Crystal structure analysis of phycocyanin from chromatically adapted Phormidium rubidum A09DM

Abstract

Phycobilisome (PBS), a light harvesting complex of phycobili proteins found in cyanobacteria and red algae, funnels photo-energy to chlorophyll through the network of covalently attached light absorbing chromophores. Phycocyanin, a component protein of PBS, was over-expressed using monochromatic red light in place of white light by chromatically adapted Phormidium rubidum A09DM. The phycocyanin protein, having α- and β-subunits, was isolated and purified in active and chromophorylated form as adjudged by PAGE, MALDI-TOF and spectroscopic analysis. The crystals, obtained using PEG-3350 as a precipitant, belong to the P6₃ space group with unit cell parameters a = b = 102.40 Å, c = 109.05 Å. The structure has been refined to a crystallographic R factor of 20.7% (R_free, 25.8%) using X-ray diffraction data extending up to 2.7 Å resolution. The asymmetric unit consists of two αβ monomers. The functional unit [(αβ)₃]₂ hexamer is generated by the application of crystal symmetry. The overall tertiary structure of α- and β-subunits and hexameric quaternary fold of the Phormidium protein resemble the other reported PC structures, except for the conformation of chromophore attached to βCys-153. The structure and sequence analyses reveal that residues αPhe-28, αGln-33 and αAsp-145 (of α-subunit) are co-evolving and play a key role in determining the conformation of this chromophore. These phycocyanins cluster together in an evolutionary tree and are expected to have evolved later.

---

Introduction

Phycobilisomes (PBS) are the large molecular antenna complexes present in cyanobacteria and red algae.¹ These capture visible light in the wavelength range 450–670 nm and funnel the light-energy to the photosynthetic reaction centre through a network of light absorbing fluorescent chromophores.^2–4 The PBS is composed of phycobili proteins (PBPs) along with linker peptides (LPs) that are arranged with six to eight rods radiating out from a two/three/five cylindrical core.^5–7 Rods are made up of phycocyanin (PC, λ_max ∼ 620 nm) and/or phycoerythrin/phycoerythrocyanin (PE/PEC, λ_max ∼ 540–578 nm), and rod linkers, whereas the core is made up of allophycocyanin (APC, λ_max ∼ 653 nm), with terminal emitters allophycocyanin-B (AP-B, λ_max ∼ 670 nm) and a core membrane linker (L_CM, λ_max ∼ 655–660 nm).^8–10 All over assembly of PBS enables the cyanobacteria to capture and transfer photo-energy in the direction from PE/PEC → PC → APCs → terminal emitters → chlorophyll, with an overall efficiency of almost 100%.¹¹ All PBPs share significant sequence and structural similarity and have evolved from the common ancestor.¹² The building block of all PBPs is a hetero-dimer of α and β subunits, commonly referred as αβ monomer, which further assembles to form (αβ)₃ trimers and [(αβ)₃]₂ hexamers.^13–15 The spectral properties of PBPs are dependent on the chemical nature and stereochemistry of the chromophore that is predominantly decided by the chromophore binding site residues.^16,17

Many, but not all, cyanobacteria have been reported to undergo chromatic complementary adaptation (CCA) phenomenon, in which, rod composition of PBS is optimized upon exposure to various colors (wavelengths) of light. This phenomenon enables cyanobacteria to harvest adequate light-energy for photosynthesis.¹⁸ It has been recently reported that far-red photoaclimated cyanobacteria can absorb in 700–750 nm wavelength range to be able to grow in far-red light by remodeling their PBS complex and photosystem.¹⁹ The molecular basis of this light responsive phenomenon is still unclear. Marine cyanobacterium Phormidium rubidum A09DM, isolated from rocky shore of Okha, Gujarat, India is found to express CCA phenotype upon exposure of various colors (wavelengths) of light. Molecular and structural information of light acclimatized PBS will provide better information regarding mechanism of energy transfer in restricted light environments. We report here a detailed crystal structure of PC produced by Phormidium rubidum A09DM under restricted light (red light) environment. The structure revealed subtle differences in chromophore conformation, compared to many phycocyanins, which can be ascribed to co-evolution of three residues in the α-subunit.

Materials and methods

Expression, purification and characterization of Phormidium phycocyanin

The phycocyanin protein was purified from marine cyanobacterium – Phormidium rubidum A09DM, isolated from rocky shores of Okha, Gujarat, India. It was cultivated under standard laboratory conditions as described earlier.^20,21 Briefly, the cyanobacterial culture were grown in artificial salt nutrient (ASN)-III medium under 12 : 12 hours light : dark illumination (36 W red light lamps; 130 μmol photons per m² s) cycles at 27 ± 2 °C. Protein expression was induced by replacement of white light illumination with red light after 5 days from inoculation.

Phycocyanin was isolated and purified by well-established protocols.^14,22,23 The exponentially growing cyanobacterial cells (28 days after inoculation) were harvested by centrifugation at 3000g for 15 min (Kubota 6500, Bunkyo-Ku, Tokyo, Japan) at 20 °C. The cell pellet was washed and re-suspended in the extraction buffer (10 mM Tris–HCl buffer, pH 8.1). Cells were lysed by repeated freeze–thaw cycles from −25 °C to 4 °C temperature. The cellular debris was removed by centrifugation at 10000g for 30 min. The dark blue supernatant, obtained after centrifugation, was subjected to 20–70% ammonium sulfate precipitation to retain PC in the precipitate. PC pellet (after solubilizing in 10 mM Tris–HCl, pH 8.1) was purified using Sephadex G-150 gel permeation sieve column (350 × 10 mm) using 10 mM Tris–HCl, pH 8.1 as mobile phase. Fractions containing PC were further purified using weak anion exchanger, DEAE-cellulose. The pure PC protein was concentrated and stored in 10 mM Tris–HCl, pH 8.1 buffer, in dark at 4 °C. The protein concentration was determined by Lowry's method with BSA as standard. PC contents were also calculated from UV-visible spectrum using equation of Bennett & Bogorad.²⁴

Characterization of PC

Purity, homogeneity, integrity and functionality of purified PC were examined by well-established standard biochemical methods.²⁵ Native-PAGE and SDS-PAGE were performed to access the purity, homogeneity and subunit composition using silver staining. Gel slabs were also stained with bilin specific zinc-acetate staining according to Berkelman & Lagarias to visualize the bilin containing proteins as fluorescence band.²⁶

The absorbance spectra of purified PC and denatured PC (at pH 2.0 with 8 M Urea) were recorded over 250–750 nm wavelength range on UV-visible spectrophotometer (Analytik Jena AG Specord 210) at 25 °C to adjudge the purity, functionality and type of chromophore.²⁷ The purity of protein was probed as ‘purity ratio’, calculated by formula A₆₁₆/A₂₈₀. Moreover, fluorescence emission of PC was traced upon excitation at 589 nm by fluorescence spectrophotometer (F-7000, Hitachi High Technologies) to verify their functionality.

Sequence determination

Sequences of α- and β-subunits of PC were deduced from their gene sequences. Genes, cpcA and cpcB were PCR amplified from Phormidium genomic DNA. Primers were designed based on conserved nucleotide sequences of PC genes available in database. Primer set (forward: 5′ ATGAAGACTCCTTTAACCGAAGCTG 3′, reverse: 5′ CTAGCTCAGAGCGTTGATGGC 3′) were used to amplify cpcA gene, while cpcB gene was amplified using primers set (forward: 5′ ATGTTTGACGCCTTCACTAAGGT 3′, reverse: 5′ CAGCTTCGGTTAAAGGAGTCTTCAT 3′). The amplified PCR products were sequenced by automated DNA analyzer 3730xl using BigDyeTM Terminator 3.1 sequencing chemistry (Applied Biosystems, Foster City, CA). The partial gene sequences of α- and β-subunits of PC derived from this study were submitted to European Nucleotide Archives (ENA) with the accession nos. LN713954 and LN713955, respectively (GenBank accession nos. LN713954.1 and LN713955.1).

Crystallization and data processing

Purified phycocyanin protein was concentrated to 10 mg ml⁻¹ in storage buffer (10 mM Tris–HCl, pH 8.1). The protein was screened for crystallization using pre-formulated commercial JCSG plus and PACT screens (Qiagen), using sitting drop vapor-diffusion method. The initial hits were further optimized by hanging drop method with laboratory buffers. The crystals used in diffraction experiments were obtained with solution containing 18.5% PEG 3350 and 0.1 M sodium citrate buffer (pH 6.0) using hanging-drop vapor-diffusion method. Crystals were transferred to cryo-protectant solution having 10% PEG 400 along with crystallization mother liquor prior to freezing at 100 K in liquid N₂ stream. Diffraction intensity data were recorded at 100 K on CCD detector (TITAN) using in-house Agilent supernova system having a micro-focus sealed-tube X-ray source with multilayer optics operated at 50 kV and 0.8 mA (Cu Kα). The intensity data were indexed and integrated using the XDS program²⁸ and were scaled, merged and truncated using Aimless and Ctruncate programs in CCP4 suite.²⁹

Structure solution and refinement

Initial phases for Phormidium PC structure were determined with molecular replacement method using MOLREP.³⁰ Crystal structure of PC from Spirulina plantensis (PDB ID, 3O18)¹³ was used as search model. The model shares nearly 75% (120 out of 162 residues for α-subunit and 134 out of 172 residues in β-subunit) sequence identity with PC from Phormidium rubidum A09DM. Atomic coordinates of αβ monomer having alanine at non-conserved/mismatch positions, after removing chromophores (phycocyanobilins) and water molecules, were used for molecular replacement solutions. Two αβ monomers were observed in the asymmetric unit. The phases were reasonably accurate as a clear electron density could be observed for phycocyanobilin chromophores not used in search model. The coordinates were subsequently refined by REFMAC5 (ref. 31) with intermittent model building using COOT.³² Refinement of the model was monitored by R_work and R_free. The geometry and stereochemistry of the models were analyzed throughout model building and refinement with the program PROCHECK.³³ The structural figures were prepared with the PYMOL package.³⁴

Sequence analysis and phylogenetic analysis

The homologous sequences for PC α- and β-subunits were retrieved from the Protein Data Bank (PDB) or Uniprot database using BLAST. The sequences were aligned with multiple sequence alignment tool clustal-omega (http://www.ebi.ac.uk/Tools/msa/clustalo/).³⁵ The phylogenetic analyses were conducted in MEGA6 (ref. 36) using the Neighbour-Joining Method. The evolutionary distances were computed using the JTT matrix-based method.³⁷ The sequence alignment figures were prepared with ESPript.³⁸

Results and discussion

Induction of PC expression

Expression of PC was induced by ‘complimentary chromatic adaptation’ (CCA) phenomenon. Red light was used in place of white light for the induction of PC expression. The change in cell mass pigmentation was indicative of shift from phycoerythrin to PC expression (Fig. 1). The increase in PC expression was also evident from the significant increase in absorbance (616 nm) in UV-visible spectra of red light grown Phormidium rubidum A09DM (Fig. 1). PC expression under red light was found highest at around 28^th days of incubation. Further incubation did not show significant increase in the PC content (Fig. S1†); hence 28 day old culture was taken for the extraction and purification of PC protein.

Fig. 1 Induction of phycocyanin production. UV-visible spectra of cell extract from white and red light grown Phormidium rubidum A09DM (inset – cell mass of Phormidium rubidum A09DM grown under white and red light).

Purification and characterization of PC

Two successive freeze–thaw cycles at −25 °C and 4 °C were enough for complete lyses of the cells. PC protein was successfully purified from soluble cell lysate by ammonium sulfate precipitation coupled with chromatographic techniques. Purified PC protein was assessed for purity, homogeneity, integrity and functionality by biochemical analysis.

Two bands, migrating corresponding to ∼18 kDa (PC-alpha subunit) and ∼20 kDa (PC-beta subunit), were observed on 12% SDS-PAGE (Fig. 2A). Same bands giving fluorescence upon UV-illumination in zinc acetate stained gel indicated the presence of phycocyanobilin chromophores with both α- and β-subunits of PC (Fig. 2A). Native-PAGE of purified PC confirmed the homogeneity and structure integrity by manifestation of only single band upon both silver as well as zinc acetate staining (Fig. 2B). Furthermore, the appearance of peak at 663 nm in the absorption spectrum of purified denatured PC under acidic urea condition identified the attached chromophores as phycocyanobilin (Fig. 2C). MALDI-TOF analysis also confirmed the presence of covalently linked chromophores with the purified PC protein. Two major lines at 18 026 Da and 19 335 Da were observed in MALDI-spectrum. The first peak corresponds to mass of chromophorylated α-subunit (theoretical mass of 17 344.7 Da deduced from amino acid sequence and chromophore expected mass of 588.7 Da). The second MALDI-TOF peak matched well with combined mass of β-subunit (18 097.5 Da deduced from sequence including the mass of additional methyl group at β-Asn72 due to post translational modification) and two covalently linked phycocyanobilin chromophores of 588.7 Da each.

Fig. 2 PAGE analysis under denaturation and native conditions. (A) Purified PC from Phormidium rubidum A09DM was resolved on 12% SDS-PAGE and visualized with silver staining and zinc acetate staining (specifically binds to chromophore). Two well resolved bands (18.0 and 19.5 kDa) were observed corresponding to the characteristic α- and β-subunits, respectively. (B) Silver stained and zinc acetate stained Native-PAGE of purified Phormidium PC. Only single band affirmed the purity and structural integrity of purified PC. Zinc acetate staining confirmed that purified Phormidium PC is chromophorylated. (C) UV-visible absorbance spectrum of purified denatured PC at pH 2.0 with 8 M urea.

The purified protein showed the phycocyanin characteristic absorption maximum at 616 nm and the fluorescence emission band centered at around 645 nm with excitation at 589 nm (Fig. 3). This confirmed the maintenance of functional state of the purified protein.

Fig. 3 UV-visible absorbance and fluorescence emission spectra (excitation at 589 nm) of purified PC from red light grown Phormidium rubidum A09DM.

Crystallographic analysis

The crystals obtained with solution containing 18.5% PEG 3350 and 0.1 M sodium citrate (pH 6.0) and using hanging-drop vapor-diffusion method diffracted the X-rays up to 2.7 Å resolution. Crystals belonged to P6₃ space group with unit cell parameters a = b = 102.35 Å, c = 109.02 Å. Data statistics are shown in Table 1. Initial phases were obtained with molecular replacement method using coordinates of αβ monomer (a heterodimer of α- and β-subunits) of Spirulina plantensis PC (PDB ID, 3O18). Each asymmetric unit contains two αβ monomers that corresponded to Matthew's coefficient 2.31 ų Da⁻¹ and 47% solvent content. The phases were reasonably accurate as clear electron density was observed for phycocyanobilin (CYC) chromophores, not used in search model (Fig. 4). The side chains of all residues including non-conserved residues (replaced with alanine in the search model) could easily be fitted into the electron density maps, except for αSer-37, αGln-78, αAsp-82, βAsp-25, βGlu-132, βSer-162 of both the αβ monomers in asymmetric unit. The side chains of these residues are not included in the final model. Presence of additional (unaccounted) electron density at βAsn-72 in both β-subunits in asymmetric unit suggested that these residues are methylated as observed in other known PC structures. The γ-N-methyl asparagine (MEN) residues were built instead of βAsn-72 in the model. The final structural model of the PC protein was refined to R_work (R_free) of 0.207 (0.258) against 2.7 Å resolution data. The model exhibits good stereochemistry, as evaluated with MOLPROBITY.³⁹ All residues were observed in the allowed region of Ramachandran's plot (98% in favored region and 1.7% in allowed region), except for βThr-75 of both the αβ monomers. The strained geometry of βThr-75 has also been observed in other PC structures.^13,14,16 The atomic coordinates have been submitted in the protein data bank (PDB ID, 4YJJ).

Table 1 Summary of data-collection and atomic model refinement statistics

a Values given in the brackets are for the highest resolution shell.
Unit cell	102.35, 102.35, 109.02 (Å), 90, 90, 120(°)
Space group	P63
Solvent content (%)	43.9
Resolution limits (Å)	19.35–2.7 (2.83–2.7)^a
Unique reflections	17 802
Redundancy	6.1 (4.0)
Completeness (%)	99.9 (100)
Rmerge	0.132 (0.421)
Mean I/mean σ(I)	12 (3.3)
Refinement statistics
Resolution range (Å)	19.35–2.7
Wilson B (Å^2)	24.5
Final Rwork/Rfree	0.207/0.258
Number of non-hydrogen atoms	5327
Ramachandaran plot (favored/allowed/disallowed)	98.0/1.7/0.3
RMSD bond lengths (Å)	0.011
RMSD bond angles (°)	2.08

---

Fig. 4 Electron density map fit of a phycocyanobilin chromophore (βCYC-202, covalently attached to βCys-153) in (2F_o − F_c) map drawn at 1.5σ contour level.

Structural analysis

The tertiary folds of α- and β-subunits of Phormidium PC are similar to that of other known PC structures. The superposition of the Phormidium PC α- or β-subunits with phycocyanins of F. diplosiphon (PDB ID, 1CPC) and T. vulcanus (PDB ID, 3O18) yielded RMSD between C_α atoms of 0.45 and 0.55 Å, respectively. In brief, both α- and β-subunits adopt very similar all helical globin-like fold (Fig. 5A) each comprising of eight helices. The RMSD between C_α atoms of α- and β-subunits is 1.9 Å. The two N-terminal helices of each subunit extend away from the rest of the subunit and make significant contacts with the other subunit to form a stable αβ monomer. These inter-subunit contacts are well conserved in all PC structures. This results in a burial of nearly 6380 Ų (30%) of the solvent accessible area with an estimated gain of nearly 72.6 kcal M⁻¹ of solvation free energy in the formation of αβ monomer, as calculated from PISA server.⁴⁰ Further, analysis of the crystal contacts suggested that the biologically active unit of Phormidium PC is a [(αβ)₃]₂ hexamer generated by crystallographic symmetry (Fig. 5B). Three of αβ monomers associate to form a disk like (αβ)₃ trimeric structure in which α-subunits of one monomer interact with the β-subunit of neighboring monomer. The [(αβ)₃]₂ hexamer is generated by the face to face interaction of two such trimeric disks, through their α-subunits, such that α-subunits are sandwiched between β-subunits of both the trimers. The total buried surface area in formation of hexamer is 62 070 Ų (49%) with an estimated gain of nearly 543.9 kcal M⁻¹ of solvation free energy. There are two such [(αβ)₃]₂ hexamers in the unit cell, placed one over another with only partial overlap such that it cannot further extend to form rod-like assemblies (Fig. 5B).

Fig. 5 (A) Cartoon representation of αβ monomer of Phormidium PC. The α-subunit is colored green, while β-subunit is colored cyan. The chromophores are labeled and shown as ball-stick representation. (B) Cartoon presentation of two [(αβ)₃]₂ hexamers observed in the unit cell in the crystal structure of Phormidium PC.

Three chromophores (phycocyanobilins; CYC), one with α-subunit and two with β-subunit, are covalently linked to the αCys-84, βCys-83 and βCys-153, respectively through thio–ether bonds and are named here as αCYC-201, βCYC-201 and βCYC-202. Each chromophore is comprised of four pyrrole rings (A–D) and was observed to have a curved structure. The curvatures of these chromophores (between pyrrole rings) were maintained by aspartates αAsp-87, βAsp-85 and βAsp-39, respectively as observed in other PC structures¹⁶ and these Asp residues are strictly conserved in all the PC sequences. The conformations of αCYC-201 and βCYC-201 are very similar in all available PC structures. Their binding site residues are also well conserved. The βCYC-202 chromophore, which resides on the outer surface of the trimeric ring, however is observed to have a stretched conformation where D-ring of the tetrapyrrole chromophore extends away and forms contacts with α-subunit of adjacent αβ monomer of PC. The detailed structural analysis of available PC structures revealed that βCYC-202 chromophore adopts either of the two preferred conformations in phycocyanin proteins. We analyze this to be dependent upon the microenvironment of the chromophore binding site. The protein micro-environment alone dictates the conformation of phycobilin chromophores has been observed from the structure of a phycoerythrin protein.⁴¹ The conf1 is observed in the present structure as well as PC structures from F. diplosiphon (PDB ID, 1CPC), S. elongatus (PDB ID, 4H0M), Synechocystis sp. PCC 6803 (PDB ID, 4F0T) and A. platensis (PDB ID, 1GH0), and conf2 is observed in T. vulcanus (PDB ID 3O18), C. caldarium (PDB ID 1PHN), G. violaceus (PDB ID, 2VJR), P. urceolata (PDB ID, 1F99) and G. chilensis (PDB ID, 2BV8) (Fig. 6). Both the conformations differ from each other with a rotation of ∼60° around the bond between ring-C and ring-D of the chromophore (marked in Fig. 6), such that delocalization of the conjugated double bonds can be expected to be more effective in conf1 stretched conformation. This could influence the spectral characteristics of different phycocyanin proteins. For instance, deviation from co-planarity of A–B rings in phycoerythrobilin has been shown to correlate with the π-coupling that governs the absorption characteristics of the phycoerythrin protein.^41,42 Peng et al.¹⁷ have also reported that enhanced planarity in B, C and D ring of phycocyanobilin chromophore in allophycocyanin and allophycocyanin-B leads to red-shift in their absorption maxima.

Fig. 6 Conformation of chromophore βCYC-202 attached to βCys-153 of β-subunit. Chromophore and neighboring residues of α-subunit and β-subunit within a distance of 6 Å from the chromophore atoms are displayed in stick representation. The pyrrole rings of the chromophore are labeled as (A), (B), (C) and (D). The chromophore adopts stretched conformation (conf1) in present structure. The hydrogen bonds stabilizing the D-ring conformation of the chromophores are displayed as dashed lines. Also shown here are the chromophores of superposed structures of T. vulcanus phycocyanin having conf2 conformation (PDB ID, 3O18; pink) and of F. diplosiphon phycocyanin having conf1 conformation (PDB ID, 1CPC; yellow) as wire model. The βCYC-202 chromophore was observed to adopt stretched conformation (conf1) in all the structures having αPhe-28, αGln-33 and αAsp-145 residues in their α-subunit.

The binding site analyses reveal that residues αPhe-28, αGln-33 and αAsp-145 present on the α-subunit of the Phormidium protein play the key role in the formation of stretched conformation of the chromophore. The conf2 is sterically hindered in the Phormidium protein due to the presence of bulkier residue αPhe-28 and the D-ring of the chromophore extends out. This conformation is stabilized by hydrogen bonds with αGln-33 and αAsp-145 of the adjacent αβ monomer at the trimer–trimer interface. These hydrogen bonds are formed between the O-atom of the carbonyl group of D-ring and N-atom of side-chain amide group of αGln-33; and between N-atom of D-ring of the chromophore and O-atom of carboxylate group of αAsp-145 (Fig. 6). The chromophore at this site (bound to βCys-153) has been earlier suggested to play role in alternate pathways for intra and inter-rod energy transfer.⁴³

The initial sequence and structure analysis using PC sequences from Protein Data Bank showed that the sequences having Phe residue at position 28 in the α-chain, invariably have αGln-33 and αAsp-145 as co-conserved residues. In all of these structures the chromophore at βCys-153 position adopts the conformation observed in present structure (conf1). In the phylogenetic analysis, conducted using Mega6, α-subunit sequences of PC with Phe-28, Gln-33 and Asp-145 residue are clustered on the same branch of phylogenetic tree (Fig. 7). Based on the branch length, it can be inferred that these PC sequences have evolved later in the evolution. For detailed analysis of the co-variance of residues in the chromophore binding site, we retrieved the PC sequences from the UniProtKB/Swiss-Prot sequence data base (reviewed sequences only). The sequences showed very high sequence similarity. Sequences having higher than 85% sequence identity were removed to reduce the redundancy. The multiple sequence alignment revealed that Phe-28, Gln-33 and Asp-145 residues in the α-subunit of the PC are co-conserved and co-evolving in a major sub-group of PC sequences (Fig. 8) with exception of Mastigocladus laminosus (UniProt ID, P00309) and Cyanophora paradoxa (Uniprot ID, P05730). The retrieved sequence of M. laminosus is a phycoerythrocyanin (PEC) and besides phycocyanobilin, it is also chromophorylated with phycoviolobilin chromophore.⁴⁴ The (αβ)₃ trimers of PEC display distinct absorption maximum at ∼576 nm, which is due to combined absorbance of phycocyanobilin and phycoviolobilin.⁴⁵ The C. paradoxa sequence also shares higher sequence similarity with M. laminosus and should be checked for its chromophore preference.

Fig. 7 (A) Multiple sequence alignment of α-subunit of PC sequences retrieved from Protein Data Bank. The alignment was performed using Clustal omega. The residue positions of Phe-28, Gln-33 and Asp-145 of Phormidium PC-alpha sequence are marked with ‘#’. (B) The phylogenetic tree generated using Neighbour-joining method using Mega6. The tree is drawn to scale, with branch lengths (next to the branches) in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the JTT matrix-based method. The PC sequences with three co-conserved residues (Phe-28, Gln-33 and Asp-145) are clustered on the same branch and are boxed.

Fig. 8 Multiple sequence alignment of α-subunit of PC sequences retrieved from Uniprot/Swissprot database of reviewed sequences. The sequences are named with their Uniprot ID. The residue positions of Phe-28, Gln-33 and Asp-145 of Phormidium PC-alpha (Phormodium-alpha) sequence are marked with ‘#’. The sequence of Mastigocladus laminosus (Uniprot ID, P00309) is marked with ‘*’ and is a PEC with phycoviolobilin chromophore. Also shown are PC-alpha sequences of Planktothrix agardhii (GenBank Accession 653002532) and Microcystis aeruginosa (GenBank Accession 488837520) found under deep water; and the βsubunit sequence of Phormidium PC (Phormodium-beta). The alignment was performed using Clustal omega.

Such co-conservation of functionally related residues is usually considered as adaptive evolution and allows proteins to acquire specific functional modifications while maintaining its overall structural-functional integrity.^46,47 To further find out whether these residues are helping the species to adapt in different ecological niches, we tried to find the sequences based on their habitat. It was observed that the PC in low-light adapted (deep sea inhabiting) cyanobacteria, including Planktothrix agardhii (GenBank Accession 653002532), Planktothrix rubescens and Microcystis aeruginosa (GenBank Accession 488837520), harbor Phe-28, Gln-33 and Asp-145 residues in their α-subunits. It would be interesting to see if the stretched conformation of chromophore with more effective π-delocalization is helping the species to adapt in low-light ecological niches.

Conclusions

We have resolved the crystal structure of chromatically induced phycocyanin of marine cyanobacterium Phormidium rubidum sp. A09DM. The protein is observed to exist as a [(αβ)₃]₂ hexamer in crystal form that is the known biological functional unit of the protein. The overall tertiary structure of α- and β-subunits and quaternary fold of the Phormidium PC resembles the other known PC structures from cyanobacteria and algae. However, the structural and sequence analyses revealed three co-evolving residue positions that determine the conformation of a phycocyanobilin chromophore suggested earlier to play role in alternate pathways for intra and inter-rod energy transfer.

Data bank submission and accession code

The DNA sequences of α- and β-subunits of PC have been deposited to European Nucleotide Archives with accession number LN713954 and LN713955, respectively. The atomic coordinates and structure factor files have been deposited in the RCSB Protein Data Bank, with accession code 4YJJ.

Acknowledgements

DM acknowledges University of Grant Commission (UGC), New Delhi for financial support in form of Centre of Advanced Study (CAS) program. RRS gratefully acknowledges Department of Science and Technology (DST), New Delhi and British Council for financial support in form of INSPIRE (IF120712) and Newton–Bhabha fellowships.

References

1. R. MacColl, Cyanobacterial Phycobilisomes, J. Struct. Biol., 1998, 124, 311–334.
2. N. K. Singh, R. R. Sonani, R. P. Rastogi and D. Madamwar, The phycobilisomes: an early requisite for efficient photosynthesis in cyanobacteria, EXCLI J., 2015, 14, 268–289.
3. M. Watanabe and M. Ikeuchi, Phycobilisome: architecture of a light-harvesting supercomplex, Photosynth. Res., 2013, 116, 265–276.
4. G. D. Scholes, G. R. Fleming, A. Olaya-Castro and R. van Grondelle, Lessons from nature about solar light harvesting, Nat. Chem., 2011, 3, 763–774.
5. N. Adir, Elucidation of the molecular structures of components of the phycobilisome: reconstructing a giant, Photosynth. Res., 2005, 85, 15–32.
6. A. N. Glazer, Light guides. Directional energy transfer in a photosynthetic antenna, J. Biol. Chem., 1989, 264, 1–4.
7. R. Huber, A Structural Basis of Light Energy and Electron Transfer in Biology (Nobel Lecture), Angew. Chem., Int. Ed., 1989, 28, 848–869.
8. N. Adir, Structure of the Phycobilisome Antennae in Cyanobacteria and Red Algae, in Photosynthetic Protein Complexes: A Structural Approach, WILEY-VCH Verlag GmbH & Co, KGaA, Weinheim, 2008, pp. 243–274.
9. K. Tang, W. L. Ding, A. Höppner, C. Zhao, L. Zhang, Y. Hontani, J. T. Kennis, W. Gärtner, H. Scheer, M. Zhou and K. H. Zhao, The terminal phycobilisome emitter, LCM: a light-harvesting pigment with a phytochrome chromophore, Proc. Natl. Acad. Sci. U. S. A., 2015, 112(52), 15880–15885.
10. K. H. Zhao, P. Su, S. Böhm, B. Song, M. Zhou, C. Bubenzer and H. Scheer, Reconstitution of phycobilisome core–membrane linker, LCM, by autocatalytic chromophore binding to ApcE, Biochim. Biophys. Acta, Bioenerg., 2005, 1706(1), 81–87.
11. E. Gantt and C. A. Lipschultz, Energy transfer in phycobilisomes from phycoerythrin to allophycocyanin, Biochim. Biophys. Acta, Bioenerg., 1973, 292, 858–861.
12. K. E. Apt, J. L. Collier and A. R. Grossman, Evolution of the Phycobiliproteins, J. Mol. Biol., 1995, 248, 79–96.
13. L. David, A. Marx and N. Adir, High-Resolution Crystal Structures of Trimeric and Rod Phycocyanin, J. Mol. Biol., 2011, 405, 201–213.
14. R. R. Sonani, G. D. Gupta, D. Madamwar and V. Kumar, Crystal Structure of Allophycocyanin from Marine Cyanobacterium Phormidium sp. A09DM, PLoS One, 2015, 10, 1–16.
15. R. R. Sonani, M. Sharma, G. D. Gupta, V. Kumar and D. Madamwar, Phormidium phycoerythrin forms hexamers in crystals: a crystallographic study, Acta Crystallogr., Sect. F: Struct. Biol. Commun., 2015, 71, 998–1004.
16. M. Duerring, G. B. Schmidt and R. Huber, Isolation, crystallization, crystal structure analysis and refinement of constitutive C-phycocyanin from the chromatically adapting cyanobacterium Fremyella diplosiphon at 1.66 Å resolution, J. Mol. Biol., 1991, 217, 577–592.
17. P. P. Peng, L. L. Dong, Y. F. Sun, X. L. Zeng, W. L. Ding, H. Scheer, X. Yang and K. H. Zhao, The structure of allophycocyanin B from Synechocystis PCC 6803 reveals the structural basis for the extreme redshift of the terminal emitter in phycobilisomes, Acta Crystallogr., Sect. D: Biol. Crystallogr., 2014, 70, 2558–2569.
18. D. M. Kehoe and A. R. Grossman, Complementary chromatic adaptation: photoperception to gene regulation, Semin. Cell Biol., 1994, 5, 303–313.
19. F. Gan, S. Zhang, N. C. Rockwell, S. S. Martin, J. C. Lagarias and D. A. Bryant, Extensive remodeling of a cyanobacterial photosynthetic apparatus in far-red light, Science, 2014, 345, 1312–1317.
20. B. Soni, B. Kalavadia, U. Trivedi and D. Madamwar, Extraction, purification and characterization of phycocyanin from Oscillatoria quadripunctulata—Isolated from the rocky shores of Bet-Dwarka, Gujarat, India, Process Biochem., 2006, 41, 2017–2023.
21. J. B. Waterbury and R. Y. Stanier, Isolation and growth of cyanobacteria from marine and hypersaline environments, in The prokaryotes, Springer, 1981, pp. 221–223.
22. N. K. Singh, A. Parmar, R. R. Sonani and D. Madamwar, Isolation, identification and characterization of novel thermotolerant Oscillatoria sp. N9DM: change in pigmentation profile in response to temperature, Process Biochem., 2012, 47, 2472–2479.
23. B. Soni, U. Trivedi and D. Madamwar, A novel method of single step hydrophobic interaction chromatography for the purification of phycocyanin from Phormidium fragile and its characterization for antioxidant property, Bioresour. Technol., 2008, 99, 188–194.
24. A. Bennett and L. Bogorad, Complementary chromatic adaption in a filamentous blue-green algae, J. Cell Biol., 1973, 58, 419–435.
25. A. Parmar, N. K. Singh, A. Kaushal, S. Sonawala and D. Madamwar, Purification, characterization and comparison of phycoerythrins from three different marine cyanobacterial cultures, Bioresour. Technol., 2011, 102, 1795–1802.
26. T. R. Berkelman and J. C. Lagarias, Visualization of bilin-linked peptides and proteins in polyacrylamide gels, Anal. Biochem., 1986, 156, 194–201.
27. A. N. Glazer and S. Fang, Chromophore content of blue-green algal phycobiliproteins, J. Biol. Chem., 1973, 248, 659–662.
28. W. Kabsch, XDS, Acta Crystallogr., Sect. D: Biol. Crystallogr., 2010, 66, 125–132.
29. M. D. Winn, C. C. Ballard, K. D. Cowtan, E. J. Dodson, P. Emsley, P. R. Evans, R. M. Keegan, E. B. Krissinel, A. G. W. Leslie, A. McCoy, S. J. McNicholas, G. N. Murshudov, N. S. Pannu, E. A. Potterton, H. R. Powell, R. J. Read, A. Vagin and K. S. Wilson, Overview of the CCP4 suite and current developments, Acta Crystallogr., Sect. D: Biol. Crystallogr., 2011, 67, 235–242.
30. A. Vagin and A. Teplyakov, Molecular replacement with it MOLREP, Acta Crystallogr., Sect. D: Biol. Crystallogr., 2010, 66, 22–25.
31. G. N. Murshudov, A. A. Vagin and E. J. Dodson, Refinement of Macromolecular Structures by the Maximum-Likelihood Method, Acta Crystallogr., Sect. D: Biol. Crystallogr., 1997, 53, 240–255.
32. P. Emsley, B. Lohkamp, W. G. Scott and K. Cowtan, Features and development of Coot, Acta Crystallogr., Sect. D: Biol. Crystallogr., 2010, 66, 486–501.
33. R. A. Laskowski, M. W. MacArthur, D. S. Moss and J. M. Thornton, PROCHECK: a program to check the stereochemical quality of protein structures, J. Appl. Crystallogr., 1993, 26, 283–291.
34. L. L. C. Schrödinger, The PyMOL Molecular Graphics System, Version∼1.8, 2015.
35. H. McWilliam, W. Li, M. Uludag, S. Squizzato, Y. M. Park, N. Buso, A. P. Cowley and R. Lopez, Analysis Tool Web Services from the EMBL-EBI, Nucleic Acids Res., 2013, 41, W597–W600.
36. K. Tamura, G. Stecher, D. Peterson, A. Filipski and S. Kumar, MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0, Mol. Biol. Evol., 2013, 30, 2725–2729.
37. D. T. Jones, W. R. Taylor and J. M. Thornton, The rapid generation of mutation data matrices from protein sequences, CABIOS, Comput. Appl. Biosci., 1992, 8, 275–282.
38. X. Robert and P. Gouet, Deciphering key features in protein structures with the new ENDscript server, Nucleic Acids Res., 2014, 42, W320–W324.
39. V. B. Chen, I. I. I. Arendall, W. Bryan, J. J. Headd, D. A. Keedy, R. M. Immormino, G. J. Kapral, L. W. Murray, J. S. Richardson and D. C. Richardson, MolProbity: all-atom structure validation for macromolecular crystallography, Acta Crystallogr., Sect. D: Biol. Crystallogr., 2010, 66, 12–21.
40. E. Krissinel and K. Henrick, Inference of Macromolecular Assemblies from Crystalline State, J. Mol. Biol., 2007, 372, 774–797.
41. V. Kumar, R. R. Sonani, M. Sharma, G. D. Gupta and D. Madamwar, Crystal structure analysis of C-phycoerythrin from marine cyanobacterium Phormidium sp. A09DM, Photosynth. Res., 2016, 129(1), 17–28.
42. A. Gaigalas, T. Gallagher, K. D. Cole, T. Singh, L. Wang and Y. Z. Zhang, A multistate model for the fluorescence response of R-phycoerythrin, Photochem. Photobiol., 2006, 82(3), 635–644.
43. B. Stec, R. F. Troxler and M. M. Teeter, Crystal Structure of C-Phycocyanin from Cyanidium caldarium Provides a New Perspective on Phycobilisome Assembly, Biophys. J., 1999, 76, 2912–2921.
44. M. Duerring, R. Huber, W. Bode, R. Ruembeli and H. Zuber, Refined three-dimensional structure of phycoerythrocyanin from the cyanobacterium Mastigocladus laminosus at 2.7 A, J. Mol. Biol., 1990, 211, 633–644.
45. A. Parbel, K. H. Zhao, J. Breton and H. Scheer, Chromophore assignment in phycoerythrocyanin from Mastigocladus laminosus, Photosynth. Res., 1997, 54, 25–34.
46. I. Sandler, N. Zigdon, E. Levy and A. Aharoni, The functional importance of co-evolving residues in proteins, Cell. Mol. Life Sci., 2013, 71, 673–682.
47. S. Chakrabarti and A. R. Panchenko, Structural and Functional Roles of Coevolved Sites in Proteins, PLoS One, 2010, 5, e8591.

---

Footnotes

† Electronic supplementary information (ESI) available. See DOI: 10.1039/c6ra12493c

‡ Authors contributed equally to this work.

§ Present address: Institute of Molecular, Cell and Systems Biology, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow G12 8TA, UK.

¶ Present address: Institute of Bioinformatics and Applied Biotechnology (IBAB), Whitefield, Bangalore-560066, Karnataka, India.

---