Pepsin egg white hydrolysate modulates gut microbiota in Zucker obese rats

Abstract

There is limited information that relates the intake of food-derived bioactive peptides and the gut microbiota. We have previously described a pepsin hydrolysate of egg white (EWH) that ameliorates fat accumulation and dyslipidemia, while reducing oxidative stress and inflammation markers in obese Zucker rats. The aim of this study was to associate the beneficial effects of EWH with gut microbiota changes in these animals. Obese Zucker rats received daily 750 mg kg⁻¹ EWH in drinking water for 12 weeks and faeces were analysed for microbial composition and metabolic compounds in comparison with Zucker lean rats and obese controls. EWH supplementation modulated the microbiological characteristics of the obese rats to values similar to those of the lean rats. Specifically, counts of total bacteria, Lactobacillus/Enterococcus and Clostridium leptum in EWH fed obese Zucker rats were more similar to the lean rats than to the obese controls. Besides, feeding the obese Zucker rats with EWH reduced (P < 0.05) the faecal concentration of lactic acid. The physiological benefits of EWH in the improvement of obesity associated complications of Zucker rats could be associated with a more lean-like gut microbiota and a tendency to diminish total short-chain fatty acids (SCFA) production and associated obesity complications. The results warrant the use of pepsin egg white hydrolysate as a bioactive food ingredient.

---

1. Introduction

The potential of dietary modifications using specific ingredients to control energy metabolism and/or modify body weight has been documented.¹ Also, dietary components are described to modulate the multiple clinical complications associated with obesity, including insulin resistance, hypertension, inflammation, oxidative stress and dyslipidemia.² Appetite suppression, lipid metabolism regulation and increase of energy expenditure are the main mechanisms by which anti-obesity effects are exerted. Dietary proteins may influence body weight by affecting four targets: satiety, thermogenesis, energy efficiency and body composition.³ In particular, bioactive peptides derived from milk and marine sources have shown potential anti-obesity effects.^1,4,5

The obese Zucker rat, which presents a mutation of the leptin receptor (fa/fa), has been one of the most commonly used murine models to study obesity over the past three decades.⁶ Many of the metabolic features that characterize the obese Zucker rat when compared with Zucker lean (fa/+) or (+/+) phenotypes relate to energy metabolism and gut microbiota composition.⁷ Experiments with genetically obese (homozygous for an aberrant leptin gene, ob/ob) rodents showed more Firmicutes and correspondingly less Bacteroidetes in their gut compared with heterozygous (ob/+) or lean wild-type (+/+) animals,⁸ pointing out a potential link between the obese-phenotype and the gut microbiota. In fact, the gut microbiome ability to recover energy from the diet has been suggested to have a role in the obese host phenotype.⁹ However, as far as we know, there are no studies that relate the intake of food-derived peptides, the amelioration of symptoms associated to obesity-related metabolic dysfunctions and the gut microbiota. Only recently Monteiro et al. have reported that dietary whey proteins can preserve a balanced intestinal microbiota profile in mice consuming a high-fat diet.¹⁰

In a previous work, we carried out an in vitro screening of egg white hydrolysates produced with food-grade enzymes from different sources.¹¹ The results indicated that a hydrolysate of egg white with pepsin presents potential hypocholesterolemic properties, estimated as its bile acid binding capacity, prevents oxidative damage and can inhibit dipeptidyl peptidase IV, the enzyme responsible for the degradation of the incretin hormones that stimulate glucose-dependent insulin secretion. Moreover, this hydrolysate significantly ameliorates obesity-related fat accumulation, hepatic steatosis and dyslipidemia, reducing oxidative stress and inflammation markers in obese Zucker rats.¹² In the present work we aimed to evaluate whether the beneficial effects of the hydrolysate of egg white with pepsin could be associated with gut microbiota changes. For this purpose, we have assessed microbial composition and metabolic compounds in the faeces of these obese rats fed with egg white pepsin hydrolysate in comparison with lean and obese controls.

2. Materials and methods

2.1. Experimental protocol in Zucker rats

Twenty male 8 week-old Zucker fatty (fa/fa) rats, weighing 250–275 g, and ten 8 week-old male Zucker lean (+/+) rats, weighing 150–175 g, all purchased from Charles River Laboratories (Barcelona, Spain), were used in the study. The experimental design was published by Garcés-Rimón et al.¹² In brief, animals were housed in a conventional animal room in transparent cages (40 × 28 × 25 cm; n = 5 per cage) at a stable room temperature of 23 °C and 60% humidity on 12 h : 12 h light : dark cycles. From the 6^th week of the experimental period onwards, due to their severe overweight, the obese animals were redistributed in smaller groups (n = 2 per cage). The rats were fed ad libitum with a solid standard diet. The obese Zucker rats were randomly divided into two groups of ten animals that received for 12 weeks, as drinking fluids, tap water or egg white hydrolysed with pepsin (EWH). Preparation of EWH, as well as the peptide sequences contained in the hydrolysate, have been previously described by Garcés-Rimón et al.¹¹ Dose of EWH was 750 mg per kg per day dissolved in tap water. The lean Zucker rats received the standard diet and tap water until the 20^th week of life. At the end of the 12^th week of the experimental period, the animals were placed individually in metabolic cages and faeces were collected for 16 h, weighted and frozen at −80 °C until further analyses.

The experiments were designed and performed in accordance with the European and Spanish legislation on care and use of experimental animals (2010/63/EU; RD 53/2013), and were approved by the Ethics Committee of the University Rey Juan Carlos (Madrid, Spain).

2.2. DNA extraction and quantitative PCR (qPCR)

Faecal samples were thawed at room temperature, weighted (0.1 g) and suspended in 1 mL 0.1% peptone solution with 0.85% NaCl. The homogeneous faecal suspension was centrifuged at 12 000 rpm for 5 min at 4 °C. The pellets were used for DNA extraction and the supernatants were stored for short chain fatty acid (SCFA) and ammonium analyses. Bacterial DNA extraction was performed as described by Moles et al.¹³ Briefly, the pellet was resuspended in an extraction buffer that contained the lytic enzymes lysozyme (20 mg mL⁻¹) and lysostaphin (5 μg mL⁻¹), followed by mechanical lysis with glass beads and extraction with phenol/chloroform/isoamyl-alcohol. The DNA was precipitated by adding isopropanol and quantified using a NanoDropH ND-1000 UV spectrophotometer.

The quantitative microbiological analysis of samples was carried out by qPCR using SYBR green methodology in a ViiA7 Real-Time PCR System (Life Technologies, Carlsbad, CA, USA). Primers, amplicon size, and annealing temperature for the bacterial groups analysed are listed in Table 1. The targeted bacterial groups represent the predominant Gram-positive bacteria belonging to clostridial clusters XIVa and IV (Firmicutes) and Gram-negative bacteria related to Bacteroidetes. Other groups such as lactic acid bacteria, bifidobacteria and Akkermansia are commonly health-related bacteria. DNA from Escherichia coli DH5α, Lactobacillus plantarum IFPL935, Bifidobacterium breve 29M2 and Bacteroides fragilis DSM2151 was used for quantification of total bacteria,¹⁴Lactobacillus/Enterococcus,¹⁵Bifidobacterium¹⁶ and Bacteroides,¹⁷ respectively. For the other groups analysed,^17–22 samples were quantified using standards derived from targeted cloned genes using the pGEM-T cloning vector system kit (Promega, Madison, WI, USA), as described by Barroso et al.²³ The correctness of the inserts was confirmed by sequence analysis.

Table 1 Primer sets used for quantitative PCR

Bacterial group	Primer sequence 5′-3′	Amplicon size	Annealing temperature	Standard
Bacteroides ^17	GAAGGTCCCCCACATTG	103	60	Bacteroides fragilis DSM2151
	CGCKACTTGGCTGGTTCAG
Bifidobacterium ^16	CTCCTGGAAACGGGTGG	593	55	Bifidobacterium breve 29M2
	GGTGTTCTTCCCGATATCTACA
Lactobacillus/Enterococcus^15	TGGAAACAGRTGCTAATACCG	192	55	Lactobacillus plantarum IFPL935
	GTCCATTGTGGAAGATTCCC
Clostridium leptum ^18 (Cluster IV)	GCACAAGCAGTGGAGT	239	55	Clone
	CTTCCTCCGTTTTGTCAA
Blautia coccoides/Eubacterium rectale^19	CGGTACCTGACTAAGAAGC	429	55	Clone
(Cluster XIVa)	AGTTTYATTCTTGCGAACG
Ruminococcus ^17 (Cluster IV)	GGCGGCYTRCTGGGCTTT	157	60	Clone
	CCAGGTGGATWACTTATTGTGTTAA
Roseburia ^17 (Cluster XIVa)	GCGGTRCGGCAAGTCTGA	81	60	Clone
	CCTCCGACACTCTAGTMCGAC
Faecalibacterium ^20 (Cluster IV)	CCATGAATTGCCTTCAAAACTGTT	141	60	Clone
	GAGCCTCAGCGTCAGTTGGT
Akkermansia ^21	CAGCACGTGAAGGTGGGGAC	329	58	Clone
	CCTTGCGGTTGGCTTCAGAT
Enterobacteriaceae^22	ATGGCTGTCGTCAGCTCGT	385	58	Clone
	CCTACTTCTTTTGCAACCCACTC
Total bacteria^14	AACGCGAAGAACCTTAC	489	55	Escherichia coli DH5α
	CGGTGTGTACAAGACCC

---

2.3. Short chain fatty-acid (SCFA) determination

Supernatants from the faecal homogenates were filtered and 0.2 μL were injected on a HPLC system (Jasco, Tokyo, Japan) equipped with a UV-975 detector. SCFA were separated using a Rezex ROA Organic Acids column (Phenomenex, Macclesfield, UK) following the method described by Sanz et al.²⁴ The mobile phase was a linear gradient of 0.005 M sulphuric acid in HPLC grade water, and flow rate was 0.6 mL min⁻¹. The elution profile was monitored at 210 nm and peak identification was carried out by comparing the retention times of target peaks with those of standards. Calibration curves of acetic, propionic, butyric, formic, succinic and lactic acids were built up in the concentration range of 1 to 100 mM.

2.4. Ammonium determination

Ammonium was determined directly from the supernatant fraction of faecal samples (13 000g, 15 min, 4 °C) using an ammonium ion selective electrode (NH500/2; WTW, Weilheim, Germany) and following the manufacturer's instructions. Results are expressed as mM using an ammonium standard solution.

2.5. Statistical analysis

The results are expressed as mean values ± standard error of the mean (SEM), and were analyzed by one-way analysis of variance (ANOVA), using the IBM SSPS Statistics software Version 23 (IBM-SPSS Inc., Chicago, IL, USA). Differences between the groups were assessed post-hoc by the Tukey test. A value of P < 0.05 was fixed for the level of significance of the tests.

3. Results and discussion

In this article we describe the microbiological composition of faeces and the products of microbial fermentative and proteolytic metabolism of obese and lean Zucker rats, after a 12 week nutritional intervention in the obese animals with egg white hydrolysed with pepsin (EWH). No differences were observed in the appearance and consistence of faeces, although the amount of faeces excreted was higher in the obese rats regardless of the intake of hydrolysate.¹²

3.1. Microbiological differences between obese and lean Zucker rats

Faecal material was analysed for microbiota composition by qPCR, targeting the specific bacterial groups shown in Table 1. The microbiological results shown in Table 2 indicate that obese and lean rats differed in several microbiological parameters. Counts per g of faeces of total bacteria, Lactobacillus/Enterococcus, C. leptum, Roseburia, Akkermansia and Ruminococcus were significantly higher (P < 0.05) in the obese rats than in their lean counterparts. Overall, most of the bacterial groups whose counts were comparatively higher in the obese rats belong to the phylum Firmicutes (the only exception was Akkermansia), whereas groups from Bacteroidetes (genus Bacteroides), Actinobacteria (genus Bifidobacterium) and Proteobacteria (family Enterobacteriaceae) showed no significant differences between obese and lean Zucker rats (Table 2). The higher Firmicutes/Bacteroidetes ratio found in the obese rats compared with their lean controls is a general trend in murine genetic obese models.^8,25,26 In humans, some studies have also associated obesity with a higher intestinal Firmicutes/Bacteroidetes ratio in comparison with lean individuals.^27,28 However, other human trials have reported no differences or opposite results in obese individuals.^29–31

Table 2 Mean ± SEM of quantitative PCR counts (log copy number per g) for the different microbial groups analysed in the faeces of the Zucker rats: lean (L), obese (O) and obese treated with egg white hydrolysed with pepsin (EWH)

Bacterial group	Lean (L)	Obese (O)	Obese + EWH	P value
				O vs. L	EWH vs. L
Different letters (a, b, c) in the same row indicate significant differences (P < 0.05) between rat groups using one-way ANOVA analysis.
Bacteroides	7.06^a ± 0.22	7.42^a ± 0.10	7.00^a ± 0.07	0.196	0.958
Bifidobacterium	8.97^a ± 0.28	9.69^ab ± 0.16	9.05^ab ± 0.13	0.043	0.948
Lactobacillus/Enterococcus	9.00^a ± 0.32	9.97^b ± 0.15	8.89^a ± 0.08	0.007	0.910
Clostridium leptum	6.34^a ± 0.08	7.42^c ± 0.06	6.84^b ± 0.06	0.000	0.001
B. coccoides/E. rectale	6.78^a ± 0.27	7.84^a ± 0.30	7.53^a ± 0.32	0.080	0.750
Ruminococcus	5.84^a ± 0.16	7.01^b ± 0.26	7.12^b ± 0.13	0.003	0.001
Roseburia	6.99^a ± 0.17	7.97^b ± 0.23	7.98^b ± 0.10	0.002	0.001
Faecalibacterium	5.33^a ± 0.22	5.62^a ± 0.16	5.82^a ± 0.15	0.553	0.191
Akkermansia	7.15^a ± 0.35	9.65^b ± 0.20	9.16^b ± 0.27	0.000	0.000
Enterobacteriaceae	4.84^a ± 0.29	5.52^a ± 0.62	5.61^a ± 0.09	0.341	0.138
Total bacteria	9.69^a ± 0.26	10.33^b ± 0.12	9.54^a ± 0.12	0.048	0.827

---

In the present work the differences found in the specific microbial groups analysed are in agreement with published data. Thus, the counts of Lactobacillus/Enterococcus in obese rats have been reported to outnumber those of their lean counterparts.^32,33 Remarkably, there were higher counts of Akkermansia in the obese rats than in their lean controls (Table 2) in agreement with the results of Noratto et al. in obese Zucker rats.³⁴ However, obesity induced in rats by a high fat diet is often inversely correlated with numbers of Akkermansia muciniphila,³⁵ the only currently known species within genus Akkermansia. This species is a usual inhabitant of the intestinal mucus layer and its decrease in dietary-induced obese rats could be related to disturbances in the mucosa barrier function caused by high fat diets.³⁶

The comparison of microbial metabolism between obese and lean rats (Fig. 1 and Table 3) shows that the total of SCFA and lactate concentrations were higher (P < 0.05) in the obese rats than in their lean counterparts. A study of energy metabolism comparing obese and lean Zucker rats by Phetcharaburanin et al. also showed higher concentrations of faecal lactate and SCFAs in obese rats compared with lean animals.⁷ Research on SCFA content in human faeces has also indicated a higher proportion of SCFA in overweight and obese subjects compared to lean controls.³⁰ A similar trend was observed in this work regarding microbial proteolytic metabolism (Fig. 1), with higher amount of ammonium in the faeces of the obese animals than in those of the lean rats. The genetic background of both rat groups and the fact that they were fed with the same diet point to the amount of food ingested as the keystone for the observed microbial and metabolic changes. Zucker obese rats lack the gene corresponding to leptin receptors and are affected by impaired satiety perception during feeding. Therefore, these rats are hyperphagic and have reduced energy expenditure, leading to development of pronounced obesity at an early stage in life.⁶ Indeed, food intake was significantly higher in the obese than in the lean animals during the first 6 weeks of the study, which led to severe obesity at the end of the experimental period (547 g versus 414 g in the lean animals).¹² The higher fermentative and proteolytic metabolism that characterised the obese animals as compared with the lean controls, together with the higher total microbial counts in faeces of the former, suggest that the different metabolic phenotypes of both types of rats could be linked to their particular microbiomes.

Fig. 1 Concentration (mM) of total SCFA and ammonium in the faeces of the Zucker rats: lean, obese and obese treated with egg white hydrolysed with pepsin (EWH). Different letters (a, b) indicate significant differences (P < 0.05) between rat groups using one factor ANOVA analysis.

Table 3 Concentration (mM; mean ± SEM) of SCFA in the faeces of the Zucker rats: lean (L), obese (O) and obese treated with egg white hydrolysed with pepsin (EWH)

Acid	Lean (L)	Obese (O)	Obese + EWH	P value
				O vs. L	EWH vs. L
Different letters (a, b) in the same column indicate significant differences (P < 0.05) between rat groups using one-way ANOVA analysis.
Acetate	15.62^a ± 3.03	23.67^a ± 2.40	18.82^a ± 2.50	0.108	0.669
Propionate	3.27^a ± 1.39	6.03^a ± 1.81	3.95^a ± 1.49	0.451	0.948
Butyrate	—	0.50^a ± 0.17	0.51^a ± 0.15
Lactate	15.17^a ± 2.86	38.99^b ± 6.26	21.62^ab ± 5.48	0.009	0.647
Succinate	2.43^a ± 0.79	1.29^a ± 0.80	2.47^a ± 0.81	0.594	0.999

---

3.2. Microbiological effects of pepsin egg white hydrolysate in obese Zucker rats

The counts of Lactobacillus/Enterococcus, C. leptum and total bacteria of the obese rats supplemented with EWH were similar (P > 0.05) to those of the lean rats (Table 2). Besides, feeding the obese Zucker rats with EWH tended to reduce the faecal concentration of total SCFA in comparison with the control obese rats (Fig. 1; P = 0.08). Particularly, the ANOVA test indicated that the lactic acid concentration was similar in the obese rats treated with EWH and the control lean rats (Table 3). On the other hand, treatment with EWH did not reduce microbial proteolytic activity, measured as the ammonium concentration in faeces, of the obese rats (Fig. 1).

An association can be established between the higher counts assessed for Lactobacillus/Enterococcus (Table 2) and the higher concentrations of lactic acid in the faeces of the obese rats, as compared with those of the lean rats (Table 3), and the observation that both, microbial counts and metabolite concentration, tended to be reduced by the treatment with EWH. Lactobacillus and Enterococcus are genera characterized by the production of lactic acid as the principal end metabolite from carbohydrate fermentation. Moreover, an increased acetic acid production has been observed during growth of Lactobacillus species in non-digestible carbohydrates.³⁷ Results of physiological markers measured in these animals and published by Garcés-Rimón et al. showed that the levels of free fatty acids (FFA) in plasma of the obese rats were higher than those in plasma of the lean rats and of the rats treated with EWH.¹² This observation matches the comparatively higher level of acetic acid in the faeces of the obese rats (Table 3) and indicates a higher production and absorption of this SCFA. Acetic and propionic acids, which are 90% absorbed in the intestine, are involved in lipid metabolism and energy storage in the adipose tissue. Particularly, acetic acid is responsible for increased de novo lipogenesis and fat accumulation in the epididymal white adipose tissue.³⁸ In this regard, the obese rats of this study showed increased absolute and relative epididymal adipose tissue weights and a substantial liver steatosis, together with dyslipidaemia (high plasma concentrations of cholesterol, triglycerides and FFA), compared with the lean rats.¹² The intake of EWH significantly decreased the epididymal adipose tissue, improved hepatic steatosis and reduced oxidative stress.¹²

The results of this work on microbiota composition and microbial metabolism of obese rats fed with EWH showed not only improvement of the aforementioned physiological markers but also changes in microbial parameters towards those typical of lean rats. However, the lean-like microbial composition observed after intake of EWH was not accompanied by a reduction of the final body weight of obese rats. This observation points out the overall difficulty to elucidate the potential link between specific dietary nutrients, changes in the abundance or phylogenetic composition of the gut microbiota, metabolic consequences and impact on health. It seems unlikely that EWH, supplied in the drinking water to the obese rats, reached the large intestine and was directly responsible for changes in microbiota composition and decrease of SCFA levels. In fact, while an increase of dietary protein usually results in a marked increase in total ammonia formed via bacterial deamination of amino acids in the colon, which produces the majority of ammonia in the body,³⁹ no enhanced microbial proteolytic activity was observed after administration of EWH (Fig. 1). Therefore, it is more likely that the bioactive peptides contained in EWH are already absorbed in the small intestine and reach the target tissues and organs via blood system, causing improvements in physiological markers of lipid metabolism, inflammation and oxidative stress¹² that promoted the changes in composition and metabolism of the gut microbiota found in this work. It is known that obesity and diabetes are two disorders that have in common inflammation and oxidative stress⁴⁰ and are repeatedly associated to microbial dysbiosis and changes in composition and functionality of gut microbiota.⁴¹ It could be hypothesized that, by virtue of their antioxidant and anti-inflammatory effects shown in this as well as in other rat models of oxidative stress,^12,42,43 the bioactive peptides contained in EWH would have the potential to modulate gut microbiota in place of, or in addition to, any change effected by their unlikely direct microbial metabolism of the peptides. Moreover, reversion of microbial dysbiosis in obese rats by reduction of inflammation and oxidative stress would turn in favour of a reduction of microbial fermentation, SCFA production and, consequently, less energy recover and associated lipogenesis. Anti-oxidative phytochemicals, such as resveratrol and, particularly, pterostilbene have demonstrated their efficiency as antiobesity dietary supplements for obese Zucker rats^44,45 and oligomeric cocoa procyanidins prevent the development of obesity in high fat fed rats.⁴⁶ Moreover, moderate physical exercise can modulate the gut microbiota due to the promotion of antioxidant enzymes and anti-inflammatory cytokines.⁴⁷ The increased capacity to tolerate oxidative stress represents a sign of microbial dysbiosis in the anaerobic gut environment, since it is indicative of the presence of aerobic bacteria and/or activation of host inflammatory responses.^41,48

4. Conclusion

The current study suggests that the ingestion of a pepsin hydrolysate of egg white by Zucker obese rats has the potential to revert the microbial dysbiosis that characterizes these animals. Changes in gut microbiota were accompanied by a trend to diminish faecal SCFA levels and occurred simultaneously with a previously reported amelioration of markers of oxidative stress and inflammation.¹² It is likely that the hydrolysate, by virtue of its antioxidant activity and its capacity to reduce inflammation, could have modulated gut microbiota towards a more balanced scenario that lowered SCFA production and associated lipogenesis, contributing to reduced fat accumulation and liver steatosis.

Acknowledgements

The authors acknowledge funding from the Spanish Ministry for Science and Innovation (AGL2012-35814 and AGL2012-32387) and CSIC (COOPB-20099 and Intramural 201570I028). The authors thank Iván Álvarez-Rodríguez for his valuable technical assistance with HPLC and qPCR.

References

1. C. Torres-Fuentes, H. Schellekens, T. G. Dinan and J. F. Cryan, Nutr. Neurosci., 2015, 18, 49–65.
2. L. Brown, H. Poudyal and S. K. Panchal, Obes. Rev., 2015, 16, 914–941.
3. M. S. Westerterp-Plantenga, A. Nieuwenhuizen, D. Tomé, S. Soenen and K. R. Westerterp, Annu. Rev. Nutr., 2009, 29, 21–41.
4. D. Bouglé and S. Bouhallab, Crit. Rev. Food Sci. Nutr., 2017, 57, 335–343.
5. V. Manikkam, T. Vasiljevic, O. N. Donkor and M. L. Mathai, Crit. Rev. Food Sci. Nutr., 2016, 56, 92–112.
6. C. Nilsson, K. Raun, F. F. Yan, M. O. Larsen and M. Tang-Christensen, Acta Pharmacol. Sin., 2012, 33, 173–181.
7. J. Phetcharaburanin, H. Lees, J. R. Marchesi, J. K. Nicholson, E. Holmes, F. Seyfried and J. V. Li, J. Proteome Res., 2016, 15, 1897–1906.
8. R. E. Ley, F. Bäckhed, P. J. Turnbaugh, C. A. Lozupone, R. D. Knight and J. I. Gordon, Proc. Natl. Acad. Sci. U. S. A., 2005, 102, 11070–11075.
9. P. J. Turnbaugh, R. E. Ley, M. A. Mahowald, V. Magrini, E. R. Mardis and J. I. Gordon, Nature, 2006, 444, 1027–1031.
10. N. E. S. Monteiro, A. R. Roquetto, F. De Pace, C. S. Moura, A. Dos Santos, A. T. Yamada, M. J. A. Saad and J. Amaya-Farfan, Food Res. Int., 2016, 85, 121–130.
11. M. Garcés-Rimón, I. López-Expósito, R. López-Fandiño and M. Miguel, Eur. Food Res. Technol., 2016, 242, 61–69.
12. M. Garcés-Rimón, C. González, J. A. Uranga, V. López-Miranda, R. López- Fandiño and M. Miguel, PLoS One, 2016, 11, e0151193.
13. L. Moles, M. Gómez, H. Heilig, G. Bustos, S. Fuentes, W. De Vos, L. Fernández, J. M. Rodríguez and E. Jiménez, PLoS One, 2013, 8, e66986.
14. U. Nübel, B. Engelen, A. Felske, J. Snaidr, A. Wieshuber, R. I. Amann, W. Ludwig and H. Backhaus, J. Bacteriol., 1996, 178, 5636–5643.
15. R. Byun, M. A. Nadkarni, K. L. Chhour, F. E. Martin, N. A. Jacques and N. Hunter, J. Clin. Microbiol., 2004, 42, 3128–3136.
16. T. Matsuki, K. Watanabe, J. Fujimoto, Y. Miyamoto, T. Takada, K. Matsumoto, H. Oyaizu and R. Tanaka, Appl. Environ. Microbiol., 2002, 68, 5445–5451.
17. C. Ramirez-Farias, K. Slezak, Z. Fuller, A. Duncan, G. Holtrop and P. Louis, Br. J. Nutr., 2009, 101, 541–550.
18. T. Matsuki, K. Watanabe, J. Fujimoto, T. Takada and R. Tanaka, Appl. Environ. Microbiol., 2004, 70, 7220–7228.
19. T. Rinttilä, A. Kassinen, E. Malinen, L. Krogius and A. Palva, J. Appl. Microbiol., 2004, 97, 1166–1177.
20. H. Sokol, B. Pigneur, L. Watterlot, O. Lakhdari, L. G. Bermúdez-Humarán, J. J. Gratadoux, S. Blugeon, C. Bridonneau, J. P. Furet, G. Corthier, C. Grangette, N. Vasquez, P. Pochart, G. Trugnan, G. Thomas, H. M. Blottière, J. Doré, P. Marteau, P. Seksik and P. Langella, Proc. Natl. Acad. Sci. U. S. A., 2008, 105, 16731–16736.
21. M. C. Collado, M. Derrien, E. Isolauri, W. M. De Vos and S. Salminen, Appl. Environ. Microbiol., 2007, 73, 7767–7770.
22. T. D. Leser, J. Z. Amenuvor, T. K. Jensen, R. H. Lindecrona, M. Boye and K. Moller, Appl. Environ. Microbiol., 2002, 68, 673–690.
23. E. Barroso, F. Sánchez-Patán, P. J. Martín-Alvárez, B. Bartolomé, M. V. Moreno-Arribas, C. Peláez, T. Requena, T. Van de Wiele and M. C. Martínez-Cuesta, J. Agric. Food Chem., 2013, 61, 10163–10172.
24. M. L. Sanz, N. Polemis, V. Morales, N. Corzo, A. Drakoularakou, G. R. Gibson and R. A. Rastall, J. Agric. Food Chem., 2005, 53, 2914–2921.
25. R. N. Carmody, G. K. Gerber, J. M. Luevano, D. M. Gatti, L. Somes, K. L. Svenson and P. J. Turnbaugh, Cell Host Microbe, 2015, 17, 72–84.
26. E. F. Murphy, P. D. Cotter, S. Healy, T. M. Marques, O. O'Sullivan, F. Fouhy, S. F. Clarke, P. W. O'Toole, E. M. Quigley, C. Stanton, P. R. Ross, R. M. O'Doherty and F. Shanahan, Gut, 2010, 59, 1635–1642.
27. R. E. Ley, P. J. Turnbaugh, S. Klein and J. I. Gordon, Nature, 2006, 444, 1022–1023.
28. S. Louis, R. M. Tappu, A. Damms-Machado, D. H. Huson and S. C. Bischoff, PLoS One, 2016, 11, e0149564.
29. S. H. Duncan, G. E. Lobley, G. Holtrop, J. Ince, A. M. Johnstone, P. Louis and H. J. Flint, Int. J. Obes., 2008, 32, 1720–1724.
30. A. Schwiertz, D. Taras, K. Schafer, S. Beijer, N. A. Bos, C. Donus and P. D. Hardt, Obesity, 2010, 18, 190–195.
31. W. A. Walters, Z. Xu and R. Knight, FEBS Lett., 2014, 588, 4223–4233.
32. J. F. Garcia-Mazcorro, I. Ivanov, D. A. Mills and G. Noratto, PeerJ, 2016, 4, e1702.
33. A. Waldram, E. Holmes, Y. Wang, M. Rantalainen, I. D. Wilson, K. M. Tuohy, A. L. McCartney, G. R. Gibson and J. K. Nicholson, J. Proteome Res., 2009, 8, 2361–2375.
34. G. D. Noratto, J. F. Garcia-Mazcorro, M. Markel, H. S. Martino, Y. Minamoto, J. M. Steiner, D. Byrne, J. S. Suchodolski and S. U. Mertens-Talcott, PLoS One, 2014, 9, e101723.
35. A. Everard, C. Belzer, L. Geurts, J. P. Ouwerkerk, C. Druart, L. B. Bindels, Y. Guiot, M. Derrien, G. G. Muccioli, N. M. Delzenne, W. M. De Vos and P. D. Cani, Proc. Natl. Acad. Sci. U. S. A., 2013, 110, 9066–9071.
36. M. Schneeberger, A. Everard, A. G. Gómez-Valadés, S. Matamoros, S. Ramírez, N. M. Delzenne, R. Gomis, M. Claret and P. D. Cani, Sci. Rep., 2015, 5, 16643.
37. R. Tabasco, J. Fontecha, P. Fernández de Palencia, C. Peláez and T. Requena, LWT–Food Sci. Technol., 2014, 55, 680–684.
38. A. Woting and M. Blaut, Nutrients, 2016, 8, 202.
39. E. P. Nyangale, D. S. Mottram and G. R. Gibson, J. Proteome Res., 2012, 11, 5573–5585.
40. V. Rani, G. Deep, R. K. Singh, K. Palle and U. C. Yadav, Life Sci., 2016, 148, 183–193.
41. J. Wang and H. Jia, Nat. Rev. Microbiol., 2016, 14, 508–522.
42. M. A. Manso, M. Miguel, J. Even, R. Hernández, A. Aleixandre and R. López-Fandiño, Food Chem., 2008, 109, 361–367.
43. D. A. Rizzetti, F. Fernandez, S. Moreno, J. A. Uranga Ocio, F. M. Peçanha, G. Vera, D. V. Vassallo, M. M. Castro and G. A. Wiggers, Brain Res., 2016, 1646, 482–489.
44. U. Etxeberria, E. Hijona, L. Aguirre, F. I. Milagro, L. Bujanda, A. M. Rimando, J. A. Martínez and M. P. Portillo, Mol. Nutr. Food Res., 2017 DOI:10.1002/mnfr.201500906.
45. S. Gómez-Zorita, A. Fernández-Quintela, M. T. Macarulla, L. Aguirre, E. Hijona, L. Bujanda, F. Milagro, J. A. Martínez and M. P. Portillo, Br. J. Nutr., 2012, 107, 202–210.
46. M. R. Dorenkott, L. E. Griffin, K. M. Goodrich, K. A. Thompson-Witrick, G. Fundaro, L. Ye, J. R. Stevens, M. Ali, S. F. O'Keefe, M. W. Hulver and A. P. Neilson, J. Agric. Food Chem., 2014, 62, 2216–2227.
47. S. C. Campbell, P. J. Wisniewski, M. Noji, L. R. McGuinness, M. M. Häggblom, S. A. Lightfoot, L. B. Joseph and L. J. Kerkhof, PLoS One, 2016, 8, e0150502.
48. M. Cernada, C. Bäuerl, E. Serna, M. C. Collado, G. P. Martínez and M. Vento, Sci. Rep., 2016, 6, 25497.

---