Synergistic antiviral effect of curcumin functionalized graphene oxide against respiratory syncytial virus infection

Xiao Xi Yang a, Chun Mei Li a, Yuan Fang Li b, Jian Wang *a and Cheng Zhi Huang *ab
aKey Laboratory of Luminescent and Real-Time Analytical Chemistry (Southwest University), Ministry of Education, College of Pharmaceutical Science, Southwest University, Chongqing 400715, China. E-mail: wj123456@swu.edu.cn; chengzhi@swu.edu.cn; Fax: +86 23 68866796; Tel: +86 2368254059
bChongqing Key Laboratory of Biomedical Analysis (Southwest University), Chongqing Science & Technology Commission, College of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, China

Received 1st September 2017 , Accepted 19th September 2017

First published on 20th September 2017


The diseases attributable to viruses remain a global burden. The respiratory syncytial virus (RSV), which is considered as the major viral pathogen of the lower respiratory tract of infants, has been implicated in severe lung disease. In this contribution, we developed a β-cyclodextrin (CD) functionalized graphene oxide (GO) composite, which displayed excellent antiviral activity and could load curcumin efficiently. RSV, a negative-sense single-stranded enveloped RNA virus, was employed as a model virus to investigate the antiviral activity of multifunctional GO. Proved by the tissue culture infectious dose assay and immunofluorescence assay, the curcumin loaded functional GO was confirmed with highly efficient inhibition for RSV infection and great biocompatibility to the host cells. The results showed that the composite could prevent RSV from infecting the host cells by directly inactivating the virus and inhibiting the viral attachment, and possessed prophylactic and therapeutic effects towards the virus. Our data indicate that the composite may provide new insights into antiviral therapy for RSV infection.


1. Introduction

Viruses are obligate intracellular parasites that consist of infection virion particles, and lack independent replicative capacity, which must instead hijack the replication machinery of infected cells.1 Furthermore, viral infection is an ever-present great threat to human beings worldwide.2 Effective prevention and treatment of viral infection is imperative. With the rapid development of nanotechnology, nanomedicine enables unique diagnostic and therapeutic capabilities to tackle problems in clinical medicine. In addition, nanomaterials show great potential due to their excellent and unique properties.1,3 Numerous nanomaterials have been increasingly adopted to treat bacterial and fungal infection in clinical settings; however, the applications of nanomaterials against viral infection remain sparse and exploratory.4,5

As one member of the Paramyxoviridae family, the respiratory syncytial virus (RSV), a negative-sense and single-stranded enveloped RNA virus 150 nm in diameter, is a major respiratory pathogen for newborn infants and young children,6 which can cause upper and lower respiratory illness in the elderly and immunocompromised individuals as well.7 Therefore, simple and specific methods for the early diagnosis of RSV and effective treatments against RSV infections are of great significance. Up to now, the antibody palivizumab (Respigam™ and Syngis™) has been approved for human beings;8,9 however, it is limited due to the risk of transmission of blood-borne pathogens and relatively high cost. Meanwhile, only ribavirin is licensed as an antiviral drug for treating severe RSV infection.10 So developing cheap, safe and effective antiviral reagents for RSV infection is urgently needed. Our group has established a series of rapid and sensitive detection, tracking and imaging procedures for RSV.11–15 Besides, we have fabricated DNA conjugated gold nanoparticle networks on host cell membranes as a protective barrier, and established curcumin functionalized AgNPs with benign antiviral activity.13,16 In this work, we try to develop a novel curcumin loaded graphene oxide (GO) multifunctional nanomaterial composite with excellent biocompatibility, which can interfere with the interaction between RSV and the host cells, and thus inhibit RSV infection.

GO is a two-dimensional crystal structure formed by carbon atoms arranged in a hexagonal lattice. As is well known, GO and its derivatives have been widely reported for their antimicrobial properties owing to their high surface-to-volume ratio and unique chemical and physical properties. It has been reported that GO and its derivatives exhibit benign inhibition activity against bacteria, fungi and viruses,17–19 which is possibly related to the mechanism that GO can destroy bacterial membranes by the direct inorganic−biomolecule interactions. Sarid's group reported that GO and reduced sulfonated GO presented antiviral activity against HSV-1 infection through cell attachment inhibition.20 Furthermore, He's group found that GO displayed broad-spectrum antiviral activity against the pseudorabies virus (PRV, a DNA virus) and the porcine epidemic diarrhea virus (PEDV, an RNA virus) through inactivating viruses directly.21 However, to date, the potential antiviral activity of GO against RSV infection is still unexplored.

Curcumin, as a natural polyphenol, is isolated from the rhizomes of the perennial herb Curcuma longa and holds various functions including antioxidant, antifungal, antibacterial, anti-inflammatory, and antiviral.22,23 This polyphenolic compound has gained significant attention due to a variety of biological activities and low toxicity.24 For instance, Kojima's group reported that curcumin could prevent the replication and budding of RSV.25 However, the poor solubility in water and low bioavailability of curcumin greatly confine its applications in clinics.26

Thus, in order to take advantage of GO and improve the bioavailability of curcumin, we synthesized β-cyclodextrin (β-CD) functionalized GO, which held benign antiviral activity and functioned as a carrier to load curcumin efficiently.22,27,28 The introduction of sulfonate groups to the functionalized GO surface can mimic the cell's surface and inhibit RSV infection through a competitive inhibition mechanism. The synergistic antiviral activity is due to the nanomaterials themselves and the drug curcumin. Additionally, the possible mechanism for the multifunctional composite against virus infection was explored. Biological studies in vitro revealed that the new multifunctional composite exhibited a very strong antiviral activity against RSV infection and might be used as novel nanomedicine in the treatment of RSV infection (Scheme 1).


image file: c7nr06520e-s1.tif
Scheme 1 Schematic representation of work principle. (A) The synthesis of functional nanomaterial composite; (B) the proposed inhibition mode of functional nanomaterial composite against RSV infection.

2. Experimental

2.1 Materials

Curcumin and β-CD were purchased from Aladdin, and GO was obtained from Nanjing XFNano Material Tech Co., Ltd (Nanjing, China). Sodium carbonate (Na2CO3), p-aminobenzene sulphonamide and sodium nitrite (NaNO2) were supplied by Chengdu Kelong Chemical Co., Ltd (Chengdu, China). Sodium borohydride (NaBH4) was offered by Tianjin Huanwei Chemical Co., Ltd (Tianjin, China). Hydrochloric acid (HCl) and ammonium hydroxide (NH3·H2O) were purchased from Chongqing Chuandong Chemical Co., Ltd (Chongqing, China). Human laryngeal epithelial type 2 (HEp-2) cells were commercially obtained from Xiangya School of Medicine (Changsha, Hunan), and RSV was commercially available from Guangzhou Biotest Biological Technology Co., Ltd. The Cell Counting Kit-8 (CCK-8) reagent was purchased from Dojindo (Kumanmoto, Japan). RPMI 1640 medium was bought from Hyclone (USA) and fetal bovine serum (FBS) was commercially obtained from GIBCO (USA). TRizol reagent was obtained from Life Technologies (Carlsbad, USA). The iScript™ cDNA synthesis kit and iQ™ SYBR Green Supermix were commercially available from Bio-Rad (California, USA).

2.2 Apparatus

UV-vis absorption and infrared spectra were acquired using a Hitachi U-3100 UV-vis spectrometer (Tokyo, Japan) and a Shimadzu FTIR-8400S Fourier transform infrared (FTIR) spectrophotometer (Kyoto, Japan), respectively. Raman spectra were recorded with a LabRam HR 800 spectrometer (HORIBA Jobin Yyon, France). A Malvern dynamic light scattering (DLS) Nano-ZS Zetasizer (England) was used to measure the size and ζ-potential. A Biotek Microplate Reader (USA) was used to measure the optical density of the solution at 450 nm for the cytotoxicity test. Immune-fluorescence imaging was performed with an Olympus IX81 microscope with a 60× objective (Tokyo, Japan). The gene expression levels of cytokines were detected by a Bio-Rad iCycler Thermal Cycler w/iQ5 Optical Module for real-time polymerase chain reaction (PCR, California, USA).

2.3 Preparation of the functionalized graphene oxide

All glassware were thoroughly cleaned with chromic acid before use. Functionalized GO was prepared as follows: 15.0 mg of GO powder was dissolved in 15.0 mL of water, followed by ultrasonication for 1 h, which yielded a homogeneous yellow-brown dispersion of GO (1.0 mg mL−1). Then, the solution pH was adjusted to 9–10 with 5% Na2CO3 solution, followed by the addition of a certain amount of NaBH4. The mixture was stirred for 1 h at 80 °C and then centrifuged to obtain the black precipitate, which was washed repeatedly with water and finally resuspended in 15.0 mL water. Then, 2.0 mL of diazonium solution (9.2 mg of sulfanilic acid, 3.6 mg of sodium nitrite and 100.0 μL of 1 M HCl solution) was added to the suspension, which was continuously stirred for 2 h in an ice-water bath. The product was filtered with a 0.22 μm dialysis membrane; the product was washed several times with water and finally dried under vacuum at 60 °C. The obtained black powder was the reduced sulfonated GO (GO-SO3, GS).

Next, 5.0 mg of the as-prepared GS powder, 80.0 mg of β-CD and 50.0 mL of water were placed in a beaker, followed by ultrasonication for 30 min. Subsequently, 40.0 μL of ammonia solution was injected into the mixture. After vigorous stirring for 3 min at room temperature, the whole solution was allowed to reflux at 80 °C for 2 h with constant stirring. The as-formed dispersion was dialyzed against water to remove the superfluous β-CD and ammonia solution. Finally, the β-CD functionalized sulfonated graphene (GO-SO3-CD, GSC) was obtained after freeze-drying.

2.4 Preparation of curcumin-loaded GSC

To load curcumin into the GSC composite, different concentrations of curcumin in DMSO was added to equal amounts of GSC dispersion, and then the mixture was sonicated in the dark for 30 min and then centrifuged to obtain the precipitate, which was washed with water to gain the curcumin-loaded GSC composite (GSCC). The loading efficiency of curcumin into GSC was measured by using a UV/vis spectrophotometer at 422 nm.

2.5 Cytotoxicity assay

Cytotoxicities of the functionalized GSC and curcumin were assessed using a CCK-8 cell viability assay. First, approximately 1.0 × 104 HEp-2 cells per well were seeded in a 96-cell plate and cultured with RPMI 1640 medium containing 2% FBS. After 24 h of incubation in a humidified incubator with 5% CO2 at 37 °C, the medium was removed from each well, and HEp-2 cells were washed with phosphate buffered saline (PBS, pH 7.4). Then, sample solutions (series concentrations of GSC and curcumin) or the control solutions were added and incubated with cells for 24 h to 72 h. After that, the culture medium was replaced with the CCK-8 reagent and incubated for another 0.5 h at 37 °C. Finally, the optical density at 450 nm was measured with a Biotek Microplate Reader. The viability of cells was expressed as the percentage of the untreated cells (100%).

2.6 Antiviral activity assay

The processes of viruses invading host cells include attachment, endocytosis, replication and exocytosis. Each stage of virus infection may be a possibility for inhibition. In order to evaluate the antiviral properties of GSCC, four separate treatment conditions were performed: (1) virus pre-treatment assay; (2) co-treatment assay; (3) cell pre-treatment assay; and (4) cell post-treatment assay. 8.0 × 104 HEp-2 cells per well were planted in a 24-well plate and incubated for 24 h. The virus pre-treatment assay was performed by incubating RSV with GSCC for 1 h, and then infecting HEp-2 cells at 37 °C for 2 h. However, the co-treatment assay was performed as follows: RSV infected HEp-2 cells in the presence of GSCC at 37 °C for 2 h. The cell pre-treatment assay was carried out by incubating HEp-2 cells with GSCC at 37 °C for 1 h, then washing cells with PBS and infecting by RSV. The cell post-treatment assay was determined by firstly incubating HEp-2 cells with RSV for 2 h at 37 °C without GSCC. Following the virus adsorption period, HEp-2 cells were treated with the series of GSCC for another 2 h at 37 °C. After the above treatments, cells were washed with PBS to remove non-adherent viruses and GSCC, and further incubated with RPMI 1640 (containing 2% FBS) at 37 °C. For all the treatments, negative (HEp-2 cells only) and positive (HEp-2 cells infected with RSV) controls were set as well. When the cytopathic effect (CPE) appeared, HEp-2 cells were repeatedly frozen and thawed three times to release the virus. Then, the harvested viruses were used for viral titer assays.

2.7 Viral titer assays

A tissue culture infectious dose (TCID50) test was performed to determine the viral titers of RSV. HEp-2 cell monolayers were seeded at 1.2 × 104 cells per well in 96-well plates and cultured for 24 h before infection. Serial 10-fold dilutions of the separately harvested RSV were prepared in serum-free medium, and 0.3 mL of the RSV solution was used to infect cells for 2 hours at 37 °C. After that, the viruses were aspirated from each well, and 100 μL of RPMI 1640 medium with 2% FBS was added. The plates were incubated at 37 °C with 5% CO2 for 7 days. Then, 50 μL of 2.5% glutaraldehyde and 0.05% Neutral Red in PBS replaced the growth medium to stain live cells. The final value of TCID50 was calculated according to the Reed–Muench formula.

2.8 Indirect immunofluorescence assay

The antiviral properties of GSCC against RSV infection were further evaluated by an immunofluorescence assay. 1.0 × 105 HEp-2 cells per well were cultured in 35 mm glass-bottom cell culture dishes (NEST Corp.) for 24 h. The four species of treatments were coincident with that of the antiviral activity assay. After discarding the non-adherent virions and GSCC, HEp-2 cells were fixed with 4% paraformaldehyde for 30 min at room temperature, which was followed by blocking with 2% bovine serum albumin for 1 h at 37 °C. After blocking the nonspecific binding sites, the cells were incubated with a mouse monoclonal antibody against RSV G protein for 1.5 h at 37 °C, followed by incubation with Dylight 488-conjugated goat anti-mouse IgG for another 45 min at 37 °C. Finally, cells were stained with Hoechst 33258 (1 μg mL−1) for 10 min and then washed three times with ice-cold PBS after each step. Fluorescent images were acquired using an Olympus IX-81 inverted microscope equipped with an Olympus IX2-DSU confocal scanning system and a Rolera-MGi EMCCD. Image analysis was performed with Image-Pro Plus software.

2.9 Real-time PCR detection of RSV G levels

Cells were harvested at 24 and 48 h after RSV infection and the total RNA was extracted using the TRizol reagent according to the manufacturer's protocol. RNA integrity was verified by 1% agarose electrophoresis and captured with a gel imaging system. Then, RNA was reverse-transcribed into cDNA, according to the manufacturer's recommendations, using an iScript™ cDNA synthesis kit. Real-time PCR detection was performed using an iQ™ SYBR Green Supermix with a Bio-Rad iQ5 real-time PCR system. The PCRs were amplified under cycling conditions as follows: 95 °C for 5 min and 40 cycles (30 s at 95 °C, 30 s at 60 °C and 45 s at 72 °C) in triplicate. The sequences of primer pairs are listed in Table 1. The mRNA expression levels of the RSV G protein were semi-quantitatively determined and normalized to the expression of the housekeeping gene β-actin.
Table 1 The sequences of primer pairs
Gene name Sequences
Forward Reverse
β-Actin CGCGAGAAGATGACCCAGATC CATGAGGTAGTCAGTCAGGTCCC
RSV G TGGGTCACTCTTAATCAT TGATTCCAACCTGAGGAT


2.10 Statistical analysis

Experimental data were presented as the mean ± standard deviation (SD) of the mean. The t-test (Prism 5 statistical and graphing software) was used for the data analysis. P < 0.05 was considered to indicate a statistically significant difference.

3. Results and discussion

3.1 Characterization of functional materials

UV-vis spectroscopy was used to confirm the formation of functionalized GO. As shown in Fig. 1(a), the typical UV-vis absorption peak of GO is at 230 nm, which is owing to the π–π* transition of aromatic C[double bond, length as m-dash]C bonds.22,27,28 And the absorption peak shifts to 246 nm after the introduction of a new sulfonate-containing moiety (sulfanilic acid) to GO.20 After functionalization with β-CD, the maximum absorption peak finally shifts to 258 nm.20 The evidence of the modification process was also demonstrated by the solution color changing from brown to black. The presence of sulfonated groups was confirmed by elemental analysis, which indicated an average of 2.9% sulphur content in GS (Table S1).
image file: c7nr06520e-f1.tif
Fig. 1 Characterization of the functional materials. (a) UV-vis absorption spectra of GO, GS and GSC. (b) Raman spectra of GO, GS and GSC.

Raman spectroscopy is known as an efficient method to examine the ordered crystal structures of carbonaceous materials. The Raman spectra of graphene-based nanomaterials are presented in Fig. 1b. The characteristic bands in the Raman spectra of GO are located at 1348 cm−1 and 1615 cm−1, corresponding to the D band and the G band,20,21,27 which respectively shift to 1326 cm−1 and 1575 cm−1 after modification.

The FTIR spectra of GO (Fig. 2) show a strong and broad peak at about 3450 cm−1 attributable to the O–H group stretching vibration.20 And the peak at 1635 cm−1 belongs to the bending vibration of aromatic C[double bond, length as m-dash]C.28 In the FTIR spectrum of the pure β-CD, the absorption peak at around 3370 cm−1 corresponds to the stretching vibration of O–H and the peak at 2925 cm−1 is indexed to the stretching vibration of C–H. The absorption peak at about 1030 cm−1 for the C–O–C stretching vibration of β-CD is observed.29 Meanwhile, the C–O–C stretching vibration is also detectable in GSC, confirming the successful attachment of β-CD onto the functionalized GO.


image file: c7nr06520e-f2.tif
Fig. 2 FTIR spectra of GO, β-CD and GSC.

The GO sheets displayed a negative ζ-potential of −23.0 mV, indicating the presence of negatively charged groups in the GO structure. After functionalization, the ζ-potential of GSC was slightly less negative (−19.4 mV) than that of GO. Moreover, the size increased from 109.6 nm to 127.7 nm (Table S2), further suggesting the successful preparation of GSC.

3.2 Cytotoxicity of GSC and curcumin

To investigate the potential cytotoxicity of GSC and curcumin, we used the CCK-8 assay to evaluate the viability of HEp-2 cells incubated with a series concentration of GSC and curcumin for 24 h to 72 h. As shown in Fig. 3a, GSC presented excellent biocompatibility. Cell viability was more than 95% when the concentration of GSC was in the range of 0.3–5.0 μg mL−1 after incubation at 37 °C for 24 h, 48 h and 72 h, respectively. And more than 85% cells remained unaffected by 10.0 μg mL−1 GSC even when the incubating time was as much as 72 h. The cytotoxicity of curcumin is shown in Fig. 3b, which did not present an obvious cytotoxic effect when the concentration of curcumin was up to 21.6 μM, but slight cytotoxicity of curcumin was observed when the concentration was 27 μM after incubation for 48 h and 72 h.
image file: c7nr06520e-f3.tif
Fig. 3 Biocompatibility of GSC and curcumin with HEp-2 cells: (a) HEp-2 cells incubated with GSC at a concentration ranging from 0.3 to 10 μg mL−1 for 24 h, 48 h and 72 h; (b) HEp-2 cells were exposed to different concentrations of curcumin ranging from 2.7 μM to 27.0 μM for 24 h, 48 h and 72 h. Each test was performed in triplicate; the error bar represents the standard deviation.

3.3 Characterization of curcumin-loaded GSC

GSC was prepared by conjugating β-CD as a drug carrier on the surface of GS; then curcumin could be embedded into the inner hydrophobic cavity of β-CD. Furthermore, curcumin could be loaded onto the surface of GO with π–π stacking interaction.22 The loading efficiency of curcumin into GSC was measured by comparison of UV absorption between the curcumin solution for incubation with GSC and the supernatant after purification by high-speed centrifugation. The approximate loading efficiency of curcumin was 65% (Fig. S1 and S2). Additionally, the size distribution and the potential of GSCC were investigated by DLS measurement (Table S2). With systematic modification, the particle size of the nanocomposite increased gradually.

3.4 GSCC exhibits antiviral activity against RSV

To understand the pathway of GSCC to block RSV infection, different addition modes of GSCC to HEp-2 cells were performed. In general, virus infection is initiated by virus attachment to the receptors on the host cell surface. The membrane-bound cell receptors are typically proteins or glycans, and thus developing strategies to block virus attachment by decoy receptors is a promising antiviral approach. Taking into account that RSV can utilize heparin sulphate (HS) for attachment or entry, it is supposed that sulfonic acid functionalized GO can mimic HS to prevent virus from attaching on the cell surface and enhance the GO−virus interactions.20 As shown in Fig. 4, GSCC could reduce the viral titers of RSV with virus pre-treatment and co-addition treatment assays. Incubation of RSV with different concentrations of GSCC prior to infection showed a dose-dependent virus inactivation by GSCC (Fig. 4a). 1.25 μg mL−1 GSCC could reduce the viral titers significantly. However, when the dose of GSCC was up to 2.50 μg mL−1, the viral titers could not be detectable, indicating that the virus had lost the ability to infect cells. It was found that GSCC could decrease four orders of magnitude in viral titers. When HEp-2 cells were infected by RSV in the presence of GSCC, the viral titers of RSV decreased gradually with the enhanced amount of GSCC (Fig. 4b).
image file: c7nr06520e-f4.tif
Fig. 4 Antiviral properties of GSCC. The viral titers of RSV were investigated under four treatment conditions: (a) virus pre-treatment; (b) co-incubation treatment; (c) cell pre-treatment; (d) cell post-treatment.

To investigate the possibility of blocking cellular receptors with GSCC, HEp-2 cells were incubated with different concentrations of GSCC prior to infection. From the result (Fig. 4c), it was found that the viral titers decreased significantly and the decrease was dose-dependent. The viral titers could not be measurable when the amount of GSCC was 5.00 μg mL−1. While HEp-2 cells had been infected with RSV, the viral titers of the harvest progeny virus were also reduced obviously with the post-infection treatment of GSCC (Fig. 4d). Importantly, 5.00 μg mL−1 GSCC could cause the virus to lose infection ability.

The above results suggested that GSCC indeed possessed excellent antiviral activity against RSV infection. In the present study, it was demonstrated that GSCC significantly inhibited RSV infection by inactivating RSV directly prior to entry into the host cells. Moreover, GSCC could inhibit the attachment of RSV by mimicking HS to present on the host cell surface. In addition, GSCC owned benign prophylactic and therapeutic effects against RSV infection.

3.5 Immunofluorescence analysis for the inhibitory effects of GSCC on RSV infection

The indirect immunofluorescence assay with antibody to virus was considered as a useful diagnostic technique. A monoclonal antibody was specific to the G protein of RSV, and Dylight 488-conjugated goat anti-mouse IgG (second antibody) was used to observe the fluorescence signal. In Fig. 5, the nuclei were stained with Hoechst 33258 (blue) and the RSV G proteins were marked with green color. There was no green fluorescence in the control group (the first row in Fig. 5), while HEp-2 cells infected by RSV presented obvious green fluorescence around the cell membrane (the second row in Fig. 5). The green fluorescence signal could not be almost observed when RSV was pre-treated with GSCC prior to infection (the third row in Fig. 5). When HEp-2 cells were infected with RSV in the presence of GSCC, the green fluorescence was much weaker than that in the RSV-infected group (the fourth row in Fig. 5), indicating that GSCC could block the viral adsorption.
image file: c7nr06520e-f5.tif
Fig. 5 The inhibition effects of GSCC against RSV infection in virus pre-treatment and co-addition treatment by immunofluorescence staining (60× oil immersion objective). The first row: HEp-2 cells only; the second row: HEp-2 cells infected by RSV; the third row: RSV interacted with GSCC for 1 h prior to infecting HEp-2 cells; the fourth row: HEp-2 cells co-incubated with RSV and GSCC.

In the cell pre-treatment assay, HEp-2 cells were pre-treated with GSCC, followed by RSV attachment and further incubation to allow the penetration of virus into the cells. After 24 h of cultivation, the progeny viruses were abundantly produced. Therefore, a strong green fluorescence signal was observed around the cells in the positive control group (the second row in Fig. 6). In contrast, the fluorescence intensity was much weaker when HEp-2 cells were pre-treated with GSCC prior to RSV infection than in the case of the RSV-infecting group (the third row in Fig. 6), indicating that GSCC could inhibit the attachment of RSV. In addition, if the host cells had been infected with RSV, cells post-treatment with GSCC were able to attenuate the green fluorescence signal significantly (the fourth row in Fig. 6). That is, GSCC had prophylactic effects against RSV infection.


image file: c7nr06520e-f6.tif
Fig. 6 The inhibition effects of GSCC against RSV infection by immunofluorescence staining (60× oil immersion objective). The first row: HEp-2 cells only; the second row: HEp-2 cells infected by RSV; the third row: HEp-2 cells pre-incubated with GSCC for 1 h before RSV infection; the fourth row: GSCC was added after RSV infection. The cells were incubated for 24 h after RSV infection.

These results further demonstrated the efficient antiviral activity of GSCC against RSV infection. Thus, it could be concluded that GSCC played an effective role in inactivating RSV prior to entry into the cells. Meanwhile GSCC could inhibit RSV attachment and had prophylactic effects against RSV infection.

3.6 The effect of GSCC on RSV G protein

As an envelope glycoprotein of RSV, the G protein is responsible for virus attachment with the target cell membrane. It has been reported that nanomaterials could interact with viral genes;30–33 thus the effect of GSCC on the RSV G protein was tested. The expression levels of the G protein could indicate the amplification of the virus indirectly. As shown in Fig. 7, the expression of the G protein increased with prolonging the infection time. When RSV was pre-treated by GSCC, the viral G protein expression was reduced significantly relative to that of HEp-2 cells infected with RSV. When HEp-2 cells had been infected by RSV, the cells post-treatment with GSCC could also reduce viral G protein expression.
image file: c7nr06520e-f7.tif
Fig. 7 The gene expression of RSV G protein in HEp-2 cells after RSV infection. No treatment: HEp-2 cells infected with RSV; pre-treatment: RSV was inactivated by GSCC for 1 h, then infected HEp-2 cells; post-treatment: HEp-2 cells infected with RSV, then incubated with GSCC. β-Actin served as an internal reference. Data were expressed as mean ± SD (n = 3).

4. Conclusions

In the present study, we developed a novel functional nanomaterial, which was composed of curcumin and β-CD functionalized GO. The antiviral activity of GSCC against RSV infection was dose-dependent, which was investigated with the TCID50 assay and the immunofluorescence assay. Moreover, GSCC could inactivate RSV prior to infection efficiently. Furthermore, GSCC had benign antiviral activity in the prevention of viral infection and after the viral infection. The decline in the range of viral titers could reach up to four orders of magnitude. There are three possible mechanisms for GSCC inhibiting RSV infection, including directly inactivating RSV, inhibition of the attachment of virus onto host cells and interfering with virus replication. GSCC will allow us to develop a novel strategy to inhibit RSV infections. Meanwhile, the benign antiviral activity of the multifunctional nanocomposite may provide new insights into novel virucide development.

Conflicts of interest

There are no conflicts to declare.

Acknowledgements

This work was financially supported by the National Natural Science Foundation of China (NSFC, 21535006).

Notes and references

  1. J. A. Jackman, J. Lee and N.-J. Cho, Small, 2016, 12, 1133–1139 CrossRef CAS PubMed.
  2. S. Galdiero, A. Falanga, M. Vitiello, M. Cantisani, V. Marra and M. Galdiero, Molecules, 2011, 16, 8894–8918 CrossRef CAS PubMed.
  3. L. M. Bimbo, O. V. Denisova, E. Mäkilä, M. Kaasalainen, J. K. De Brabander, J. Hirvonen, J. Salonen, L. Kakkola, D. Kainov and H. A. Santos, ACS Nano, 2013, 7, 6884–6893 CrossRef CAS PubMed.
  4. C. Li, X. Wang, F. Chen, C. Zhang, X. Zhi, K. Wang and D. Cui, Biomaterials, 2013, 34, 3882–3890 CrossRef CAS PubMed.
  5. Y. Tian, J. Qi, W. Zhang, Q. Cai and X. Jiang, ACS Appl. Mater. Interfaces, 2014, 6, 12038–12045 CAS.
  6. S. Krishnan, M. Halonen and R. C. Welliver, Viral Immunol., 2004, 17, 220–233 CrossRef CAS PubMed.
  7. J. Zhu, J.-J. Li and J.-W. Zhao, J. Nanopart. Res., 2012, 14, 864–868 CrossRef.
  8. S. S. Bawage, P. M. Tiwari, S. Pillai, V. Dennis and S. R. Singh, Adv. Virol., 2013, 2013, 595768 Search PubMed.
  9. T. F. Feltes, A. K. Cabalka, H. C. Meissner, F. M. Piazza, D. A. Carlin, F. H. Top, E. M. Connor and H. M. Sondheimer, J. Pediatr., 2003, 143, 532–540 CrossRef CAS PubMed.
  10. S. M. Bueno, P. A. González, C. A. Riedel, L. J. Carreno, A. E. Vásquez and A. M. Kalergis, Immunol. Lett., 2011, 136, 122–129 CrossRef CAS PubMed.
  11. L. L. Zheng, X. X. Yang, Y. Liu, X. Y. Wan, W. B. Wu, T. T. Wang, Q. Wang, S. J. Zhen and C. Z. Huang, Chem. Commun., 2014, 50, 15776–15779 RSC.
  12. L. Zhan, C. M. Li, W. B. Wu and C. Z. Huang, Chem. Commun., 2014, 50, 11526–11528 RSC.
  13. X. X. Yang, C. M. Li and C. Z. Huang, Nanoscale, 2016, 8, 3040–3048 RSC.
  14. L. L. Zheng, C. M. Li, S. J. Zhen, Y. F. Li and C. Z. Huang, Nanoscale, 2017, 9, 7880–7887 RSC.
  15. X. Y. Wan, L. L. Zheng, P. F. Gao, X. X. Yang, C. M. Li, Y. F. Li and C. Z. Huang, Sci. Rep., 2014, 4, 4529 CrossRef PubMed.
  16. C. M. Li, L. L. Zheng, X. X. Yang, X. Y. Wan, W. B. Wu, S. J. Zhen, Y. F. Li, L. F. Luo and C. Z. Huang, Biomaterials, 2016, 77, 216–226 CrossRef CAS PubMed.
  17. F. Perreault, A. F. de Faria, S. Nejati and M. Elimelech, ACS Nano, 2015, 9, 7226–7236 CrossRef CAS PubMed.
  18. X. Zou, L. Zhang, Z. Wang and Y. Luo, J. Am. Chem. Soc., 2016, 138, 2064–2077 CrossRef CAS PubMed.
  19. Z. Song, X. Wang, G. Zhu, Q. Nian, H. Zhou, D. Yang, C. Qin and R. Tang, Small, 2015, 11, 1171–1176 CrossRef CAS PubMed.
  20. M. Sametband, I. Kalt, A. Gedanken and R. Sarid, ACS Appl. Mater. Interfaces, 2013, 6, 1228–1235 Search PubMed.
  21. S. Ye, K. Shao, Z. Li, N. Guo, Y. Zuo, Q. Li, Z. Lu, L. Chen, Q. He and H. Han, ACS Appl. Mater. Interfaces, 2015, 7, 21571–21579 CAS.
  22. D. N. Heo, W.-K. Ko, H.-J. Moon, H.-J. Kim, S. J. Lee, J. B. Lee, M. S. Bae, J.-K. Yi, Y.-S. Hwang, J. B. Bang, E.-C. Kim, S. H. Do and I. K. Kwon, ACS Nano, 2014, 8, 12049–12062 CrossRef CAS PubMed.
  23. J. Zhang, Y. C. Liang, X. Lin, X. Zhu, L. Yan, S. Li, X. Yang, G. Zhu, A. L. Rogach and P. K. N. Yu, ACS Nano, 2015, 9, 9741–9756 CrossRef CAS PubMed.
  24. M. Zheng, S. Liu, X. Guan and Z. Xie, ACS Appl. Mater. Interfaces, 2015, 7, 22181–22187 CAS.
  25. K. Obata, T. Kojima, T. Masaki, T. Okabayashi, S. Yokota, S. Hirakawa, K. Nomura, A. Takasawa, M. Murata, S. Tanaka, J. Fuchimoto, N. Fujii, H. Tsutsumi, T. Himi and N. Sawada, PLoS One, 2013, 8, 70225–70239 Search PubMed.
  26. P. Anand, A. B. Kunnumakkara, R. A. Newman and B. B. Aggarwat, Mol. Pharm., 2007, 4, 807–818 CrossRef CAS PubMed.
  27. Y. J. Guo, S. J. Guo, J. T. Ren, Y. M. Zhai, S. J. Dong and E. K. Wang, ACS Nano, 2010, 4, 4001–4010 CrossRef CAS PubMed.
  28. H. Dong, Y. Li, J. Yu, Y. Song, X. Cai, J. Liu, J. Zhang, R. C. Ewing and D. Shi, Small, 2013, 9, 446–456 CrossRef CAS PubMed.
  29. H. Hu, J. H. Xin, H. Hu, X. Wang and X. Lu, Molecules, 2014, 19, 7459–7479 CrossRef CAS PubMed.
  30. J. C. Trefry and D. P. Wooley, J. Biomed. Nanotechnol., 2013, 9, 1624–1635 CrossRef CAS PubMed.
  31. X. Hang, H. Peng, H. Song, Z. Qi, X. Miao and W. Xu, J. Virol. Methods, 2015, 222, 150–157 CrossRef CAS PubMed.
  32. N. Khandelwal, G. Kaur, N. Kumar and A. Tiwari, Dig. J. Nanomater. Bios., 2014, 9, 175–186 Search PubMed.
  33. N. Chen, Y. Zheng, J. Yin, X. Li and C. Zheng, J. Virol. Methods, 2013, 193, 470–477 CrossRef CAS PubMed.

Footnote

Electronic supplementary information (ESI) available. See DOI: 10.1039/c7nr06520e

This journal is © The Royal Society of Chemistry 2017