Toan
Huynh
,
Samantha A.
Byrnes
,
Tim C.
Chang
,
Bernhard H.
Weigl
and
Kevin P.
Nichols
*
Intellectual Ventures Laboratory, 14360 SE Eastgate Way, Bellevue, WA 98007, USA. E-mail: knichols@intven.com
First published on 24th October 2019
In digital assays, devices are typically considered to require precisely controlled volumes since variation in compartment volumes causes biases in concentration estimates. To enable more possibilities in device design, we derived two methods to accurately calculate target concentrations from raw results when the compartment volume may vary and may not follow known parametrically described distributions. The Digital Variable Volume (dvv) method uses volumes of ON compartments (those with positive signals) and the total sample volume, while the Digital Variable Volume Approximation (dvva) method uses the number of ON compartments, the total number of compartments, and a set of separately measured volumes. We verified the trueness of the dvv and dvva methods using simulated assays where volumes followed an empirical distribution (based on measured droplet volumes) and well known distributions with a wide range of standard deviations. We applied both methods to digital PCR experiments with polydisperse volumes, and also derived equations to estimate standard errors and limits of detection. The dvv method allows the compartment volume to follow any distribution in each assay run, the dvva method allows for quantification without in-assay volume measurements, and both methods potentially enable new designs of digital assays.
Previously developed methods to infer results of digital assays with polydisperse volumes assume that the compartment volumes follow truncated normal (Gaussian) distributions16 or gamma distributions.17 These methods provide accurate results when the volumes follow the specified distributions, or when the standard deviations are small. However, in systems where compartments are made by a simple method, such as vortexing,13,14 the volume distribution does not have a known analytical form and spans orders of magnitude. A method to account for general volume variation was previously published18 but has not been shown to work with very wide volume distributions (e.g. those of manually made droplets13,14 with standard deviations exceeding a few times the mean). Another method was built upon results for multivolume digital PCR (MVdPCR)19 but with the assumption that the compartment volumes are non-identical, and without the confidence intervals of the estimated concentrations.
We aimed to derive the dvv and dvva methods so that they are compatible with any volume distribution, no matter how wide it is or if it follows any known function. These methods differ in the type of information available due to different experimental setups. The dvv method is applicable when the volumes of ON compartments are measured in each assay run and the total sample volume is known. The dvva method is useful when one knows the number of ON compartments, the total number of compartments, and a set of pre-measured compartment volumes as an estimate of the volume distribution.
In this paper, we describe the derivation of the dvv and dvva methods. We then compare the truness of the dvv and dvva methods to that of some previously published methods,16–18 using both assay results simulated with different volume distributions and experimental results. We also provide trueness maps of those methods and simple approximation methods. We then characterize the precision of dvv and dvva, and provide a simple approximation of the limit of detection.
Volumes following the gamma distributions were simulated using the method numpy.random.gamma. The shape was μV2/σV2, and the scale was μV2/σV (σV is volume standard deviation).
Volumes following the lognormal distributions were simulated using the method numpy.random.lognormal. The mean of the underlying normal distribution was , and the standard deviation of the underlying normal distribution was .
The simulation of volumes following the truncated normal distributions was limited to those with smaller standard deviations, due to a theoretical upper limit on the coefficient of variation (σV/μV), which we now prove. We can calculate the actual mean (μV) and standard deviation (σV) of a truncated normal distribution defined on (0, ∞) using the underlying mean (μ0) and standard deviation (σ0).20
(1) |
(2) |
The larger σ0, the larger the coefficient of variation, σV/μV. With erf (0) = 0 and erfc (0) = 1, as σ0 approaches infinity, σV/μV approaches a constant.
(3) |
Therefore, random volumes following truncated normal distribution were simulated with a limited range of standard deviations ( with μV = 1). Volumes following the truncated normal distributions were simulated using the method scipy.stats.truncnorm.rvs. To achieve the desired μV and σV, the mean (μ0) and standard deviation (σV) of the underlying normal distribution were calculated by numerically solving the system of eqn (1) and (2). The parameters for the scipy.stats.truncnorm.rvs method include the lower bound of (0 − μ0)/σ0, upper bound of effectively infinity (numpy.finfo(numpy.float64).max), location of μ0, and scale of σ0.
Volume simulation was verified by comparing histograms of simulated volumes with the theoretical probability distribution functions (Fig. S1†).
For a compartment with volume vi, at bulk concentration λ, the assay result was simulated via a Poisson random number (with mean of viλ), using the method numpy.random.poisson.
DNA targets were amplified using the BioRad Supermix for ddPCR (BioRad, Hercules, CA, USA). Input DNA concentrations were varied from 0.8 to 32000 copies per μL. Final primer and probe concentrations were 500 nM and 250 nM, respectively. The assay utilized the targeted the E. coli rodA gene (forward primer [GCAAACCACCTTTGGTCG], reverse primer [CTGTGGGTGTGGATTGACAT], and probe [TexasRed-AACCCCTACAACCGGCAGAATACC-BHQ2]).23 The droplet-based reactions were run in either a C100 or C1000 thermocycler (BioRad, Hercules, CA, USA) using the following protocol: 95 °C for 10 minutes, 40 cycles of 95 °C for 30 seconds and 60 °C for 1 minute.
In each experiment, droplets were imaged in a 100 μm-deep cell counting chamber slide (Countess slide, ThermoFisher C10228) using a Nikon Eclipse Ti2 inverted microscope with epifluorescence illumination and a 14-bit Nikon DS-Qi2 CMOS camera (Nikon Instruments, Melville, NY, USA). Large stitched images were acquired using 26 × 13 individual fluorescence images with a 20× objective, an automated x–y stage, and a 15% overlap. Droplets in the countess slides were focused manually prior to imaging. The Nikon NIS-Elements AR software was used to control the image acquisition.
The MATLAB (Mathworks, Natick, MA, USA) image analysis software was used to automate the quantification of ON droplets in each image. Briefly, images were cropped to remove edges with uneven illumination, converted to a black and white format, and thresholded before ON droplets were identified. The MATLAB Image Processing Toolbox (Mathworks, Natick, MA, USA) was used for droplet size identification and counting of ON droplets. In particular, images were analyzed using the imfindcircles function in the MATLAB Image Processing Toolbox. The size range was set to 2–50, with ObjectPolarity set to bright, Sensitivity set to 0.90–0.95, and EdgeThreshold set to 0.10–0.15. The resulting radii were converted to droplet volumes in pL.
For each assay, the bulk concentration needs to be calculated using a certain inference method. The dvv and dvva methods are based on maximum likelihood estimation; the concentration estimate is the one that maximizes the likelihood of observing a certain experimental result. The choice of maximum likelihood estimation was inspired by its use in MVdPCR19 (where each assay utilizes a handful of predetermined, precisely controlled volumes), which has been inspired by limiting dilution assays for microorganism counting.24,25 In particular, an important feature is that results from different volumes are readily combined by way of multiplying the likelihoods. Below, we derive the expressions used to calculate the concentration estimates and the standard errors using the maximum likelihood framework.
The main goal is to calculate the bulk concentration (λ) or its logarithm (Λ). The calculated values (estimators) are denoted as and , respectively. All symbols are defined in Table 1.
We begin by calculating the probability that a particular compartment with turns ON given the volume (v) and bulk concentration (λ) (eqn (4)). It is the same as the probability of having more than one target in the compartment, based on the Poisson distribution with the mean of vλ. This probability is useful in subsequent derivation steps.
(4) |
Herein, we operate under the assumption that eqn (4) is correct. Mathematically, the assay in each compartment follows Poisson statistics. In practice, this condition requires the following. First, the target particles are much smaller than the smallest compartment size, so that it is possible for each compartment to have from 0 to a very large number of target particles. Second, the assay in each compartment happens without interference from any other compartment (i.e. no cross-talks, blocking, etc.). Third, the subject (e.g. a pond) has to contain a much larger number of target particles (e.g. bacteria) in comparison to the expected number of targets in a sample (e.g. 1 mL of pond water) (even if the concentration is low), and the distribution of the particles is spatially homogeneous. Fourth, target particles are separate and independent from each other, i.e. the co-occupation of any two particles in the same compartment is due to independent events.
The likelihood l(λ) of observing a certain assay result, i.e. particular numbers of ON and OFF compartments (a and b, respectively) with the associated volumes is the product of individual likelihoods calculated using eqn (4).
(5) |
We need to find the λ value that maximizes l(λ). We use the natural logarithm of the concentration (Λ ≡ ln(λ)) and the loglikelihood function (L(Λ) ≡ ln(l(λ))) to conveniently calculate the standard errors and enforce the requirement for positive concentrations. The calculation of the standard error is also more appropriate for Λ than for λ because the distribution of Λ is less skewed.24,25 Therefore, the goal is now finding the Λ value that maximizes L(Λ). The expression for L(Λ) and the first and second derivatives are shown below.
(6) |
(7) |
(8) |
To calculate , we can numerically find the root of the first derivative (eqn (7)), i.e. solve the equation below.
(9) |
Eqn (9) agrees with the result obtained by using an equation for MVdPCR (eqn (10) in Kreutz et al.19), treating individual compartments as pre-determined compartments in MVdPCR. Although this approach was taken previously with the assumption that none of the volumes are identical,26 the derivation of eqn (9) herein shows that this assumption is mathematically unnecessary.
Plugging L′(Λ) = 0 into eqn (8), we have L′′(Λ) < 0. So the value found using eqn (9) indeed maximizes L(Λ). Also, using the derivatives at , the standard error of Λ can also be calculated using the observed Fisher information, .27
(10) |
This can be used to calculate the confidence interval. Calculating using the expected Fisher information is not feasible because the volume distribution is unknown. In fact, to use the dvv method, the volume distribution is not required and need not be the same from one experiment to another.
In general, we can calculate the probability a compartment turns ON using the volume distribution (specified by the probability density function f(v)).
(11) |
Previously, f(v) has been chosen to follow the gamma distribution17 or truncated normal distribution.16 However, in practice, f(v) may not be described by a simple function. and even when it is, a set of pre-measured volumes still needs to be experimentally obtained to characterize f(v). Therefore, for the dvv a method, a set of separately measured volumes, M ≡ v1, v2, …, vm, is used instead of f(v).
(12) |
The likelihood function can then be obtained using the binomial distribution (for the case of a ON compartments out of n compartments with the probability of pON(λ)).
(13) |
As motivated above, we can calculate the loglikelihood function with the change of variable Λ ≡ ln(λ), and subsequently, its first and second derivatives.
(14) |
(15) |
(16) |
To maximize L(Λ), we can find the root of L′(Λ) (eqn (17)), and verify that it corresponds to a maximum by checking the sign of the second derivative (eqn (18)). An interesting observation is that eqn (17) can also be obtained by using a/n to estimate pON(λ).
(17) |
(18) |
We can then calculate using the expected Fisher information, −〈L′′(Λ)〉.27 The second derivative, L′′(Λ), is a linear function of (eqn (16)). We can plug in eqn (15) and plug the subsequent result in eqn (16) to obtain the following expression for .
(19) |
In this particular case, the standard error calculated using the observed Fisher information, ,27 is also the same as eqn (19) evaluated at . This can be verified by plugging into (eqn (16)).
(20) |
Using the first and second partial derivatives with respects to Λ, we can calculate the optimal Λ (denoted Λ0) and the minimum .
(21) |
(22) |
Method | Input | Equation |
---|---|---|
Digital variable volume (dvv) | A, Vtotal | |
Digital variable volume | ||
Approximation (dvva) | a, n, M | |
Nonparametric volume | ||
Modeling18 (volmod) | a, n, M | An iterative process |
Poisson Plus16 (pp) | a, n, μV, σV | |
Poisson Plus approximation16 (ppa) | a, n, μV, σV | |
Huggett–Cowen–Foy17 (hcf) | a, n, μV, σV | |
Count (cnt) | a, n | |
Arithmetic mean volume (amv) | a, n, μV | |
Geometric mean volume (gmv) | μ lnV |
The standard deviation of the empirical distribution is 1.96. Random volumes following this distribution were simulated using inverse transform sampling.28 The standard deviations of the gamma and lognormal distributions were chosen from 0.01 to 5.01 and included the standard deviation of the empirical distribution (1.96). The gamma, lognormal, and truncated normal (truncated at 0 to ensure volumes are positive) distributions with different standard deviations (in the range of 0.01–5.01) were also used. Eqn (3) also implies that the pp method16 is not compatible with distributions with coefficients of variation larger than such limit.
We compared the trueness of the dvv, dvva, volmod, pp, and hcf methods with volume distributions that have the same standard deviation as that of the empirical distribution of 1.96 (Fig. 1). The truncated normal distributions were not considered due to the limit discussed above (eqn (3)), so only the empirical, gamma, and lognormal distributions were used. The dvv and dvva methods were accurate in the whole range of true Λ and in all distributions. The volmod method underestimated in cases of gamma distributions with larger standard deviations, but were accurate in all other cases (including the empirical and lognormal distributions with large standard deviations). The hcf method was accurate with the gamma distribution as expected (it is based on the gamma distribution). With the lognormal distribution, the hcf method was accurate at lower Λ values only and over-estimated at higher ones. The pp method under-estimated at all concentrations with all distributions. This result is expected because the truncated normal distribution behind the pp method cannot have a standard deviation of 1.96 while the mean is 1 (eqn (3)). Note that the confidence intervals for the hcf method were abnormally wide with the empirical and lognormal distributions, and were narrow with the gamma distribution. This observation further emphasizes the need for the appropriate volume distribution in the model, or the use of methods such as dvv or dvva to bypass that need.
Fig. 1 Trueness of the dvv, dvva, volmod, hcf, and pp methods in analyzing simulated assay results. The plots show the bias () calculated from simulated assay results versus input Λ. The shaded areas indicate the 95% confidence intervals calculated from the standard deviations. Compartment volumes were simulated following the empirical, gamma, and lognormal distributions, with parameters matching that of the empirical distributions (μV = 1 and σV = 1.96). The bulk concentration was varied over 2 orders of magnitude (λ ∈ [0.069, 6.93] ⇔ Λ ∈ [−2.67, 1.94]). The number of pre-measured volumes, m, was 2000, and the number of compartments, n, in each assay was 1000. Each point shows the average of results from 1500 assays. Such number of assays was chosen to ensure the sample size is large enough, and the simulated results (e.g.) converge (Fig. S2†). |
To provide an overview of the trueness of different methods in a wide range of distributions, we also calculated error maps of the inference methods (Table 2) over wide ranges of Λ and σV (Fig. 2), with different distribution types (gamma, lognormal, and truncated normal). After averaging over many simulation runs, the bias () was 0 throughout for both the dvv dvva methods. The volmod method was correct in most conditions, except those with very large volume standard deviations. As expected, the hcf method had no errors with the gamma distribution, but led to errors with the other distribution types. Similarly, the pp method gave correct results for truncated normal distributions, but not others. In general, methods other than dvv and dvva were accurate at lower bulk concentrations and volume standard deviations, while the dvv and dvva methods were accurate in all cases considered.
Fig. 2 Trueness maps of inference methods (Table 2) with different volume distributions (gamma, lognormal, and truncated normal), standard deviations (σV ∈ [0.01, 5.01] ⇔ ln(σV) ∈ [−4.61, 1.61]), and bulk concentrations (Λ ∈ [−2.67, 1.94]), with μV = 1. The color maps show the difference between (calculated from simulated assay results) and input Λ. The orange and blue dots indicate locations of 20% overestimation of λ () and 17% underestimation of λ (), respectively. The number of pre-measured volumes, m, was 2000, and the number of compartments, n, in each assay was 1000. Each point shows the average of results from 1500 assays. Dark gray areas indicate where the calculation is invalid. For the truncated normal distribution, ln(σV) ≤ −0.461, because σV ≤ 0.756 when μV = 1 according to eqn (3). |
Fig. 3 Application to experimental data (droplet digital PCR14). Plots show the relationship between values calculated using the dvv, dvva, hcf, and pp methods versus the expected Λ = ln (λ) values. The solid lines indicate the corresponding simulation results (averaged over 1500 simulation runs). The white dashed lines indicate where . The known input concentrations (λ) were 8.0 × 10−7, 8.0 × 10−6, 8.0 × 10−5, 8.0 × 10−4, 8.0 × 10−3, 1.6 × 10−2, and 3.2 × 10−2 copies per pL, and the corresponding Λ values were −14.04, −11.74, −9.43, −7.13, −4.83, −4.14, and −3.44. Note that the y-axis scale in each panel was chosen to present the data fully and clearly, and may be different from those of other panels. |
However, results using all methods were noisy and were obtained with only 3 technical replicates. As previously pointed out,14 there remains challenges in imaging and measuring droplets with sizes spanning a wide range. Future experiments with more replicates and better droplet counting methods (e.g. using a confocal microscope or a flow-through reader) will allow for a more expansive validation process.
It is useful to characterize when the calculation is more or less precise, i.e. the standard errors are smaller or larger, respectively. Using obtained with the dvv method for simulated assay results, was calculated over wide ranges of Λ and σV (Fig. 4). The quantity did not markedly increase until σV ≈ 0.5. Similarly, the most-precise Λ is near the best-case estimate of ≈0.466 (eqn (21)). Note that at smaller σV, the landscapes are similar across different distribution types, and at larger σV, the most-precise Λ also increases.
Fig. 4 Maps of the standard error () at different volume standard deviations (σV) and log bulk concentrations (Λ), with different types of volume distributions (gamma, lognormal, and truncated normal), using the dvv method. Each panel corresponds to a volume distribution type, and provides the landscape of the standard error as a function of Λ and σV. The white dashed line denotes the optimal Λ (eqn (21)). The magenta lines denote the contours (interval = 0.002). Each standard error (each point on the maps) was calculated from 1500 values, each of which was calculated using the dvv method from raw results of an simulated assay. In each assay, the number of compartments was n = 1000. The dark gray area corresponds to where the truncated normal distribution is not defined (σV ≤ 0.756 according to eqn (3)). The mean volume, μV, was 1. |
The dvva method is called “approximation” because the pre-measured volumes are used to approximate the true volume distribution. The more pre-measured volumes (larger m), the better this approximation. Indeed, as m becomes larger, the dvva becomes smaller and approaches the dvv (Fig. 5).
The standard errors of can be obtained using eqn (10) for the dvv method, and eqn (19) for the dvva method. The use of standard errors of is appropriate (especially when confidence intervals of assay results are desired) because values follow normal distributions (Fig. S3†). However, these expressions are expected to provide approximations only. If the dvv method is used, the standard error provided by eqn (10) is conditional upon the set of individual compartment volumes, each of which is a random variable based on the true volume distribution. The use of eqn (19) for dvva is more forgiving, because, even though the set of pre-measured volumes is also a random variable based on the true volume distribution, it only needs to be representative enough. Indeed, the error plots (Fig. 6, S3†) indicates that eqn (10) (for dvv) underestimated at lower concentrations and overestimated at higher concentrations, while eqn (19) (for dvva) gave results similar to the simulated values, with a little underestimation at higher concentrations.
Fig. 6 Maps of errors in using derived expressions to calculate standard errors of . The error is defined as . The calculated is the standard errors calculated using eqn (10) for the dvv method, and eqn (19) for the dvva method, averaged over different simulated assays of the same conditions, as specified by the volume distribution type, volume standard deviation, and input concentrations. The emprirical for each assay condition is the sample standard deviation of obtained by simulated assays. The simulation parameters are the same as those used to obtain Fig. 2. |
(23) |
Note that λLOD scales with 1/n and does not depend on the volume distribution. To verify this observation, we simulated limits of detection over different volume distribution types and standard deviations (details in the ESI†). Indeed, eqn (23) agrees well with results simulated over different n, σV values (0.01–5.01), and distribution types (empirical, gamma, lognormal, and truncated normal) (Fig. 7).
Fig. 7 Limits of detection of Λ. The plot shows the relationship between the limit of detection, ΛLOD, and the number of compartments per assay, n (100–10000), when the mean volume is a constant (μV = 1). The points indicate simulated ΛLOD at different σV values (0.01–5.01), with different volume distributions (empirical, gamma, lognormal, and truncated normal). The white curve represents the analytical expression (eqn (23)). Note that at each n value, many points representing different volume distributions cluster at the white curve. |
According to previously published results, the volmod method was expected to be compatible with any volume distribution.18 Surprisingly, it was found to be inaccurate at larger volume standard deviations (Fig. 2). A possible reason for this discrepancy was how the method is implemented. The published implementation includes user-determined parameters such as the number of volumes to be simulated, and the number of iterations. Default values were used in this paper. Future investigation in how volmod is implemented would be useful. An additional motivation for such investigation is that the volmod implementation in R is about 3 orders of magnitude slower than the dvva implementation in Python described herein (Fig. S5†).
Even though other methods (Table 2) may not be as accurate as the dvv and dvva methods in some cases (Fig. 1 and 2), calibration can be performed when using them, as previously suggested.15 For example, curves of versus Λ with biases are monotonically increasing, implying the possibility of calibration (Fig. 1). If the volume distribution is well approximated by functions specified by a few parameters (such as a gamma function), the calibration can be simpler than generally recognized.15 If the volume distribution cannot be simply described by a few parameters, many experiments have to be performed. In such case, depending on the specific scenarios, one needs to choose between having larger numbers of experiments (for calibration) and adding the capability of volume measurements.
Second, the analysis of the LOD revealed an important insight about assay systems with variable volumes. The finding that the LOD does not depend on the volume distribution, and only scales with 1/Vtotal (or 1/n when μV is a constant) (eqn (23)) indicates that the assay sensitivity is not affected by volume variation. This implies that for detection purposes, any method of compartmentalization can be employed without concerns about volume precision or trueness, even when compartments are droplets with really wide volume distributions.13,14
Third, whether the main goal is sensitive detection, quantification, or both, digital assays can now be performed without complex and expensive microfluidic devices. This development enables the design of digital assays geared toward resource-limited settings. The total addressable volume can consequentially be increased to achieve better sensitivity (eqn (23)) and mitigate the noise due to volume variation.
Another possible experimental error is the variation in the signal intensity, which has been observed in many digital PCR experiments.30–34 Such error would change the number of terms in the left hand side of eqn (9) (for dvv) and the a/n ratio in eqn (9) (for dvva). In both cases, if the errors are not systematic, their effects on different compartments may partially cancel each other out. However, it would still be better to apply clustering techniques to better distinguish ON and OFF compartments as previously suggested.30–34 Furthermore, an alternative is to use the likelihood of observing a certain signal intensity (instead of an ON/OFF response like in eqn (4)) as a function of the compartment volume and the bulk concentration, and apply a similar maximum likelihood estimation framework as described herein. In such case, however, the assay requires the instrument to measure intermediate signal intensities and is no longer digital.
Footnote |
† Electronic supplementary information (ESI) available: Extra figures referred to in the main text. A zip file containing code and raw data. See DOI: 10.1039/C9AN01479A |
This journal is © The Royal Society of Chemistry 2019 |