccinimide ester (Merck, Germany) for 2.5 h at 25 °C. The product was precipitated by 2% NaClO4 in acetone, washed twice with acetone and diluted in water. The excess reagent was removed by centrifugation using an Amicon Ultra-0.5 mL Centrifugal Filters 3 K device (Merck, Germany).
The dsDNA library was obtained by the primer extension using the Klenow fragment of E. coli DNA polymerase I. The product of the extension reaction was purified with the MinElute Reaction Cleanup kit (Qiagen, Germany). The purified dsDNA library was then used as a template for in vitro transcription of the 2′-F-modified RNA library. The transcription was performed using 1 mM ATP, GTP and 3 mM 2′-F-UTP, 2′-F-CTP, and T7 RNA polymerase. The resulting 2′-F-modified RNA library was purified by gel filtration and analyzed by denaturing PAGE.
2′-F-Modified RNA library was folded in DPBSE by heating at 90 °C for 5 min and cooled down for 10 min at 25 °C. Then Tween 20, BSA and E. coli tRNA (rounds 1–5) or polyA (rounds 6–12) were added as nonspecific competitors for final concentrations of 0.05%, 0.01%, and 0.1%, respectively. To remove nonspecifically binding RNAs, the initial library was incubated with 5 μL of Ni Sepharose resin at room temperature with mixing for 1 h. Unbound RNAs were collected by centrifugation and mixed with 5 μL of Ni Sepharose with pre-immobilized His-Obe at room temperature for 1 h. Unbound RNAs were washed out with 0.05% Tween 20 in DPBSE. After several washes, RNA–protein complexes were eluted with 20 mM Tris–HCl buffer (pH 7.0) containing 100 mM imidazole. The recovered RNAs were subjected to reverse transcription by RevertAid reverse transcriptase followed by the cDNA amplification and T7 RNA transcription to regenerate an enriched RNA pool. The selection pressure was progressively increased by decreasing the amount of protein and the time of incubation and adding more washes (see details at Table S1†).
(1) |
Each binding assay was performed in triplicate. The values of the equilibrium dissociation constants (KD) were determined by approximation of experimental data using a standard equation for bimolecular ligand–receptor binding (2) in the GraphPad Prism software.
(2) |
Then, the wells were washed, and 50 μL aliquots of the mixed solution of human hemoglobin (final concentration from 100 to 1.6 nM) and His-Obe (final concentration of 100 nM) in binding buffer were added into the wells and incubated for 40 min at room temperature.
Aliquots of 100 nM His-Obe in binding buffer were placed into the control wells. After washing the wells, bioluminescence of bound obelin was initiated by injection of 0.1 M CaCl2 in 0.1 M Tris–HCl, pH 8.8 (50 μL) and measured with Mithras LB 940 plate luminometer (Berthold, Germany).
The signal was integrated for 5 s. Signals from the control wells were subtracted from those obtained from the respective aptamer-containing wells.
The Ca2+-regulated photoprotein obelin elongated from the N-terminus by the hexahistidine fragment (His-Obe)18 was used as a SELEX target, according to commonly used selection technique27–29 (see ESI† for Experimental details of the selection). To monitor the course of the enrichment, we assessed the diversity of the obtained libraries in the dsDNA form by analyzing remelting profiles of dsDNA pools (DiStRO assay) (Fig. S1†). The progressive increase in remelting temperature with the number of the round pointed to the loss of diversity, which corresponds to the enrichment of the library After 12 rounds of selection and high-throughput sequencing of the final and intermediate selection pools, the most represented aptamers (Table S2 and Fig. S3†) were chemically synthesized and tested for their ability to bind His-tagged and tag-free obelins.
Name | Sequence (5′–3′) | KD, μM (His-Obe) | KD, μM (wt-Obe) |
---|---|---|---|
a NB, no binding detected. | |||
O79 | gggagacaagaauaaacgcucaaugugaagucgcauuuaauugcuggcgccguuuacuugcucuucgacaggaggcucacaacaggc | 0.28 | 0.69 |
O79t | gggagacaagaauaaacgcucaaugugaagucgcauuuaauugcuggcgccguuuacuugcuc | 0.34 | 0.72 |
O3t | gggagacaagaauaaacgcucaaugugaagucgcacuuaguugcuggcgucguuuacuugcuc | 0.23 | 1.37 |
O4t | gggagacaagaauaaacgcucaacuaggcugugcgcggugcccuaucuuauccgcgccucuccu | 0.58 | NBa |
O6t | gggagacaagaauaaacgcucaagacgugcgcgggaaagaccgacgcucuaccccuacaagcu | 0.94 | NBa |
O35 | gggagacaagaauaaacgcucaauaggguacgcggacagcgaugggaccgcguugccagccccuucgacaggaggcucacaacaggc | 0.12 | NBa |
O5 | gggagacaagaauaaacgcucaaguuguacgcgguuggcaauccgcguugcuuuacggguuccuucgacaggaggcucacaacaggc | 0.45 | NBa |
As the most promising candidate for the obelin-recruiting module, we chose the aptamer O79, which demonstrated sufficient binding affinity to both His-tagged and tag-free targets. Of note, the bioluminescent assay with microplate-immobilized aptamers proved that obelin retains its bioluminescent properties being bound to the aptamers (Fig. S7†).
Further truncation of O79t1 aptamer led to the complete loss of binding affinity (Fig. S6, ESI†). We therefore considered this sequence as a minimal binding motif. Of note, the aptamers of O79 series demonstrated an excellent selectivity for obelin. We have not registered any complex formation with closely related Ca2+-dependent photoproteins aequorin and clytin (e.g., Fig. 1B), even though these three proteins exhibit high structural homology.20
Since the analytical signal should turn-on only in the presence of the target analyte, we aimed to engineer a structure-switching construct capable of strictly sequential activation. To this point, we employed the rational modular design relying on the secondary structure prediction. Within the bi-specific construct, the analyte-binding aptamer mostly retains its structure, while the obelin-binding part is hybridized with a complementary fragment of the analyte aptamer or with a short additional linker sequence. It is, therefore, ‘hidden’ and unable to recognize the obelin. Binding of the analyte induces the structural rearrangement of the whole construct and ‘unmasking’ of the obelin-binding aptamer. Thus, upon the addition of obelin, it binds the cognate aptamer, which, in turn, enables the generation of the specific bioluminescent signal after Ca2+ addition. The principal detection scheme is depicted in Fig. 2.
Fig. 2 A general scheme of microplate bioluminescent detection of an analyte with bi-specific aptamers. |
As a proof of principle for this strategy, we employed the human hemoglobin (Hb) binding 2′-F-RNA aptamer H9t11 as an analyte-binding module.30 This G-quadruplex aptamer is of relatively small size (43 nt), which makes it possible to synthesize the whole 2′-F-RNA molecule built of two aptamer sequences on an automated DNA/RNA synthesizer. Theoretically, two aptamers can be fused into the single construct differently, with or without an additional oligonucleotide linker between the aptamer modules. Generally, linkers of “neutral” nucleotide sequences such as A10 and (dT)10, or non-nucleotide hexaethylene glycol linker are employed to connect different aptamers in bi-functional molecules that expose both aptamers for the simultaneous binding of the targets.5 However, for the constructs that provide the sequential target binding, the particular sequence of the linker requires a more thorough design since it contributes to the overall secondary structure. So far, there are no universal guidelines for engineering structure-switching bifunctional aptamers. In some cases, the fusion of two aptamers without a linker allows hiding one of them in the resulting structure.9 Other constructs require a smart design of the oligonucleotide linker made from the fragment of the one of the aptamers.7
Here, we tested both approaches. For the engineering of structure-switching bimodular aptamers, we either joined two aptamers without a linker or derived the linker sequences from short terminal fragments (6–8 nt) of both aptamers. In the latter case, we chose the length of the linker having in mind that the secondary structure of the bi-functional construct should be stable enough to hide the obelin aptamer, but also capable of rearrangement after hemoglobin binding. A set of possible variants was designed and analyzed for their secondary structures. In doing this, we considered two requirements: (1) the hemoglobin aptamer retains its structure, and (2) the structure of the obelin-binding motif within the whole molecule is significantly changed as compared to O79t1 alone. The following three constructs met the criteria mentioned above (Fig. 3): (1) O79t1 followed by H9t11 directly, without the linker, (2) 5′-H9t11-L-O79t1-3′, and (3) 5′-O79t1-L-H9t11-3′, where L is a hexanucleotide linker sequence corresponding to the 3′-terminal fragment of O79t1.
In contrast, upon the addition of hemoglobin, all constructs provided a specific growth in the bioluminescent signal proportional to the analyte's concentration, with slightly different bioluminescence curves. Namely, in the case of linker-containing aptamers, we observed a linear growth in the bioluminescent signal from 1.6 to 50 nM Hb for O79t1-L-H9t11 and from 3.1 nM Hb for the H9t11-L-O79t1 construct. For linker-free O79t1-H9t11, this growth started from 6.25 nM Hb. Thereby, the designed constructs possessed the ability to derive the specific bioluminescent signal upon the analyte binding. The developed assay allows for the simultaneous addition of hemoglobin and obelin to the microplate well with immobilized aptamer, followed by washing step and measurement of Ca2+ bioluminescence. This makes the detection protocol very easy and fast to perform. What is also important, the bi-functional aptamer is re-folded by the common heating/cooling procedure before plate immobilization, without jeopardizing the reporter photoprotein.
As compared to other aptasensing systems for hemoglobin detection, our assay surpasses the analytical performance of fluorescent aptasensor based on fluorescein-labeled aptamer and graphene oxide (range of detection 77–770 nM).31 Electrochemical hemoglobin-specific aptasensors provide lower detection limits of 10−12 M (ref. 32) and even 10−20 M.33 It should be noted, however, that physiological blood hemoglobin concentration is about 2 mM (13.2 g dL−1). All reported aptasensors provide at least nanomolar sensitivity and therefore perfectly suit for Hb detection.
We thus established a proof-of-principle for non-covalent integration of the reporter protein into the aptamer-based bioanalytical system using the specific aptamer. The proposed novel approach offers the advantages of using a free protein as a reporter group, wide possibilities for re-folding of the aptamer part without any harm for the protein component, and fast and straightforward protocol of detection. With a proper design of a secondary structure, this strategy of aptasensor engineering might be further extended to the bi-specific aptamer-based bioluminescent sensors for other analytes of interest.
Footnote |
† Electronic supplementary information (ESI) available. See DOI: 10.1039/d0ra05117a |
This journal is © The Royal Society of Chemistry 2020 |