Alginic acid oligosaccharide accelerates weaned pig growth through regulating antioxidant capacity, immunity and intestinal development

Abstract

Alginic acid oligosaccharide (ALGO) is the lyase–lysate of alginic acid, which is a naturally occurring anionic polysaccharide isolated from the cell walls of seaweed. In the present study, we fully characterised the effects of dietary ALGO supplementation on certain parameters of weaned pigs. In a 21-day experiment, 16 Landrace × Yorkshire weaned pigs were divided into two groups (n = 8) and fed either with a corn–soybean basal diet (CON) or a basal diet supplemented with 100 mg kg⁻¹ ALGO. We show that dietary ALGO supplementation markedly enhanced (P < 0.05) the average daily body weight gain (ADG) of weaned pigs over the experimental periods. ALGO supplementation not only elevated (P < 0.05) the concentrations of IL-10, IgG and IgA but also increased (P < 0.05) the activities of superoxide dismutase (SOD), catalase (CAT) and total antioxidant capacity (T-AOC) in the serum. Moreover, the concentration of serum malonic dialdehyde (MDA) was lower (P < 0.05) in the ALGO group than in the CON group. ALGO supplementation also significantly enhanced (P < 0.05) secretory immunoglobulin A (sIgA) content, villus height and disaccharidase activities (lactase and sucrase) in the small intestine. Interestingly, dietary ALGO supplementation up-regulated (P < 0.05) the expression levels of tight junction protein occludin (OCLN) and zonula occludens 1 (ZO-1) in the small intestine. Importantly, ALGO not only increased (P < 0.05) the populations of Bifidobacterium and Lactobacillus but also decreased (P < 0.05) the populations of total bacteria and Escherichia coli in the intestine. Overall, the positive effects of ALGO on the growth performance, antioxidant capacity, immunity and intestinal development in weaned pigs suggest that ALGO could serve as an attractive bioactive feed additive in the pig industry, which may be beneficial to human health.

---

Introduction

Recently, the development of natural bioactive compounds as functional ingredients in feed additives has attracted considerable research interest.^1–3 Marine algae are considered as valuable sources of structurally diverse bioactive compounds (e.g., carrageenans in red algae, fucoidans in brown algae and ulvans in green algae), which are rich in sulphated polysaccharides.⁴ These sulphated polysaccharides exhibit many health-beneficial nutraceutical effects such as antioxidant,^5–7 anti-allergy,⁸ anticancer,^9,10 and anticoagulant activities.^11,12 Therefore, polysaccharides derived from marine algae have great potential to be further developed as bioactive feed additives in the pig industry.

Alginic acid is a naturally occurring hydrophilic colloidal polysaccharide obtained from several species of brown seaweeds.¹³ Alginic acid has been regarded as a fabulous biopolymer because of its unique characteristics such as biodegradability, biocompatibility and non-toxicity.¹⁴ Dramatically, alginic acid oligosaccharide (ALGO), a lyase lysate of alginic acid with an average degree of polymerisation of 4.4, has been revealed to be able to affect some immune responses.^15,16 As an oligosaccharide derived from seaweed extracts, ALGO may present important physicochemical and physiological properties, which are beneficial to the health of animals.¹⁶ In particular, several studies showed that dietary supplementation with oligosaccharides or seaweed extracts can enhance beneficial bacteria in the intestine in weaned pigs.^17,18

Weaning imposes tremendous stress on piglets and is accompanied by marked changes in gastrointestinal physiology, microbiology and immunology.¹⁹ For instance, small-intestinal barrier and absorptive functions deteriorate within a short time after weaning.^20,21 As such, maintaining the integrity of intestinal structures and enhancing intestinal development is necessary to enable pigs to cope with weaning. Furthermore, a recent study indicated that weaning could also induce oxidative stress and then result in oxidative damage in pigs.²² Hence, protecting the pig body against oxidative stress appears particularly important. Currently, variations in diet composition and supplementation with bioactive substances have been determined to be feasible options for facilitating intestinal development and elevating antioxidant capacity.^23,24 Given its health benefits and biological activities, ALGO may be an important bioactive feed additive to protect animals against oxidative stress as well as to advance their intestinal development. However, the effects of ALGO supplementation on antioxidant capacity, immunity and intestinal development of weaned pigs have not yet been studied. Consequently, the functional characterisation of ALGO is reasonable and necessary.

In the present study, a trial with weaned pigs has been carried out to evaluate the potential benefits of ALGO as a bioactive feed additive in the pig industry. Our results can provide scientific evidence of the ability of ALGO to improve antioxidant capacity, immune defences and intestinal development, which have contributed to the elevated growth performance. Additionally, this evidence suggests that ALGO may have a promising potential to be used as a medicinal food ingredient or bioactive feed additive. As far as we know, this is the first paper to report ALGO supplementation for weaned pigs.

Materials and methods

ALGO preparation and its composition

ALGO was prepared by the Dalian Institute of Chemical Physics, Chinese Academy of Sciences (Dalian, China). To profile the oligosaccharide compositions, samples were analysed by electrospray ionisation mass spectrometry (ESI-MS). Ion peaks that emerged at m/z 375, 551, 727, 903, 1079, 1255, 1431, 1607 and 1783 over the m/z range of 150–2000 represented the mono-dehydrated sodium adducts of a series from disaccharides and deca-saccharides ([Hex_2-10 − H₂O + Na]⁺). Among the enzymatic products, the predominant ion peaks were observed at 551 and 727 m/z, which represent trisaccharides and tetrasaccharides.

Animals, diets and experimental design

A total of 16 Landrace × Yorkshire pigs weaned at 28 days with an initial body weight of 7.80 (±0.16) kg were randomly assigned to each of the two dietary treatments (n = 8) that consisted of a basal diet (CON) and the basal diet supplemented with 100 mg kg⁻¹ ALGO (ALGO). The basal diets were formulated to meet or exceed the nutrient requirements recommended by the National Research Council (NRC) (2012),²⁵ and their compositions are shown in Table 1. The pigs were individually housed in metabolism cages (0.7 × 1.5 m) with woven wire flooring in a temperature-controlled nursery room (25–28 °C) during a 21-day experimental period. All pigs had ad libitum access to feed and water.

Table 1 Composition and calculated nutrient content of the basal diet

Ingredients	Content (%)
a The premix provided the following per kg of diets: 75 mg of Fe, 150 mg of Cu, 75 mg of Zn, 60 mg of Mn, 0.35 mg of I, and 0.35 mg of Se.b The premix provided the following per kg of diets: 9000 IU of VA, 3000 IU of VD3, 20 IU of VE, 3 mg of VK3, 1.50 mg of VB1, 4 mg of VB2, 3 mg of VB6, 0.02 mg of VB12, 30 mg of niacin, 15 mg of pantothenic acid, 0.75 mg of folic acid, and 0.10 mg of biotin.
Extruded corn (crude protein 7.8%)	24.00
Corn (crude protein 7.8%)	27.70
Soybean meal (crude protein 44.2%)	13.50
Extruded soybean	10.50
Whey powder (low protein)	7.00
Soybean protein concentrate	5.00
Fish meal (crude protein 62.5%)	4.00
Sucrose	4.00
Soybean oil	1.50
Limestone	0.90
Dicalcium phosphate	0.60
L-Lysine HCl (78%)	0.30
Salt	0.30
Chloride choline	0.10
DL-Methionine	0.08
L-Threonine (98.5%)	0.06
Tryptophan	0.02
Mineral premix^a	0.40
Vitamin premix^b	0.04
Total	100
Calculated composition
Crude protein	19.93
Calcium	0.85
Total phosphorus	0.62
Available phosphorus	0.44
Lysine	1.33
Methionine	0.39
Methionine + cysteine	0.66
Threonine	0.78
Dietary energy (MJ kg^−1)	14.85

---

Growth performance

The pigs were individually weighed at the start of the trial and on day 22 prior to the morning feeding. Feed consumption was recorded as the amount of feed offered daily minus the remaining quantity in the feeder on the next morning during the experiment. These values were used to calculate average daily body weight gain (ADG), average daily feed intake (ADFI) and the ratio of feed to gain (F/G).

Sample collection

Blood samples were collected by venepuncture in the morning (08:00 h) of day 22 after overnight fasting and were injected into a 10 mL vacuum tube. Briefly, the tubes were centrifuged at 3000 × g for 15 minutes (4 °C), and then the serum samples were harvested and stored at −20 °C for analyses of antioxidant status and immune indices.

After blood sampling, all pigs were then killed with sodium pentobarbital (200 mg kg⁻¹ BW) to collect intestinal samples. Duodenal, jejunal and ileal samples of approximately 2 cm in length were stored in 4% paraformaldehyde solution, and kept at 4 °C for a microscopic assessment of the mucosal morphology. Duodenal, jejunal and ileal mucosa were scraped by a glass slide and then stored at −80 °C until enzyme activities and secretory immunoglobulin A (sIgA) analyses were done. Intestinal segments of the duodenum, jejunum and ileum were collected and immediately frozen at −80 °C for quantitative real-time polymerase chain reaction (PCR). Finally, ileal, caecal and colonic digesta were collected and immediately frozen at −80 °C for later microbial population determination.

Determination of antioxidant index in serum

To evaluate the prooxidant–antioxidant balance in blood, we determined the malonic dialdehyde (MDA) content and the activities of several enzymatic and non-enzymatic antioxidants, including glutathione peroxidase (GSH-PX), superoxide dismutase (SOD), catalase (CAT) and total antioxidant capacity (T-AOC). All antioxidant-related indices were analysed using the corresponding diagnostic kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

MDA content analysis. MDA content was analysed as described by Livingstone et al.²⁶ through the thiobarbituric acid reaction. MDA forms a red compound featuring absorbance at 532 nm with thiobarbituric acid. MDA results are expressed as nmol per millilitre (nm mL⁻¹) of serum.

SOD activity analysis. SOD activity was detected as reported by Cao et al.²⁷ Serum SOD activity is expressed as units per millilitre (U mL⁻¹) of serum; here, one unit (U) SOD activity was defined as the amount of enzyme necessary to produce 50% inhibition of nitric ion production.

CAT activity analysis. CAT activity was assayed through the decomposition of hydrogen peroxide.²⁸ CAT activity is expressed in U mL⁻¹ of serum; here, one U CAT activity is defined as the quantity that decreased 1 mmol per millilitre (mmol L⁻¹) H₂O₂ within 1 s per millilitre of serum.

T-AOC activity analysis. T-AOC was determined following the protocol of Miller et al.²⁹ Integral cellular endogenous antioxidative ability, including both enzymatic and non-enzymatic antioxidants, is reflected by T-AOC. All antioxidants were able to reduce Fe³⁺ to Fe²⁺, and the latter can develop coloured and stable chelates when combined with phenanthroline. T-AOC is presented in U mL⁻¹ of serum; here, one U of T-AOC is defined as the absorbance value (at 520 nm) that increases by 0.01 within 1 minute per millilitre of serum.

GSH-Px activity analysis. GSH-Px activity was determined as described by Beulter³⁰ by quantifying the rate of H₂O₂-induced oxidation of GSH to oxidised glutathione (GSSG). A yellow product with absorbance at 412 nm is formed as GSH reacts with dithiobisnitrobenzoic acid. Serum GSH-Px activity is expressed as U mL⁻¹ of serum, where one U of GSH-Px is defined as the amount of enzyme that decreases 1 mmol L⁻¹ GSH within 1 minute per millilitre of serum.

Measurements of cytokines and immunoglobulins in serum

The concentrations of inflammatory factors such as tumor necrosis factor-α (TNF-α) and interleukins (IL-1, IL-6 and IL-10) and immunoglobulins (IgA, IgG and IgM) in the serum, were determined by using porcine ELISA kits (R&D Systems, Minneapolis, MN, USA). All of the procedures were performed based on the manufacturer's instructions and the absorbance was determined by using a microplate reader (SpectraMax M2, Molecular Devices, Sunnyvale, CA, USA). The concentrations of inflammatory factors and immunoglobulins are presented as picogram per millilitre (pg mL⁻¹) and microgram per millilitre (μg mL⁻¹), respectively.

Assay of secretory immunoglobulin A in intestinal mucosa

Frozen duodenal, jejunal and ileal mucosa scrapings were weighed, thawed and homogenised (5 minutes) in nine times the volume (w/v) of ice-cold physiologic saline. The mixtures were then centrifuged at 3000 × g for 15 minutes (4 °C), and the supernatants were collected and stored at −20 °C until sIgA analysis. The total proteins of the homogenates were extracted, and their concentration was determined according to the procedure of bicinchoninic acid (Solarbio, Inc., China), with bovine serum albumin as the standard. Then, sIgA in the intestinal mucosa was also measured using commercially available porcine ELISA kits (R&D Systems, Minneapolis, MN, USA). The concentration of sIgA was determined according to the manufacturer's instructions and presented as milligrams per gram of protein (mg g⁻¹ protein).

Duodenal, jejunal and ileal morphology

The duodenal, jejunal and ileal samples were douched with physiologic saline and stored in 4% paraformaldehyde solution. The preserved segments were prepared after staining with hematoxylin and eosin (HE) solution using standard paraffin-embedding procedures. Ten intact, well-oriented crypt–villus units were selected in triplicate as sources of each pig intestine cross section. Morphometric variables, including villus height (distance from the villus tip to the crypt mouth) and crypt depth (distance from the crypt mouth to the base), were measured with an image processing and analysis system (Image Pro Plus, Media Cybernetics, Bethesda, MD, USA). The ratio of villus height to crypt depth (V/C) was calculated from values previously described.

Enzyme assay of the duodenum, jejunum and ileum

The intestinal mucosa supernatants (including duodenum, jejunum and ileum) and their total protein concentration were performed as previously described. Disaccharidase activities (including maltase, sucrase and lactase) were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions. The absorbance was determined with spectrophotometer at 505 nm (Beckman Coulter DU-800; Beckman Coulter, Inc., Pasadena, CA, USA). The activities of disaccharidase were presented as units per mg of protein (U per mg protein). One U was defined as 1 nmol maltose, sucrose or lactose as substrate for the enzymatic reaction.

Total RNA extraction, reverse transcription and quantitative real-time PCR

Total RNA was extracted from frozen intestinal tissue (i.e., duodenum, jejunum and ileum) using TRIzol reagent (Catalogue no. 15596-026; Invitrogen) according to the manufacturer's instructions, and the quality and purity of RNA samples were assessed by electrophoresis on 1.0% agarose gels (Egel; Invitrogen, Carlsbad, CA, USA) and nucleic acid analyser (A260/A280, Beckman DU-800; Beckman Coulter, Inc., Pasadena, CA, USA), respectively. Subsequently, the RNA samples were reverse transcribed (RT) into complementary DNA using the PrimeScript™ RT reagent kit (Catalogue no. RR047A; Takara Bio, Japan) according to the manufacturer's instructions. A portion of the RT products (1 μL) was used directly for quantitative real-time PCR. The primers were synthesised commercially by Invitrogen (Shanghai, China) and are listed in Table 2. Real-time PCR for quantification of claudin 1 (CLDN-1), occludin (OCLN) and zonula occludens 1 (ZO-1) were run in a CFX96 Real-Time PCR Detection System (Bio-Rad, CA, USA) using the SYBR® Green I PCR reagents (Catalogue no. RR820A; Takara Bio, Japan). All experiment sample analysis was repeated in triplicate. The reaction mixture (10 μL) contained 5 μL of freshly SYBR® Premix Ex Taq™ II (Tli RNaseH Plus, 2×), 1 μL forward primers (4 μM) and 1 μL reverse primers (4 μM), 1 μL of RT products and 2 μL nuclease-free water. The PCR protocol was used as follows: a prerun at 95 °C for 10 seconds, and 40 cycles of denaturation step at 95 °C for 5 seconds, followed by an annealing temperature at 55.7 °C for 30 seconds, and a 72 °C extension step for 10 seconds. After amplification, a melting curve analysis was performed to verify the specificity of the reactions. Melting curve conditions were as follows: 1 cycle of denaturation at 95 °C for 10 seconds and then 65 °C changed to 95 °C with a temperature change velocity of 0.5 °C s⁻¹. The standard curve of each gene was run in triplicate for obtaining reliable amplification efficiency values. The correlation coefficients of all the standard curves were >0.99, and the amplification efficiency values were between 90% and 110%. β-Actin expression was used as the reference gene to normalise the mRNA expression of target genes, and the relative quantification of gene expression among the treatment groups was analysed using the 2^−ΔΔC_t method.³¹ Finally, the mRNA levels were expressed as the fold change relative to the mean value of the CON group, which was arbitrarily defined as 1.0.

Table 2 Sequences of primers and probes used for quantitative real-time PCR

Items	Primer/probe name and sequence (5′–3′)	Annealing temperature (°C)	Product length (bp)	Reference
a CLDN-1, claudin 1.b OCLN, occludin.c ZO-1, zonula occludens 1.
β-Actin	β-F, TCTGGCACCACACCTTCT	55.7	114	32
	β-R, TGATCTGGGTCATCTTCTCAC
CLDN-1^a	CL-F, GCCACAGCAAGGTATGGTAAC	55.7	140	55
	CL-R, AGTAGGGCACCTCCCAGAAG
OCLN^b	OC-F, CTACTCGTCCAACGGGAAAG	55.7	158	55
	OC-R, ACGCCTCCAAGTTACCACTG
ZO-1^c	ZO-F, TGGCATTATTCGCCTTCATAC	55.7	171	55
	ZO-R, AGCCTCATTCGCATTGTTT
Total bacteria	Eub338F, ACTCCTACGGGAGGCAGCAG	60.0	200	24
	Eub518R, ATTACCGCGGCTGCTGG
Escherichia coli	DC-F, CATGCCGCGTGTATGAAGAA	59.5	96	24
	DC-R, CGGGTAACGTCAATGAGCAAA DC-P, AGGTATTAACTTTACTCCCTTCCTC
Lactobacillus	RS-F, GAGGCAGCAGTAGGGAATCTTC	53.0	126	24
	RS-R, CAACAGTTACTCTG ACACCCGTTCTTC
	RS-P, AAGAAGGGTTTCGGCTCGTAAAACTCTGTT
Bifidobacterium	SQ-F, CGCGTCCGGTGTGAAAG	59.5	121	24
	SQ-R, CTTCCCGATATCTACACATTCCA
	SQ-P, ATTCCACCGTTACACCGGGAA
Bacillus	YB-F, GCAACGAGCGCAACCCTTGA	59.5	92	24
	YB-R, TCATCCCCACCTTCCTCCGGT
	YB-P, CGGTTTGTCACCGGCAGTCACCT

---

Microbial population determination

Bacterial DNA was extracted from the ileal, caecal and colonic digesta using the Stool DNA Kit (Omega Bio-Tek, Doraville, CA, USA) according to the manufacturer's protocol. Primers and fluorescent oligonucleotide probes (Table 2) were designed with Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA) and followed 16S rRNA sequences of maximum species of each genus homology downloaded from GenBank database, European Molecular Biology Laboratory and DNA Data Bank of Japan to obtain specific amplification, and the sequences of all the genera taken from the database were submitted to DNAStar (MegAlign) program (DNASTAR, Inc., Madison, WI, USA), as described by Wan et al.²⁴ Next, these sequences were submitted to alignment, in which the maximum number of species belonging to one genus was gathered and the regions showing conservations were picked up as genus-specific primers and probes. All the primers and fluorescent oligonucleotide probes used in this experiment were commercially synthesised by Invitrogen (Shanghai, China).

Quantitative real-time PCR was performed in a CFX96 Real-Time PCR Detection System (Bio-Rad, CA, USA) with optical-grade 96-well plates. For the quantification of total bacteria, the reaction mixture (25 μL) contained 1 μL forward and 1 μL reverse primers (100 nM), 12.5 μL SYBR® Premix Ex Taq™ II (Tli RNaseH Plus, 2×), 1 μL template DNA and 9.5 μL nuclease-free water. The thermal cycling conditions were an initial predenaturation step at 95 °C for 10 seconds, 40 cycles of denaturation at 95 °C for 5 seconds, annealing at 60.0 °C for 25 seconds and extension at 72 °C for 60 seconds. For the quantification of Bifidobacterium, Lactobacillus, Escherichia coli and Bacillus, the RealMasterMix (Probe) Kit (Catalogue no. FP203-02; Tiangen Biotech, Beijing, China) was purchased. Quantitative real-time PCR was conducted in a reaction volume of 20 μL with a 1 μL probe enhancer solution (20×), 0.3 μL probe (100 nM), 1 μL forward and 1 μL reverse primers (100 nM), 8 μL RealMasterMix (2.5×), 1 μL template DNA and 7.7 μL nuclease-free water. The PCR conditions involved 10 seconds at 95 °C and 50 cycles for 5 seconds at 95 °C, 25 seconds at annealing temperature (Table 2) and 60 seconds at 72 °C. The cycle threshold (C_t) values and baseline settings were determined by automatic analysis settings, and the copy numbers of the target group for each reaction were calculated from the standard curves.

For the quantification of bacteria in the test samples, specific standard curves were generated by constructing standard plasmids, as presented by Han et al.³² DNA concentrations of standard plasmids were detected using a spectrophotometer (Beckman Coulter DU 800; Beckman Coulter, Fullerton, CA, USA). The gene copy numbers were calculated by the following formula: (6.0233 × 1023 copies per mol × DNA concentration (μg μL⁻¹))/(660 × 106 × DNA size (bp)). A 10-fold serial dilution series of plasmid DNA was used to construct the standard curves for total bacteria, Bifidobacterium, Lactobacillus, Escherichia coli and Bacillus. Each standard curve was generated by a linear regression of the plotted points, and C_t-values were plotted against the logarithm of template copy numbers.

Statistical analysis

Bacterial copies were transformed (log₁₀) before the statistical analysis was conducted. Data were analysed by T-test using the statistical program SAS (version 9.0; SAS Inst., Inc., Cary, NC, USA). Each pig served as the statistical unit. Data are presented as mean ± standard error. P < 0.05 was considered to be statistically significant.

Results

Performance

The impacts of ALGO on the growth performance are shown in Table 3. ALGO supplementation obviously increased (P < 0.05) the ADG relative to the CON group. However, there were no prominent differences (P > 0.05) in the ADFI and F/G between the CON group and the ALGO group.

Table 3 Effects of alginic acid oligosaccharide on the growth performance over the experimental periods of weaned pigs^b

Items	Treatments		P-Value
	CON	ALGO
a P < 0.05 versus the CON group. CON, a corn–soybean basal diet; ALGO, alginic acid oligosaccharide (the basal diet supplemented with 100 mg kg^−1 alginic acid oligosaccharide).b Values are means of eight replicates per treatment.c ADG, average daily body weight gain.d ADFI, average daily feed intake.e F/G, the ratio of feed to gain.
Days 1–21
ADG^c (g)	441.07 ± 22.86	516.53 ± 22.11^a	0.035
ADFI^d (g)	666.82 ± 30.96	749.03 ± 24.25	0.059
F/G^e	1.52 ± 0.05	1.46 ± 0.06	0.461

---

Antioxidant capacity

Table 4 reveals that ALGO supplementation promoted increases (P < 0.05) in SOD, CAT and T-AOC activities in the serum by 21.03%, 36.62% and 14.01%, respectively, compared with the CON group; a decrease (P < 0.05) in serum MDA activity (by 25.84%) was also observed. In addition, no significant change (P > 0.05) on GSH-Px activity in serum was noted relative to the CON group.

Table 4 Effects of alginic acid oligosaccharide on the serum antioxidant status of weaned pigs^a,b

Items	Treatments		P-Value
	CON	ALGO
a *P < 0.05 versus the CON group. **P < 0.01 versus the CON group. CON, a corn–soybean basal diet; ALGO, alginic acid oligosaccharide (the basal diet supplemented with 100 mg kg^−1 alginic acid oligosaccharide).b Values are means of eight replicates per treatment.c GSH-Px, glutathione peroxidase.d T-AOC, total antioxidant capacity.e SOD, superoxide dismutase.f CAT, catalase.g MDA, malonic dialdehyde.
GSH-Px^c (U mL^−1)	391.15 ± 7.83	401.42 ± 3.23	0.260
T-AOC^d (U mL^−1)	4.21 ± 0.18	4.80 ± 0.11*	0.023
SOD^e (U mL^−1)	49.84 ± 1.32	60.32 ± 0.52**	<0.001
CAT^f (U mL^−1)	3.96 ± 0.19	5.41 ± 0.19**	<0.001
MDA^g (nm mL^−1)	4.45 ± 0.37	3.30 ± 0.11*	0.020

---

Immune indices

As shown in Table 5, sIgA content in all of the selected intestinal segments was enhanced (P < 0.05) by dietary ALGO supplementation. In the serum, the concentrations of cytokines (IL-6 and IL-10) and immunoglobulins (IgG and IgA) were higher (P < 0.05) for pigs fed the ALGO diet than those fed the CON diet. In addition, the pro-inflammatory cytokines IL-1 and TNF-α, as well as IgM, in the serum were unaffected (P > 0.05) by dietary treatment.

Table 5 Effects of alginic acid oligosaccharide on the immune responses of weaned pigs^b

Items	Treatments		P-Value
	CON	ALGO
a P < 0.01 versus the CON group. CON, a corn–soybean basal diet; ALGO, alginic acid oligosaccharide (the basal diet supplemented with 100 mg kg^−1 alginic acid oligosaccharide).b Values are means of eight replicates per treatment.c IL-1, interleukin-1.d IL-6, interleukin-6.e IL-10, interleukin-10.f TNF-α, tumor necrosis factor-α.g IgG, immunoglobulin G.h IgA, immunoglobulin A.i IgM, immunoglobulin M.j sIgA, secretory immunoglobulin A.
Serum
IL-1^c (pg mL^−1)	325.37 ± 7.33	311.78 ± 2.97	0.124
IL-6^d (pg mL^−1)	301.75 ± 4.44	331.37 ± 2.33^a	<0.001
IL-10^e (pg mL^−1)	142.74 ± 2.33	156.82 ± 1.81^a	0.001
TNF-α^f (pg mL^−1)	324.99 ± 15.58	355.45 ± 7.75	0.118
IgG^g (μg mL^−1)	261.92 ± 9.56	315.69 ± 11.56^a	0.007
IgA^h (μg mL^−1)	51.79 ± 2.45	79.59 ± 5.50^a	0.001
IgM^i (μg mL^−1)	130.05 ± 8.34	132.60 ± 7.04	0.820
Mucosal sIgA^j (mg g^−1 protein)
Duodenum	3.66 ± 0.11	5.00 ± 0.06^a	<0.001
Jejunum	4.39 ± 0.12	5.01 ± 0.05^a	0.004
Ileum	10.99 ± 0.13	11.95 ± 0.02^a	0.004

---

Intestinal morphological structure

The HE staining results are shown in Fig. 1. We found that the duodenal morphological structure was significantly affected by ALGO supplementation; subsequently, we calculated the villus height and crypt depth in two groups (Table 6). We also observed the morphological structure in jejunum and ileum; however, there were no differences between the two groups.

Fig. 1 Histological evaluation of intestinal tissues (HE × 40) after exposure to alginic acid oligosaccharide. CON, a corn–soybean basal diet; ALGO, alginic acid oligosaccharide (the basal diet supplemented with 100 mg kg⁻¹ alginic acid oligosaccharide).

Table 6 Effects of alginic acid oligosaccharide on the intestinal mucosa morphology of weaned pigs^a,b

Items	Treatments		P-Value
	CON	ALGO
a *P < 0.05 versus the CON group. **P < 0.01 versus the CON group. CON, a corn–soybean basal diet; ALGO, alginic acid oligosaccharide (the basal diet supplemented with 100 mg kg^−1 alginic acid oligosaccharide).b Values are means of eight replicates per treatment.c V/C, the ratio of villus height to crypt depth.
Duodenum
Villus height (μm)	468.41 ± 7.29	513.58 ± 4.33**	<0.001
Crypt depth (μm)	233.01 ± 4.35	230.89 ± 7.80	0.816
V/C^c	2.02 ± 0.05	2.24 ± 0.07*	0.023
Jejunum
Villus height (μm)	310.96 ± 12.51	328.59 ± 11.07	0.309
Crypt depth (μm)	155.77 ± 9.85	160.85 ± 5.85	0.664
V/C^c	2.04 ± 0.13	2.07 ± 0.12	0.861
Ileum
Villus height (μm)	446.71 ± 13.00	461.14 ± 15.20	0.482
Crypt depth (μm)	203.63 ± 7.67	203.35 ± 2.32	0.973
V/C^c	2.22 ± 0.12	2.27 ± 0.07	0.718

---

Table 6 presents the specific morphological indices of the small intestine (duodenum, jejunum and ileum). ALGO significantly increased (P < 0.05) the villus height and V/C in the duodenum of ALGO-treated pigs by 9.64% and 10.89%, respectively, in comparison with the CON group.

Disaccharidase activities

In the duodenum, the maltase, lactase and sucrose activities were not affected (P > 0.05) by dietary treatment. Compared with the jejunal samples of the CON group, the jejunum of ALGO-treated pigs revealed a significant increase (P < 0.05) in the lactase activity by 18.25%; meanwhile, no marked change (P > 0.05) on maltase activity was noted. Inclusion of ALGO in the diet significantly increased (P < 0.05) the jejunal and ileal sucrose activity by 37.75% and 27.59%, respectively. Moreover, maltase and lactase activities in the ileum did not differ (P > 0.05) between the ALGO group and the CON group (Table 7).

Table 7 Effects of alginic acid oligosaccharide on the disaccharidase activities of weaned pigs^a,b

Items	Treatments		P-Value
	CON	ALGO
a *P < 0.05 versus the CON group. **P < 0.01 versus the CON group. CON, a corn–soybean basal diet; ALGO, alginic acid oligosaccharide (the basal diet supplemented with 100 mg kg^−1 alginic acid oligosaccharide).b Values are means of eight replicates per treatment.
Duodenum (U mg^−1 protein)
Maltase	224.36 ± 4.82	234.44 ± 7.61	0.306
Lactase	44.38 ± 2.37	51.40 ± 0.43	0.057
Sucrase	23.91 ± 1.39	26.26 ± 0.81	0.195
Jejunum (U mg^−1 protein)
Maltase	201.41 ± 2.15	212.97 ± 9.46	0.312
Lactase	181.20 ± 8.33	214.27 ± 6.85*	0.022
Sucrase	99.73 ± 3.48	137.38 ± 8.01**	0.005
Ileum (U mg^−1 protein)
Maltase	210.68 ± 10.66	235.01 ± 6.31	0.097
Lactase	78.25 ± 3.21	87.70 ± 2.60	0.063
Sucrase	76.40 ± 3.24	97.48 ± 3.99**	0.006

---

Intestinal barrier function

The data for gene expression of CLDN-1, OCLN and ZO-1 are shown in Fig. 2. The mRNA expression of OCLN in the duodenum, jejunum and ileum were increased (P < 0.05) by ALGO supplementation. Dietary supplementation with ALGO also increased (P < 0.05) the abundance of ZO-1 in the duodenum, but not (P > 0.05) in the jejunum and ileum. Furthermore, no effect (P > 0.05) of dietary ALGO supplementation was detected on the abundance of CLDN-1 in the duodenum, jejunum and ileum.

Fig. 2 Effects of dietary alginic acid oligosaccharide supplementation on the relative mRNA expression of tight junction proteins in the duodenal (A), jejunal (B) and ileal (C) mucosa of weaned pigs. Values are means (8 pigs per treatment) with standard errors represented by vertical bars. *P < 0.05 and **P < 0.01 (indicates that the relative mRNA expression of the tight junction proteins in the ALGO group is significantly higher than that in the CON group). CON, a corn–soybean basal diet; ALGO, alginic acid oligosaccharide (the basal diet supplemented with 100 mg kg⁻¹ alginic acid oligosaccharide). CLDN-1, claudin 1; OCLN, occludin; ZO-1, zonula occludens 1.

Intestinal microflora

Microbial population changes in the ileum, caecum and colon observed after ALGO supplementation are listed in Table 8. There was no effect (P > 0.05) of the diets on Bacillus populations in pigs. In the ileum, an increase (P < 0.05) in the Bifidobacterium and Lactobacillus populations were found in pigs fed the ALGO diet compared with those on the CON diet, while the total bacteria and Escherichia coli populations were unaffected (P > 0.05) by dietary treatment. Compared with the CON diet, pigs supplemented with the ALGO diet had lower (P < 0.05) caecal total bacteria and Escherichia coli populations. Meanwhile, the Bifidobacterium and Lactobacillus populations in the caecum were observed to have no differences (P > 0.05) between pigs fed each diets. ALGO supplementation prominently decreased (P < 0.05) the total viable counts of Escherichia coli in the colonic digesta. However, no significant effect (P > 0.05) of ALGO supplementation was found on the total bacteria, Bifidobacterium and Lactobacillus populations in the colon.

Table 8 Effects of alginic acid oligosaccharide on the intestinal microflora of weaned pigs^b

Items	Bacteria content (lg (copies per g))		P-Value
	Treatments
	CON	ALGO
a P < 0.05 versus the CON group. CON, a corn–soybean basal diet; ALGO, alginic acid oligosaccharide (the basal diet supplemented with 100 mg kg^−1 alginic acid oligosaccharide).b Values are means of eight replicates per treatment.
Ileum
Total bacteria	10.52 ± 0.27	10.27 ± 0.13	0.440
Bifidobacterium	7.10 ± 0.06	8.04 ± 0.27^a	0.038
Lactobacillus	7.45 ± 0.39	8.92 ± 0.24^a	0.018
Escherichia coli	8.04 ± 0.47	7.62 ± 0.36	0.502
Bacillus	10.03 ± 0.04	10.04 ± 0.03	0.780
Caecum
Total bacteria	11.65 ± 0.08	9.90 ± 0.45^a	0.027
Bifidobacterium	9.50 ± 0.18	10.12 ± 0.24	0.085
Lactobacillus	8.55 ± 0.29	8.74 ± 0.15	0.586
Escherichia coli	8.84 ± 0.30	7.70 ± 0.30^a	0.035
Bacillus	10.06 ± 0.07	10.15 ± 0.01	0.260
Colon
Total bacteria	11.56 ± 0.09	10.60 ± 0.60	0.206
Bifidobacterium	9.99 ± 0.04	10.55 ± 0.24	0.100
Lactobacillus	8.52 ± 0.17	8.75 ± 0.19	0.403
Escherichia coli	8.18 ± 0.25	7.15 ± 0.33^a	0.046
Bacillus	10.09 ± 0.03	10.60 ± 0.18	0.066

---

Discussion

Oxidative stress is an imbalance between the generation of reactive oxygen species and the antioxidant defence capacity of the body.³³ For weaned pigs, weaning and infection can lead to oxidative stress, which may cause enormous damage to the cellular antioxidant defence. ALGO, derived from various edible brown seaweed extracts, could be used as a rich source of natural antioxidants. In the present study, ALGO distinctly decreased MDA content in serum, which shows that lipid peroxidation could be decreased by ALGO.³⁴ It is well known that SOD and CAT play crucial roles in preventing oxidative damage.^35,36 In particular, SOD is the first endogenous antioxidant enzyme to respond to toxic compounds and oxygen radicals by reducing H₂O₂ accumulation and organic hydroperoxide conversion into H₂O₂ and O₂.³⁷ Therefore, we further investigated the influences of ALGO on the SOD and CAT activities in the serum. As expected, the SOD and CAT activities in the serum were significantly enhanced by dietary ALGO supplementation, thus indicating the antioxidant ability of the compound.^37,38 In addition, increased T-AOC was observed in the present study, which further suggested the antioxidant ability of ALGO.³⁹ Taken together, these results suggest that ALGO could be adopted as an excellent candidate to follow bioactive antioxidants to improve antioxidant capacity in weaned pigs.

Improvements in the immune defences of weaned pigs are beneficial to the serum immunoglobulins and cytokines.⁴⁰ The results of our present study showed that serum IL-10, IgG and IgA concentrations were increased by ALGO supplementation, which are indicators of the activated immune system.⁴¹ These data signify that dietary ALGO supplementation enhanced pig immune function, in part, through promoting immunoglobulins and cytokines concentrations. Furthermore, we found that ALGO can improve the sIgA concentration in the intestinal mucosal, which constitutes the largest antibody system of the body (principally being anti-inflammatory).⁴² Thus, we conclude from all of the previously mentioned evidence that ALGO has a beneficial effect to induce an immune response in weaned pigs by modulating the production of cytokines and antibodies, which may be a contributing factor for ALGO to enhance growth performance. Our results also agree with that of a previous study that ALGO supplementation can suppress the inflammatory effect in vivo.¹⁵

Generally, the ratio of villus height to crypt depth represents the absorption capacity of the small intestine.⁴³ In the present study, villus height and the ratio of villus height to crypt depth in the duodenum were increased relative to those in the CON group, which suggest that ALGO influences pig intestinal absorption capacity by regulating morphological structures. In addition, we probed the influences of ALGO supplementation on intestinal enzymatic activity. Our results showed that ALGO supplementation significantly increased the lactase and sucrase activities in the jejunum as well as the sucrase activity in the ileum, namely that the development of disaccharidase activities can be induced by ALGO supplementation. As previously mentioned, the activities of lactase, maltase and sucrase play crucial roles in degrading disaccharides.⁴⁴ In support of this notion, we speculated that ALGO supplementation also can facilitate intestinal absorptive capacity through facilitating disaccharidase activities in weaned pigs. In general, these results demonstrate that ALGO supplementation can promote the development of the small intestine in weaned pigs and improve intestinal digestive and absorptive functions for nutrient substances.

A recent study disclosed that the gastrointestinal tract plays a central role as a physiological barrier between the outer environment and the body.⁴⁵ The paracellular barrier function of intestinal epithelia is thought to be regulated by tight junction proteins (including CLDN-1, OCLN and ZO-1).^46,47 Considering the fact that these proteins play a critical role in intestinal epithelial barrier integrity, we assayed the relative mRNA expression of CLDN-1, OCLN and ZO-1 in the small intestine between the two treatment groups. Here, we observed that OCLN mRNA expression in the whole small intestine (duodenum, jejunum and ileum) and ZO-1 mRNA expression in the duodenum were higher in the ALGO group than in the CON group, suggesting that these pigs have improved intestinal integrity.⁴⁸ In our opinion, the elevated intestinal integrity and function in ALGO-treated weaned pigs appear to be mediated through accelerated intestinal growth and development. Our findings provide new insights into the effects of seaweed extracts or oligosaccharides supplementation on the intestinal integrity of weaned pigs. However, the molecular mechanisms by which ALGO mediates tight junction alterations are still not clear, and further exploration of this topic is necessary.

Dietary supplementation with various oligosaccharides has been shown to have different effects on the intestinal microflora populations.^49–51 In the present study, we were surprised to discover that dietary ALGO supplementation selectively regulates intestinal microflora, including stimulating the growth of health-promoting bacterial species (Bifidobacterium and Lactobacillus) and suppressing the growth of potential pathogenic bacterial species (Escherichia coli). With an increase in the Bifidobacterium and Lactobacillus populations in the intestine of pigs fed the ALGO diet, the establishment of Escherichia coli was inhibited possibly by a phenomenon known as competitive exclusion, first referred to as colonisation resistance.⁵² In addition, Konstantinov et al.⁵³ indicated that a healthy and stable microflora prevents the development of intestinal diseases and results in improved performance. In view of the previously mentioned reasoning, we summarised that the increased populations of Bifidobacterium and Lactobacillus and the decreased populations of total bacteria and Escherichia coli in the intestine improved the intestinal health in response to dietary ALGO supplementation, which may be associated with the changes in the intestinal barrier integrity.⁵⁴ These findings furthered our understanding of the mechanism underlying the causative action of ALGO supplementation in preventing the development of intestinal diseases.

Conclusions

Our results first indicated that ALGO has potential benefits that serve as a bioactive feed additive in the pig industry. Supplementing the diet with 100 mg kg⁻¹ ALGO could enhance weaned pig growth performance by boosting antioxidant capacity, immunity and intestinal development, which affords an excellent health status for rapid growth. This novel and important finding has important practical implications for enhancing growth in pigs. Further, these results provide a necessary foundation for future studies to define the mechanisms responsible for the beneficial effects of ALGO in improving growth performance in weaned pigs.

Competing interests

The authors declare that they have no competing interests.

Ethics approval and consent to participate

All experimental procedures for the present study were approved by the Animal Management Rules of the Ministry of Health of the People's Republic of China and the Animal Care and Use Committee of Sichuan Agricultural University.

Acknowledgements

We wish to thank Kaiyun Yang, Quyuan Wang and Huifen Wang for their assistance during the experiments. We also would like to thank Likun Cheng, Heng Yin and Yuguang Du for their immeasurable help in determining the composition of ALGO. This work was supported by the Special Fund for Agro-scientific Research in the Public Interest (201403047), the Fok Ying-Tung Education Foundation (141027) and the National Natural Science Foundation of China (31372347).

References

1. J. Wan, Y. Li, D. W. Chen, B. Yu, P. Zheng, X. B. Mao, J. Yu and J. He, J. Microbiol. Biotechnol., 2016, 26, 461–468.
2. W. Wijesinghe and Y. J. Jeon, Phytochem. Rev., 2011, 10, 431–443.
3. S. Gupta and N. Abu Ghannam, Trends Food Sci. Technol., 2011, 22, 315–326.
4. D. H. Ngo and S. K. Kim, Int. J. Biol. Macromol., 2013, 62, 70–75.
5. B. W. Souza, M. A. Cerqueira, A. I. Bourbon, A. C. Pinheiro, J. T. Martins, J. A. Teixeira, M. A. Coimbra and A. A. Vicente, Food Hydrocolloids, 2012, 27, 287–292.
6. C. Y. Zhang, W. H. Wu, J. Wang and M. B. Lan, Mar. Drugs, 2012, 10, 119–130.
7. T. Barahona, N. P. Chandía, M. V. Encinas, B. Matsuhiro and E. A. Zúñiga, Food Hydrocolloids, 2011, 25, 529–535.
8. T. S. Vo, D. H. Ngo and S. K. Kim, Process Biochem., 2012, 47, 386–394.
9. K. O. Lins, D. P. Bezerra, A. P. N. Alves, N. Alencar, M. W. Lima, V. M. Torres, W. R. Farias, C. Pessoa, M. O. de Moraes and L. V. Costa Lotufo, J. Appl. Toxicol., 2009, 29, 20–26.
10. N. Sithranga Boopathy and K. Kathiresan, J. Oncol., 2010, 2010, 214186.
11. M. Ciancia, I. Quintana and A. S. Cerezo, Curr. Med. Chem., 2010, 17, 2503–2529.
12. B. Mulloy, P. A. S. Mourao and E. Gray, J. Biotechnol., 2000, 77, 123–135.
13. M. Asada, M. Sugie, M. Inoue, K. Nakagomi, S. Hongo, K. Murata, S. Irie, T. Takeuchi, N. Tomizuka and S. Oka, Biosci., Biotechnol., Biochem., 1997, 61, 1030–1032.
14. K. Pandi and N. Viswanathan, Carbohydr. Polym., 2015, 118, 242–249.
15. T. Uno, M. Hattori and T. Yoshida, Biosci., Biotechnol., Biochem., 2006, 70, 3054–3057.
16. T. Yoshida, A. Hirano, H. Wada, K. Takahashi and M. Hattori, Int. Arch. Allergy Immunol., 2004, 133, 239–247.
17. W. H. Zhu, D. F. Li, H. Wu, J. T. Li, Y. Q. Chen, H. S. Guan and L. Y. Zhang, Anim. Feed Sci. Technol., 2016, 216, 161–168.
18. C. M. Yang, P. R. Ferket, Q. H. Hong, J. Zhou, G. T. Cao, L. Zhou and A. G. Chen, J. Anim. Sci., 2012, 90, 2671–2676.
19. J. M. Heo, F. O. Opapeju, J. R. Pluske, J. C. Kim, D. J. Hampson and C. M. Nyachoti, J. Anim. Physiol. Anim. Nutr., 2013, 97, 207–237.
20. C. H. Hu, L. Y. Gu, Z. S. Luan, J. Song and K. Zhu, Anim. Feed Sci. Technol., 2012, 177, 108–115.
21. P. J. Wijtten, J. van der Meulen and M. W. Verstegen, Br. J. Nutr., 2011, 105, 967–981.
22. L. H. Zhu, K. L. Zhao, X. L. Chen and J. X. Xu, J. Anim. Sci., 2012, 90, 2581–2589.
23. J. Wan, K. Y. Yang, Q. S. Xu, D. W. Chen, B. Yu, Y. H. Luo and J. He, RSC Adv., 2016, 6, 70715–70722.
24. J. Wan, Y. Li, D. W. Chen, B. Yu, G. Chen, P. Zheng, X. B. Mao, J. Yu and J. He, Anim. Feed Sci. Technol., 2016, 211, 216–226.
25. National Research Council, Nutrient Requirements of Swine, National Academics Press, Washington, DC, 11th edn, 2012.
26. D. R. Livingstone, P. G. Martinez, X. Michel, J. Narbonne, S. O'hara, D. Ribera and G. Winston, Funct. Ecol., 1990, 415–424.
27. W. Cao, G. M. Liu, T. T. Fang, X. J. Wu, G. Jia, H. Zhao, X. L. Chen, C. M. Wu, J. Wang and J. Y. Cai, RSC Adv., 2015, 5, 76607–76614.
28. H. Aebi, Methods Enzymol., 1984, 105, 121–126.
29. N. J. Miller, C. Rice Evans, M. J. Davies, V. Gopinathan and A. Milner, Clin. Sci., 1993, 84, 407–412.
30. E. Beutler, Red cell metabolism: a manual of biochemical methods, Grune & Stratton, 1975.
31. K. J. Livak and T. D. Schmittgen, Methods, 2001, 25, 402–408.
32. G. Q. Han, Z. T. Xiang, B. Yu, D. W. Chen, H. W. Qi, X. B. Mao, H. Chen, Q. Mao and Z. Q. Huang, Mol. Biol. Rep., 2012, 39, 1869–1876.
33. P. Zheng, B. Yu, J. He, G. Tian, Y. H. Luo, X. B. Mao, K. Y. Zhang, L. Q. Che and D. W. Chen, Br. J. Nutr., 2013, 109, 2253–2260.
34. L. Feng, S. Zhao, G. F. Chen, W. D. Jiang, Y. Liu, J. Jiang, K. Hu, S. H. Li and X. Q. Zhou, Fish Physiol. Biochem., 2014, 40, 499–510.
35. T. T. Fang, G. M. Liu, W. Cao, X. J. Wu, G. Jia, H. Zhao, X. L. Chen, C. M. Wu and J. Wang, RSC Adv., 2016, 6, 31323–31335.
36. S. B. Nimse and D. Pal, RSC Adv., 2015, 5, 27986–28006.
37. G. W. Winston and R. T. Di Giulio, Aquat. Toxicol., 1991, 19, 137–161.
38. M. David, V. Munaswamy, R. Halappa and S. R. Marigoudar, Pestic. Biochem. Physiol., 2008, 92, 15–18.
39. W. K. Ren, Y. L. Yin, G. Liu, X. L. Yu, Y. H. Li, G. Yang, T. J. Li and G. Y. Wu, Amino Acids, 2012, 42, 2089–2094.
40. S. D. Wu, F. R. Zhang, Z. M. Huang, H. Liu, C. Y. Xie, J. Zhang, P. A. Thacker and S. Y. Qiao, Peptides, 2012, 35, 225–230.
41. J. G. Bode, U. Albrecht, D. Häussinger, P. C. Heinrich and F. Schaper, Eur. J. Cell Biol., 2012, 91, 496–505.
42. P. Brandtzaeg and F. E. Johansen, Immunol. Rev., 2005, 206, 32–63.
43. L. Montagne, J. R. Pluske and D. J. Hampson, Anim. Feed Sci. Technol., 2003, 108, 95–117.
44. Z. B. Cheng, D. F. Li, J. J. Xing, X. Y. Guo and Z. J. Li, Anim. Sci., 2006, 82, 621–626.
45. J. PLalles, J. Anim. Sci., 2012, 90, 421–429.
46. L. Elkouby Naor and T. Ben Yosef, Int. Rev. Cell Mol. Biol., 2010, 279, 1–32.
47. I. E. Blasig, C. Bellmann, J. Cording, G. d. Vecchio, D. Zwanziger, O. Huber and R. F. Haseloff, Antioxid. Redox Signaling, 2011, 15, 1195–1219.
48. B. K. Zhang and Y. M. Guo, Br. J. Nutr., 2009, 102, 687–693.
49. L. F. Jiao, Z. H. Song, Y. L. Ke, K. Xiao, C. H. Hu and B. Shi, Anim. Feed Sci. Technol., 2014, 195, 85–91.
50. J. Song, L. F. Jiao, K. Xiao, Z. S. Luan, C. H. Hu, B. Shi and X. A. Zhan, Anim. Feed Sci. Technol., 2013, 185, 175–181.
51. M. Castillo, S. M. Martin Orue, J. A. Taylor Pickard, J. F. Perez and J. Gasa, J. Anim. Sci., 2008, 86, 94–101.
52. D. Van der Waaij, J. M. Berghuis de Vries and J. E. C. Lekkerkerk Van der Wees, J. Hyg., 1971, 69, 405–411.
53. S. R. Konstantinov, A. A. Awati, B. A. Williams, B. G. Miller, P. Jones, C. R. Stokes, A. D. Akkermans, H. Smidt and W. M. De Vos, Environ. Microbiol., 2006, 8, 1191–1199.
54. R. C. Anderson, A. L. Cookson, W. C. McNabb, Z. Park, M. J. McCann, W. J. Kelly and N. C. Roy, BMC Microbiol., 2010, 10, 316.
55. H. Chen, X. B. Mao, J. He, B. Yu, Z. Q. Huang, J. Yu, P. Zheng and D. W. Chen, Br. J. Nutr., 2013, 110, 1837–1848.

---

Footnote

† Contributed equally.

---