Rice protein hydrolysates (RPHs) inhibit the LPS-stimulated inflammatory response and phagocytosis in RAW264.7 macrophages by regulating the NF-κB signaling pathway

Li Wen ab, Yuehua Chena, Li Zhangb, Huixin Yu*b, Zhou Xua, Haixi Youa and Yunhui Cheng*a
aDepartment of Food and Biological Engineering, College of Chemical and Biological Engineering, Changsha University of Science and Technology, No. 960, 2nd section, Wangjiali South Road, Changsha 410114, Hunan, China. E-mail: chengyh6488@gmail.com; Fax: +86-731-85258322; Tel: +86-731-85258322
bKey Laboratory of Nuclear Medicine, Ministry of Health, Jiangsu Key Laboratory of Molecular Nuclear Medicine, Jiangsu Institute of Nuclear Medicine, Wuxi 214063, Jiangsu, China. E-mail: yuhuixin@jsinm.org

Received 7th April 2016 , Accepted 12th July 2016

First published on 12th July 2016


Abstract

The antioxidant and anti-hypertension properties of rice peptides following hydrolysis by proteolytic enzymes have been investigated previously, but the anti-inflammatory and immune characteristics have not been fully explored. In this study, we investigated the inhibitory effects of trypsin-derived rice protein hydrolysates (RPHs) on the inflammatory response in LPS-stimulated RAW264.7 macrophages, and probed their underlying molecular mechanisms of action. Moreover, a fraction, RPHs-C-7-3, displayed significant inflammation suppression activity by inhibiting the release of nitric oxide (NO) and tumour necrosis factor-α (TNF-α). Transcription of TNF-α, inducible nitric oxide synthase (iNOS), interleukin-6 (IL-6), and interleukin-1β (IL-1β) were decreased in a dose-dependent manner. Additionally, RPHs-C-7-3 attenuated iNOS and repressed the nuclear transcription factor (NF-κB) signaling pathway by impeding the nuclear translocation of p65. RPHs-C-7-3 also repressed the phagocytic ability of the activated macrophages. Our results demonstrated that RPHs exerted anti-inflammatory effects in LPS-stimulated RAW264.7 macrophages and may therefore have potential for treating inflammation-related conditions.


1. Introduction

Bioactive peptides in the diet are widely known to be associated with various physiological activities and are used in many experiments in vivo and in vitro.1,2 Immunopeptides isolated from foods exhibit immunosuppressive and immunomodulatory effects3,4 and have attracted attention as possible anti-inflammatory drugs due to their favourable properties that include high integrality, ease of absorption, and lack of immunogenicity.5 Recent studies identified rice protein hydrolysates as dietary factors that lower the glycemic response6 and possess remarkable DPPH radical scavenging activity.7 In our previous study, we isolated trypsin-derived hydrolysates from rice protein (RPHs) as a series of multidimensional peptide fractions prepared by different purification processes that promoted proliferation and activity of macrophages.8

As essential components of the innate immune response, macrophages are primary immune cells that play a pivotal role in anti-inflammation and host defences against external stimuli such as invading pathogens and bacterial infections.9,10 Macrophages can recognize and discriminate pathogens through their membrane-bound surface receptors or pattern recognition receptors (PRRs) that include toll-like receptors (TLRs), receptor kinases and C-type lectin receptors (CLRs).11,12 Stimuli initiate the activation of transcription factors such as nuclear transcription factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) that then regulate the activities and functions of macrophages, resulting in the secretion of cytokines and chemokines and the overproduction of other inflammatory mediators.12,13

Lipopolysaccharide (LPS), a potent immune system activator, is the main structural component of Gram-negative bacterial cell walls and is considered an important risk factor for inflammation in various inflammatory diseases including acute lung injury (ALI),14,15 inflammatory bowel disease (IBD)16 and sepsis.17 The pathogenesis of inflammations induced by LPS are characterised by binding to the endogenous ligand TLR-4 that mediates signal pathways involved in the initiation of immunological cascades.18 During LPS-induced inflammation, activated macrophages overproduce pro-inflammatory mediators such as nitric oxide (NO), tumour necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-1β (IL-1β) that are all regulated by the NF-κB pathway that is believed to contribute to inflammatory processes.19,20 NF-κB is maintained in an inactive state in the cytoplasm as a heterodimer composed of p65 and p50 subunits bound to the inhibitor of κB (IκB).21 Induction of NF-κB by a downstream pathway is needed to trigger its transcriptional activation function that is stimulated by inflammatory stimuli.22 In particular, p65 is specifically required for TLR4-stimulated expression of inflammatory mediators in the acute phase of inflammatory responses. The p65 component is liberated from the restrained state when cells undergo stimulation, and is then free to translocate from the cytosol to the nucleus where it can target genes and regulate their transcription in anti-cancer, anti-bacterial, and anti-viral immune responses.23–25

NO is produced by inducible nitric oxide synthase (iNOS, also known as NOS2) in macrophages and is an important low molecular weight signaling molecule that acts as a mediator in numerous physiological processes including circulatory shock and inflammation,26 macrophage polarization,27 regulation of the cardiovascular and nervous systems, and IBD.28–30 Phagocytosis occurs in response to pathogenic bacteria and other stimulatory agents and is vital for physiological homeostasis.31 Cytokines or bacterial toxins contribute to the enhancement of macrophage phagocytic ability, and NO also has a major influence by echoing the immune responses.32 iNOS can be generated in many cell types, especially macrophages, keratinocytes, and hepatocytes,33 and endotoxins and cytokines up-regulate iNOS at both gene and protein levels to accelerate inflammation.34 Excess secretion of NO triggers a signal transduction cascade that leads to mitochondrial dysfunction and apoptosis,35,36 leading to severe damage to host cells and tissues if production of NO is not quickly returned to normal levels.

In the present study, we demonstrated that RPHs attenuated inflammation in a LPS-stimulated RAW264.7 macrophage model, acting primarily through the NF-κB pathway and resulting in secretion of cytokines. Investigation of NO and cytokine levels following treatment with RPHs indicated suppression of NF-κB p65 translocation and macrophage phagocytosis, suggesting RPHs protected macrophages from more severe inflammation and ameliorated some cell functions. For the first time, we demonstrated that RPHs exerted effectively anti-inflammatory effects in LPS-stimulated RAW264.7 macrophages at both gene and protein levels. This study contributed to enriching the research in the field of rice peptides and the anti-inflammatory and immune characteristics of RPHs were also demonstrated.

2. Results

2.1. Different components of RPHs inhibit NO and TNF-α generation in LPS-stimulated RAW264.7 macrophages

To compare the anti-inflammatory activity of different components of RPHs in LPS-stimulated RAW264.7 cells, the amount of the key inflammatory mediators NO and TNF-α produced following treatment with different RPH components was measured (Table 1). After treatment with LPS (1 μg mL−1) for 24 h, the NO concentration in the supernatant markedly increased compared with controls (Fig. 1). All five RPH components decreased the release of LPS-stimulated NO at a concentration of 250 μg mL−1, and RPHs-C-7 exhibited the strongest inhibition (Fig. 1A). Furthermore, treatment with RPHs-C-7-1, RPHs-C-7-2, and RPHs-C-7-3 that were purified from RPHs-C-7 resulted in even higher levels of NO inhibition, and the effect was dose-dependent within the concentration range tested (31.25–250 μg mL−1; Fig. 1B). However, no significant changes in cell viability were observed with any of the three components in this concentration range (Fig. 1C), suggesting RPHs had a minimal effect on cell growth. RPHs-C-7-3 exhibited the highest anti-inflammatory activity (Fig. 1B and C). ELISA showed that the TNF-α concentration in the medium of LPS-treated RAW264.7 cells was approximately four-fold higher than in the control group, and secretion of TNF-α was suppressed by RPHs-C-7-3 (Fig. 1D). RPHs-C-7-3 therefore had the highest inhibitory activity of LPS-mediated NO production and TNF-α secretion in RAW264.7 macrophages.
Table 1 Different RPH components purified from rice proteina
Component Isolation and purification method State
a IER: ion-exchange resin; GPC: gel permeation chromatography.
RPHs-C-P IER, penetrating Lyophilization, solid powder
RPHs-C-5 IER, pH = 5 eluting Lyophilization, solid powder
RPHs-C-7 IER, pH = 7 eluting Lyophilization, solid powder
RPHs-C-10 IER, pH = 10 eluting Lyophilization, solid powder
RPHs-C-N IER, 0.2 M ammonia eluting Lyophilization, solid powder
RPHs-C-7-1 GPC, the F1 component Lyophilization, solid powder
RPHs-C-7-2 GPC, the F2 component Lyophilization, solid powder
RPHs-C-7-3 GPC, the F3 component Lyophilization, solid powder



image file: c6ra08927e-f1.tif
Fig. 1 Inhibitory activity of different RPH components on NO and TNF-α production in LPS-stimulated RAW264.7 cells. (A) Effects of five different RPH components on NO production. Cells were incubated with 250 μg mL−1 RPHs at 37 °C for 12 h followed by LPS (1 μg mL−1) stimulation for 24 h. (B) Effects of RPHs-C-7 and three purified components from RPHs-C-7 on NO production. Cells were pretreated with gradually increasing concentrations (0, 31.25, 62.5, 125 and 250 μg mL−1) of RPHs at 37 °C for 12 h followed by LPS (1 μg mL−1) stimulation for 24 h. (C) Effects of four RPH components in (B) on cell cytotoxicity. (D) Effects of RPHs-C-7-3 on TNF-α secretion. The results are presented as means ± SD (n = 3). ##P < 0.01 compared with controls; *P < 0.05 compared with LPS treatment alone; **P < 0.01 compared with LPS treatment alone.

2.2. RPHs-C-7-3 inhibits the expression of pro-inflammatory genes

A growing number of studies suggests that inflammatory genes are expressed mainly in activated macrophages.37 The effects of RPHs-C-7-3 on the expression of TNF-α, IL-6, and IL-1β were investigated by PCR, and iNOS expression was also evaluated to assess the influence on upstream mediators. TNF-α, IL-6, IL-1β, and iNOS mRNA levels were all sharply increased following LPS treatment for 12 h, but these increases in expression were reversed in a dose-dependent manner by treatment with RPHs-C-7-3 (31.25–250 μg mL−1) for 12 h (Fig. 2). The changes in iNOS and TNF-α expression corresponded with their products in the supernatant (Fig. 1), which confirmed the inhibition of inflammation at the transcriptional level.
image file: c6ra08927e-f2.tif
Fig. 2 Effects of RPHs-C-7-3 on LPS-stimulated expression of pro-inflammatory mediators in RAW264.7 cells. (A) PCR measurement of TNF-α, iNOS, IL-6 and IL-1β mRNA levels in RAW264.7 cells pretreated with RPHs-C-7-3 for 12 h and stimulated with LPS (1 μg mL−1) for 12 h. β-actin mRNA was used for normalization. (B) Relative mRNA expression of TNF-α, iNOS, IL-6 and IL-1β. Results are presented as means ± SD (n = 3); ##P < 0.01 compared with RPHs-C-7-3 and LPS-untreated cells; *P < 0.05 compared with LPS treatment alone; **P < 0.01 compared with LPS treatment alone.

2.3. RPHs-C-7-3 suppresses the phagocytic ability of LPS-stimulated RAW264.7 macrophages

When the inflammatory response occurs, macrophages secrete cytokines and perform phagocytosis. The effects of RPHs-C-7-3 on the phagocytosis were examined based on the ability of cells to internalize fluorescent red latex beads. Stimulation of RAW264.7 cells with LPS for 12 h led to a substantial increase in phagocytosis (Fig. 3A). However, phagocytosis was greatly reduced in LPS-stimulated RAW264.7 cells pre-treated with 62.5–250 μg mL−1 RPHs-C-7-3, although dose-dependency was not observed (Fig. 3A). Flow cytometry indicated that the percentage of beads phagocytosed increased from 14.3% to 56.8% following LPS stimulation, but this was reduced to 36.9%, 38.3%, and 38.9% in cells treated with 62.5, 125, and 250 μg mL−1 RPHs-C-7-3, respectively (Fig. 3B and C).
image file: c6ra08927e-f3.tif
Fig. 3 Effects of RPHs-C-7-3 on the phagocytic ability of LPS-stimulated RAW264.7 cells. Cells were pretreated with gradually increasing concentrations (0, 62.5, 125 and 250 μg mL−1) of RPHs-C-7-3 at 37 °C for 12 h followed by LPS (1 μg mL−1) stimulation for 12 h, then exposed to fluorescent red latex beads for 1 h. (A) Representative fluorescent cell images. Arrows indicate cells that have engulfed beads. (B) Representative flow cytometric chart illustrating the phagocytic activity of LPS-stimulated RAW264.7 cells pretreated with RPHs-C-7-3. (C) The percentage of cells undergoing phagocytosis was determined by flow cytometric analysis. Results are presented as means ± SD (n = 3); ##P < 0.01 compared with RPHs-C-7-3 and LPS-untreated cells; **P < 0.01 compared with LPS treatment alone.

2.4. RPHs-C-7-3 attenuates the expression of iNOS

As illustrated above in Fig. 1, RPHs have a strong inhibitory effect on NO production in the supernatant. NO production in macrophages is mediated by iNOS that is also induced by LPS through surface receptors. Western blotting showed that iNOS was degraded in a dose-dependent manner following treatment with 62.5–250 μg mL−1 RPHs-C-7-3 (Fig. 4), and even the lowest concentration of RPHs-C-7-3 tested (62.5 μg mL−1) was enough to attenuate the LPS-induced expression of iNOS (Fig. 4).
image file: c6ra08927e-f4.tif
Fig. 4 Effects of RPHs-C-7-3 on the expression of iNOS in LPS-stimulated RAW264.7 cells. Cells were pretreated with or without RPHs-C-7-3 for 12 h and stimulated with LPS (1 μg mL−1) for an additional 12 h period. Cell lysates were subjected to western blotting analysis to measure iNOS protein levels, with actin as a reference. (A) Effects of 62.5–250 μg mL−1 RPHs-C-7-3 on iNOS expression. (B) Relative density of iNOS in (A). Results are presented as means ± SD (n = 3); ##P < 0.01 compared with RPHs-C-7-3 and LPS-untreated cells; **P < 0.01 compared with LPS treatment alone.

2.5. RPHs-C-7-3 regulates the nuclear translocation of p65

LPS activates a series of pathways associated with inflammatory responses, including the essential NF-κB pathway that targets transcription factors that regulate the expression of a large array of inflammatory genes, of which p65 is primarily responsible for modulating the inflammatory responses stimulated by LPS.22 The influence of RPHs-C-7-3 on the nuclear translocation of p65 was investigated by western blotting, and the results showed that LPS facilitated a massive accumulation of p65 in the nucleus. RPHs-C-7-3 impeded this process in a dose-dependent manner (Fig. 5A), and translocation was completely inhibited when cells were pretreated with the highest dose (250 μg mL−1) (Fig. 5A and B).
image file: c6ra08927e-f5.tif
Fig. 5 Effects of RPHs-C-7-3 on nuclear factor-κB (NF-κB) activation in LPS-stimulated RAW264.7 cells. Cells were pretreated with or without RPHs-C-7-3 for 12 h followed by LPS (1 μg mL−1) stimulation for 2 h. Nuclear and cytosolic extracts were subjected to western blotting analysis to measure p65 protein levels. PARP and tubulin were used as cytosolic and nuclear markers, respectively. (A) Effects of 62.5–250 μg mL−1 RPHs-C-7-3 on p65 nuclear translocation. (B) Relative density of nuclear p65 in (A). Results are presented as means ± SD (n = 3); ##P < 0.01 compared with RPHs-C-7-3 and LPS-untreated cells; **P < 0.01 compared with LPS treatment alone.

3. Discussion

Food-derived bioactive peptides have many advantages over traditional pharmaceutical agents, and their use in food and medicine aligns with sustainable food utilization.38,39 LPS-stimulated murine RAW264.7 macrophages are one of the most widely-used cell lines for studying inflammatory responses and assessing anti-inflammatory drugs in vitro.40,41 In the present work, we investigated the inflammatory repression activities of several novel RPHs in LPS-stimulated RAW264.7 macrophages.

Inflammation is a central feature of the host defence against pathogenic mediators such as damaged cells or invading microbes, and it plays a fundamental role in immune modulation and restoration of tissue homeostasis.37 During inflammation, overproduction of pro-inflammatory substances contributes to a variety of pathophysiological conditions and metabolic disorders.9,36 TNF-α, IL-6, and IL-1β are the main cytokines induced by LPS in RAW264.7 macrophages, and upregulation occurs at both mRNA and protein levels. However, anti-inflammatory drugs usually decrease cytokine production in the LPS-induced inflammatory response and this can influence cell survival and various physiological functions.42–44

NO is a pleiotropic free radical that acts as a diffusible universal messenger and is associated with various inflammation-related diseases.45 In LPS-stimulated cells, the concentration of NO was reported to increase several-fold compared with the untreated group,46,47 and food-derived protein anti-inflammatory extracts ascophyllan,44 prebiotics48 and gliadin49 all markedly inhibited the release of NO in LPS-stimulated RAW264.7 macrophages by downregulating the expression of iNOS. Based on these findings, we decided to measure NO concentration to compare inhibition among the different RPHs. Preliminary studies indicated that all compounds inhibited LPS-induced NO overproduction. Inhibition was highest with RPHs-C-7-3, which reduced the NO concentration by over 40%, and this fraction was chosen for further experiments (Fig. 1B). iNOS, endothelial NOS (eNOS) and neuronal NOS (nNOS) are distinct isoforms of NOS, and all metabolize L-arginine to produce NO.34,50 Unlike eNOS and nNOS that exhibit calcium-dependence and highly specific expression, iNOS is induced in several cell types by immunological and inflammatory stimuli. Our results showed that iNOS was markedly decreased at both mRNA and protein levels following treatment with RPHs-C-7-3, consistent with the reduction in NO (Fig. 2 and 4).

As shown in Fig. 1C, no significant changes in cell viability were observed with any of the RPHs-C-7-3 in this concentration range, suggesting RPHs-C-7-3 had a minimal effect on cell growth. Indeed RPHs-C-7-3 inhibited the NO production in a dose-dependent manner shown in Fig. 1B. However, there was no dose-dependence was found in the effects of RPHs-C-7-3 on phagocytosis (Fig. 3). In our study, RPHs-C-7-3 showed a consistent effect on suppressing the LPS-induced macrophage phagocytosis in different concentration. Although little literature can supply us a hint to help explain the poor dose-dependence for this effect at present, we are trying to explore the structure–function relationship through the structural biology technology in present. As a series of in-depth molecular and structural investigations promoted, we hope that the mechanism of the peptide effects on the cells can be explained in the future.

Our findings indicated that inhibition of NF-κB nuclear translocation is, as least in part, involved in mediating the anti-inflammatory properties of RPHs-C-7-3 (Fig. 5). NF-κB signaling has been implicated in a variety of cellular processes, including cellular activation, inflammation, differentiation and apoptosis,24 and NF-κB activation is required for the development of LPS-induced sepsis and septic shock.17 Nuclear translocation of p65 is essential for NF-κB activation, and degradation of IκBα is responsible for dissociation of the p65/p50 heterodimer that regulates p65 nuclear translocation and gene transcription.21,51 Once transcription of NF-κB is initiated, p65 binds to target genes and mediates the expression of inflammatory mediators.25 Our results indicate that RPHs-C-7-3 impeded the nuclear translocation of p65, down-regulated the transcription of TNF-α, IL-6, and IL-1β, and reduced secretion of TNF-α (Fig. 1D and 2). These observations are in accordance with the previous findings that bioactive peptides act as negative regulators of LPS-induced activation of the NF-κB pathway52,53 and are acutely involved in the anti-inflammatory mechanism.

RPHs-C-7-3 was found to be the best inflammation suppression activity in LPS-stimulated RAW264.7 macrophages in three aspects. Firstly, RPHs-C-7-3 significantly inhibited the expression of pro-inflammatory mediators and inhibited the production of NO sharply. The NO inhibition rate reached to 61.38%. Moreover, RPHs-C-7-3 also suppressed the expression of TNF-α and iNOS at both gene and protein levels. Secondly, RPHs-C-7-3 markedly decreased phagocytosis, and the highest phagocytosis inhibition rate was 32.90%. Thirdly, the anti-inflammatory activity of RPHs-C-7-3 was associated with down-regulation of the NF-κB pathway by impeding the LPS-induced accumulation of p65 in the nucleus. After being separated and purified by gel permeation chromatography, molecular weight was deferentially analyzed between the group RPHs-C-7-3 and groups RPHs-C-7, RPHs-C-7-1 and 2, and the results showed the former was the smallest one. It has reported that the length of the peptide chain is closely associated with its biological activities,54 and the molecular weight of peptide has significant effects on modulating immune cell activity.55 Some studies have indicated that low molecular weight peptides purified by gel permeation chromatography showed stronger immune activity compared with the high molecular weight ones.56,57 In the present study, we have predicted the potential immuno-active peptides in RPHs-C-7-3 samples using the NetMHCpan 3.0 server software. The results showed that an identified peptide of 16 amino acid residues (QRDFLLAGNKRNPQAY) could interact with major histocompatibility complexes (MHC), and this indicated a very strong immune activity of the peptide. The core sequence of this peptide includes polar and basic amino acid regions (FLLAGNKRN) (data in publishing).

Phagocytosis, induced by various extracellular stimulatory molecules, is critical for the host defence against invading pathogens,58 and is the main function of phagocytic cells that participate in inflammation and immune responses. Phagocytosis is driven by a variety of distinct receptors that trigger the activation of intricate signaling pathways.32,59,60 Various biological molecules attenuate inflammation by affecting phagocytosis,61 and flow cytometry showed that RPHs-C-7-3 markedly decreased phagocytosis in the present study, although not in a dose-dependent manner (Fig. 3).

NF-κB members are transcription factors composed of DNA-binding p50, p65 proteins, and Rel proteins containing a transactivation domain. Activation of NF-κB by pro-inflammatory cytokines such as LPS involves IκB phosphorylation by IκB kinase (IKK), which leads to IκB proteasomal degradation and p65 translocation to the nucleus where p65 triggers transcriptional activation of the genes related to inflammation, cellular transformation, and cancer metastasis.22

The regulation of NF-κB signaling directly affects expression of pro-inflammatory cytokines and inflammatory mediators involved in immune response.62 Our results showed that RPHs-C-7 could down-regulate the LPS-induced iNOS, TNF-α, IL-6 and IL-β transcription in a dose-dependent manner (Fig. 2), as evidenced by the decrease in p65 DNA-binding ability and reporter gene activity. The down-regulation of the NF-κB pathway by decreasing p65 nuclear translocation (Fig. 5) was the result of inhibition of IκB and IKK phosphorylation. The association of the NF-κB p65/p50 dimer with IκBα plays a pivotal role in regulating its nuclear translocation and gene transcription. It has been known that IκB and IKK degradation caused the dissociation and nuclear translocation of p65.63 Thus we presumed that the phosphorylation of IκB and IKK would be similarly inhibited by RPHs-C-7.

The searches for therapeutic drugs and experimental compounds decreasing macrophage phagocytosis are intense.64,65 Even though the primary role of TLRs is to initiate inflammatory pathways, they have also been implicated to play a role in the modulation of macrophage phagocytosis.66 The current literature and observations showed that toll-like receptors signaling may interact with modulating macrophage phagocytosis.67 The RPHs-C-7 treatment may decrease TLR4 message and protein levels thereby weakening LPS-induced phagocytosis.

In our study, the fraction RPHs-C-7-3 displayed the most significant anti-inflammatory activity, and RPHs-C-7-1 and 2 had the inferior effects. The reasons resulted in different effects were the different molecular weight between RPHs-C-7-1, 2, and 3. Molecular weight of RPHs-C-7-3 was the smallest among all the analysed fractions, and the highest immuno-activity peptide was concentrated in it as mentioned above.

In summary, our findings demonstrated that RPHs extracted from rice protein inhibited the generation of LPS-induced pro-inflammatory mediators in RAW264.7 cells. The anti-inflammatory activity of RPHs-C-7-3 was associated with down-regulation of the NF-κB pathway and a decrease in LPS-induced nuclear translocation of p65. RPHs-C-7-3 also suppressed LPS-induced phagocytosis in a latex bead model, and this purified fraction could prove to be a useful anti-inflammatory peptide.

4. Experimental

4.1. Chemicals and reagents

RPHs were purified in our laboratory as described below. Lipopolysaccharide (LPS) from Escherichia coli 055:B5 was purchased from Sigma-Aldrich (L2880, St. Louis, MO, USA); bovine serum albumin (BSA), gelatin, dimethyl sulfoxide (DMSO) and 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) were purchased from Sangon (Shanghai, China); N-(1-naphthyl)ethylenediamine dihydrochloride, sulfanilamide, H3PO4 and other chemicals were purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). PCR primers were synthesized by Sangon (Shanghai, China). Antibodies used for western blotting were as follows: anti-iNOS and anti-β-actin were purchased from Santa Cruz Biotechnology (Dallas, Texas, USA); anti-NF-κB p65 and anti-tubulin were purchased from Beyotime Biotechnology (Shanghai, China). All antibodies were diluted 1[thin space (1/6-em)]:[thin space (1/6-em)]1000 except where specified otherwise.

4.2. Preparation of RPHs

RPHs were separated by purification and freeze-dried as shown in Table 1. All components were solubilized in sterile water, stored at −20 °C, and diluted into medium as required.

4.3. Cell culture

The murine macrophage RAW264.7 cell line was obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco, Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Hangzhou, China), 100 U mL−1 penicillin and 100 U mL−1 streptomycin. Cells were incubated in a humidified incubator (Thermo Electron Corporation, Waltham, MA, USA) with an atmosphere of 5% CO2 at 37 °C and subcultured every 2 or 3 days.

4.4. Cytotoxicity assays

RAW264.7 cells were seeded in 96-well plates (Corning Incorporated, NY, USA) at a density of 1.5 × 104 cells per well and stabilized for 24 h. Cells were pretreated with various concentrations of RPHs for 20 h, and 20 μL of MTT stock solution in phosphate buffered saline (PBS, 5 mg mL−1) was added to each well and further incubated for 4 h under the same conditions. After removal of the culture medium, 150 μL DMSO was added to each well and the whole plate was oscillated at room temperature until solid material was dissolved completely. Cell viability was determined by measuring the absorbance at 490 nm in a microplate reader (μ Quant, BIO-Tek, Winooski, VT, USA).

4.5. LPS treatment and determination of nitrite production

LPS was dissolved in sterile water to 5 mg mL−1 and stored at −20 °C. RAW264.7 cells were seeded in 96-well plates (3 × 104 cells per well). After 12 h incubation, cells were treated with gradually increasing concentrations of RPHs for 12 h followed by incubation in the absence or presence of LPS (1 μg mL−1) for 24 h. Supernatants were collected and NO was determined using the Griess reagent.68 Briefly, the supernatant (100 μL) from LPS-induced RAW264.7 cell cultures was mixed with an equal volume of Griess reagent (0.1% N-(1-naphthyl) ethylenediamine dihydrochloride, 1% sulfanilamide, 2.5% H3PO4) and incubated at 37 °C for 15 min. The absorbance at 540 nm was measured with a microplate reader, and concentrations were calculated against a sodium nitrite standard curve.

4.6. Measurement of TNF-α using enzyme-linked immunosorbent assay (ELISA)

Cells (5 × 105 cells per well) were seeded in 24-well plates. After 12 h incubation, cells were treated with or without RPHs for 12 h, and stimulated by LPS for 12 h. Supernatants were collected and the TNF-α concentration in the medium was determined using commercially available ELISA kits (DKW12-2720-096, DAKEWE, Shenzhen, China) according to the manufacturer's instructions.

4.7. Reverse transcription PCR assays

Cells (2.5 × 106 cells per well) were seeded into six-well plates and incubated for 24 h, then pretreated with RPHs for 12 h. After LPS stimulation for 12 h, total RNA was extracted using TRIzol reagent (Ambion, Waltham, MA, USA). The concentration and purity of RNA were determined by measuring the absorbance at 260 nm and 280 nm using a microplate reader. RNA was reverse-transcribed to cDNA using a two-step method. Firstly, total RNA (2 μg) was mixed with diethyl pyrocarbonate (DEPC) water containing oligo (dT)15 (0.5 μg μL−1), incubated at 70 °C for 5 min and placed immediately on ice for 5 min. M-MLV reverse transcriptase (TaKaRa, Dalian, China) was then used to synthesize cDNA in a PCR Amplifier (Applied Biosystems, Waltham, MA, USA) at 42 °C for 60 min according to the manufacturer's instructions. Amplification of cDNA was performed using murine specific primers were designed with Primer Premier 5 (Table 2). PCR products were separated using agarose gel electrophoresis and stained with ethidium bromide. β-actin was used as a loading control. Data were analyzed using an image analysis program (Tanon GIS System, Shanghai, China) and expressed as the ratio of candidate genes to β-actin.
Table 2 Primers used for reverse transcription PCR
Gene   Primer sequence (5′-3′) Product size (bp)
TNF-α Sense GTCGTAGCAAACCACCAA 440
Anti-sense AACACCCATTCCCTTCAC
iNOS Sense GAGCGAGTTGTGGATTGTC 133
Anti-sense CCAGGAAGTAGGTGAGGG
IL-6 Sense TGCCTTCTTGGGACTGAT 384
Anti-sense CTCGCTTTGTCTTTCTTGTT
IL-1β Sense AGGCTCCGAGATGAACAA 464
Anti-sense AAGGCATTAGAAACAGTCC
Actin Sense GCCGGGACCTGACTGACTAC 325
Anti-sense CGGATGTCCACGTCACACTT


4.8. Phagocytosis assays

The phagocytic ability of cells was investigated using fluorescent red latex beads (1 μm diameter, L2778, Sigma-Aldrich) that were opsonized with 1% BSA solution for 1 h at 37 °C before all experiments. Cells were seeded into six-well plates, treated with or without RPHs and incubated at 37 °C for 12 h followed by LPS stimulation for 12 h. Next, 100 μL of beads suspended in medium was added to each well (beads[thin space (1/6-em)]:[thin space (1/6-em)]cells = 1[thin space (1/6-em)]:[thin space (1/6-em)]100) and incubation continued at 37 °C for 1 h. After cells had phagocytosed the beads, phagocytosis was terminated by placing the plate on ice and replacing the medium with ice-cold sterile PBS. Cells were then harvested and washed with PBS and analyzed by fluorescence microscopy (TH4-200, Olympus, Tokyo, Japan) and flow cytometry (FACSAria, Becton Dickinson, Franklin Lakes, NJ, USA). Data analysis was performed using Flowjo software 7.6. Briefly, viable macrophages in each sample were first gated using a forward scatter (FSC) versus side scatter (SSC) plot, and 10[thin space (1/6-em)]000 cells within the gated population were further investigated to identify a population of cells that had phagocytized the beads.

4.9. Western blot analysis

Cells were pretreated with or without RPHs for 12 h before stimulation with LPS. Cells were then washed with PBS, lysed in lysis buffer consisting of 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 2 mM ethylenediaminetetraacetic acid (EDTA), 1% (w/v) Nonidet P-40, 0.02% (w/v) sodium azide, 1 mM phenylmethylsulfonyl fluoride (PMSF), and incubated with oscillation on ice for 15 min. Samples were centrifuged to yield whole-cell lysates. Cytosolic and nuclear proteins were extracted using a Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime Biotechnology). Protein samples were electrophoresed using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes (Millipore, Billerica, MA, USA) in transfer buffer (20% methanol, 25 mM Tris, 192 mM glycine). After blocking in TBST (25 mM Tris–HCl, 150 mM NaCl, 0.1% Tween 20) containing 5% non-fat milk, membranes were incubated with antibodies overnight at 4 °C, washed and finally incubated for 1 h with secondary antibodies conjugated to horseradish peroxidase. Protein bands were visualized using an enhanced chemiluminescence (ECL) substrate solution (Santa Cruz Biotechnology) and films were developed and analyzed using dedicated apparatus (Bio-Rad Molecular Imager, Richmond, CA, USA).

4.10. Statistical analysis

All values are presented as arithmetic means ± S.D. One-way ANOVA was utilized to determine the statistical significance, and a p-value < 0.05 was considered significant.

5. Conclusions

We demonstrated, for the first time, that RPHs attenuated inflammation in LPS-stimulated murine macrophages by decreasing NO and cytokine production, and alleviating LPS-induced phagocytosis. Moreover, investigation of NF-κB activation provided insight into the molecular mechanisms underpinning the anti-inflammatory activity of RPHs, and this knowledge may assist the development of future anti-inflammatory treatments.

Conflict of interest

The authors declare that they have no conflicts of interest.

Acknowledgements

This work is financially supported by the National Natural Science Foundation of China (31171672, 31071523), the Key Programs from MOST (2012BAD34B02, 2011BAK10B05, 2012BAD29B05), Public Program from the General Administration of Quality Supervision (201310128), and grants from the Ministry of Health Foundation of China (W201304).

References

  1. M. Yoshikawa, Peptides, 2015, 72, 208–225 CrossRef CAS PubMed.
  2. A. B. Nongonierma and R. J. FitzGerald, Food Funct., 2015, 6, 2115–2127 CAS.
  3. V. P. Dia, N. A. Bringe and E. G. de Mejia, Food Chem., 2014, 152, 423–431 CrossRef CAS PubMed.
  4. S. Marcone, K. Haughton, P. J. Simpson, O. Belton and D. J. Fitzgerald, J. Inflammation, 2015, 12, 1 CrossRef CAS PubMed.
  5. W. M. Miner-Williams, B. R. Stevens and P. J. Moughan, Nutr. Res. Rev., 2014, 27, 308–329 CrossRef CAS PubMed.
  6. Y. Ishikawa, T. Hira, D. Inoue, Y. Harada, H. Hashimoto, M. Fujii, M. Kadowaki and H. Hara, Food Funct., 2015, 6, 2525–2534 CAS.
  7. K. Liu, Y. Zhao, F. Chen and Y. Fang, Food Chem., 2015, 187, 424–430 CrossRef CAS PubMed.
  8. L. Wang, Y. H. Chen, Z. Xu, L. Wen, H. P. Bu and Y. H. Cheng, Packag. Food Mach., 2015, 31, 38–42 Search PubMed.
  9. A. Chawla, K. D. Nguyen and Y. P. Goh, Nat. Rev. Immunol., 2011, 11, 738–749 CrossRef CAS PubMed.
  10. F. Ginhoux and S. Jung, Nat. Rev. Immunol., 2014, 14, 392–404 CrossRef CAS PubMed.
  11. T. Kawai and S. Akira, Nat. Immunol., 2010, 11, 373–384 CrossRef CAS PubMed.
  12. S. N. Lester and K. Li, J. Mol. Biol., 2014, 426, 1246–1264 CrossRef CAS PubMed.
  13. M. Takano, M. Ohkusa, M. Otani, K. S. Min, K. Kadoyama, K. Minami, K. Sano and S. Matsuyama, Immunol. Lett., 2015, 167, 57–62 CrossRef CAS PubMed.
  14. A. A. Birukova, F. Meng, Y. Tian, A. Meliton, N. Sarich, L. A. Quilliam and K. G. Birukov, Biochim. Biophys. Acta, 2015, 1852, 778–791 CrossRef CAS PubMed.
  15. S. Vettorazzi, C. Bode, L. Dejager, L. Frappart, E. Shelest, C. Klassen, A. Tasdogan, H. M. Reichardt, C. Libert, M. Schneider, F. Weih, N. Henriette Uhlenhaut, J. P. David, M. Graler, A. Kleiman and J. P. Tuckermann, Nat. Commun., 2015, 6, 7796 CrossRef CAS PubMed.
  16. Y. Vodovotz, C. C. Chow, J. Bartels, C. Lagoa, J. M. Prince, R. M. Levy, R. Kumar, J. Day, J. Rubin and G. Constantine, Shock, 2006, 26, 235–244 CrossRef CAS PubMed.
  17. L. Li, Y. Liu, H. Z. Chen, F. W. Li, J. F. Wu, H. K. Zhang, J. P. He, Y. Z. Xing, Y. Chen, W. J. Wang, X. Y. Tian, A. Z. Li, Q. Zhang, P. Q. Huang, J. Han, T. Lin and Q. Wu, Nat. Chem. Biol., 2015, 11, 339–346 CrossRef CAS PubMed.
  18. T. Kawai and S. Akira, Immunity, 2011, 34, 637–650 CrossRef CAS PubMed.
  19. H. T. Liu, W. M. Li, X. Y. Li, Q. S. Xu, Q. S. Liu, X. F. Bai, C. Yu and Y. G. Du, Basic Clin. Pharmacol. Toxicol., 2010, 106, 362–371 CAS.
  20. M. S. Sheeba and V. V. Asha, J. Ethnopharmacol., 2009, 124, 39–44 CrossRef CAS PubMed.
  21. J. Caamano and C. A. Hunter, Clin. Microbiol. Rev., 2002, 15, 414–429 CrossRef CAS PubMed.
  22. T. Lawrence, Cold Spring Harbor Perspect. Biol., 2009, 1, a001651 Search PubMed.
  23. J. Jin, Y. Xiao, H. Hu, Q. Zou, Y. Li, Y. Gao, W. Ge, X. Cheng and S. C. Sun, Nat. Commun., 2015, 6, 5930 CrossRef CAS PubMed.
  24. S. Maeda and M. Omata, Cancer Sci., 2008, 99, 836–842 CrossRef CAS PubMed.
  25. P. P. Tak and G. S. Firestein, J. Clin. Invest., 2001, 107, 7–11 CrossRef CAS PubMed.
  26. C. Nathan and Q.-w. Xie, Cell, 1994, 78, 915–918 CrossRef CAS PubMed.
  27. G. Lu, R. Zhang, S. Geng, L. Peng, P. Jayaraman, C. Chen, F. Xu, J. Yang, Q. Li, H. Zheng, K. Shen, J. Wang, X. Liu, W. Wang, Z. Zheng, C. F. Qi, C. Si, J. C. He, K. Liu, S. A. Lira, A. G. Sikora, L. Li and H. Xiong, Nat. Commun., 2015, 6, 6676 CrossRef CAS PubMed.
  28. I. Bellezza, S. Grottelli, A. L. Mierla, I. Cacciatore, E. Fornasari, L. Roscini, G. Cardinali and A. Minelli, Int. J. Biochem. Cell Biol., 2014, 51, 159–169 CrossRef CAS PubMed.
  29. V. Calabrese, C. Mancuso, M. Calvani, E. Rizzarelli, D. A. Butterfield and A. M. G. Stella, Nat. Rev. Neurosci., 2007, 8, 766–775 CrossRef CAS PubMed.
  30. G. Kolios, V. Valatas and S. G. Ward, Immunology, 2004, 113, 427–437 CrossRef CAS PubMed.
  31. A. Aderem and D. M. Underhill, Annu. Rev. Immunol., 1999, 17, 593–623 CrossRef CAS PubMed.
  32. S. A. Reddy, S. B. Shelar, T. M. Dang, B. N. Lee, H. Yang, S. M. Ong, H. L. Ng, W. K. Chui, S. C. Wong and E. H. Chew, Int. Immunopharmacol., 2015, 24, 440–450 CrossRef CAS PubMed.
  33. J. MacMicking, Q.-w. Xie and C. Nathan, Annu. Rev. Immunol., 1997, 15, 323–350 CrossRef CAS PubMed.
  34. C. Bogdan, M. Röllinghoff and A. Diefenbach, Immunol. Rev., 2000, 173, 17–26 CAS.
  35. K. Jarvinen, K. Vuolteenaho, R. Nieminen, T. Moilanen, R. Knowles and E. Moilanen, Clin. Exp. Rheumatol., 2008, 26, 275–282 CAS.
  36. A. Van Zonneveld, H. De Boer, E. Van Der Veer and T. Rabelink, Ann. Rheum. Dis., 2010, 69, i57–i60 CrossRef CAS PubMed.
  37. L. Zhang and C.-C. Wang, Hepatobiliary Pancreatic Dis. Int., 2014, 13, 138–152 CrossRef.
  38. S. Chakrabarti, F. Jahandideh and J. Wu, BioMed Res. Int., 2014, 2014, 608979 Search PubMed.
  39. O. Martinez-Augustin, B. Rivero-Gutierrez, C. Mascaraque and F. Sanchez de Medina, Int. J. Mol. Sci., 2014, 15, 22857–22873 CrossRef CAS PubMed.
  40. M. R. Maurya, S. Gupta, X. Li, E. Fahy, A. R. Dinasarapu, M. Sud, H. A. Brown, C. K. Glass, R. C. Murphy and D. W. Russell, J. Lipid Res., 2013, 54, 2525–2542 CrossRef CAS PubMed.
  41. C. A. Rouzer, A. T. Jacobs, C. S. Nirodi, P. J. Kingsley, J. D. Morrow and L. J. Marnett, J. Lipid Res., 2005, 46, 1027–1037 CrossRef CAS PubMed.
  42. B. O. Cho, H. W. Ryu, Y. So, J. K. Cho, H. S. Woo, C. H. Jin, K. I. Seo, J. C. Park and I. Y. Jeong, Food Chem. Toxicol., 2013, 62, 638–644 CrossRef CAS PubMed.
  43. Y. Fu, E. Zhou, Z. Wei, X. Song, Z. Liu, T. Wang, W. Wang, N. Zhang, G. Liu and Z. Yang, Biochim. Biophys. Acta, 2014, 1840, 1755–1764 CrossRef CAS PubMed.
  44. Z. Jiang, T. Okimura, K. Yamaguchi and T. Oda, Nitric Oxide, 2011, 25, 407–415 CrossRef CAS PubMed.
  45. C. J. Lowenstein, J. L. Dinerman and S. H. Snyder, Ann. Intern. Med., 1994, 120, 227–237 CrossRef CAS PubMed.
  46. C. Bogdan, Nat. Immunol., 2001, 2, 907–916 CrossRef CAS PubMed.
  47. A. Kumar, S. H. Chen, M. B. Kadiiska, J. S. Hong, J. Zielonka, B. Kalyanaraman and R. P. Mason, Free Radical Biol. Med., 2014, 73, 51–59 CrossRef CAS PubMed.
  48. N. Zhang, D. Li, X. Zhang, Y. Shi and H. Wang, Food Funct., 2015, 6, 2620–2625 CAS.
  49. A. Barilli, B. M. Rotoli, R. Visigalli and V. Dall'Asta, Biochim. Biophys. Acta, 2014, 1842, 1364–1371 CrossRef CAS PubMed.
  50. O. W. Griffith and D. J. Stuehr, Annu. Rev. Physiol., 1995, 57, 707–734 CrossRef CAS PubMed.
  51. S. Ghosh and M. Karin, Cell, 2002, 109, S81–S96 CrossRef CAS PubMed.
  52. X. Cheng, D. Gao, B. Chen and X. Mao, Nutrients, 2015, 7, 3119–3137 CrossRef CAS PubMed.
  53. S. Hirai, S. Horii, Y. Matsuzaki, S. Ono, Y. Shimmura, K. Sato and Y. Egashira, Life Sci., 2014, 117, 1–6 CrossRef CAS PubMed.
  54. J. Leonil, V. Gagnaire, D. Molle, S. Pezennec and S. Bouhallab, J. Chromatogr. A, 2000, 881, 1–21 CrossRef CAS PubMed.
  55. A. Mercier, S. F. Gauthier and I. l. Fliss, Int. Dairy J., 2004, 14, 175–183 CrossRef CAS.
  56. H. Hou, Y. Fan, B. Li, C. Xue, G. Yu, Z. Zhang and X. Zhao, Food Chem., 2012, 134, 821–828 CrossRef CAS PubMed.
  57. Y. W. Li, B. Jiang and X. S. Tong, Chem. J. Chin. Univ., 2005, 26(1), 61–63 CAS.
  58. C. T. Kåhrström, Nat. Rev. Microbiol., 2012, 10, 162 CrossRef PubMed.
  59. R. S. Flannagan, V. Jaumouillé and S. Grinstein, Annu. Rev. Pathol.: Mech. Dis., 2012, 7, 61–98 CrossRef CAS PubMed.
  60. S. Ren, S. Zhang, M. Li, C. Huang, R. Liang, A. Jiang, Y. Guo, Y. Pu, N. Huang and J. Yang, Int. J. Biochem. Cell Biol., 2013, 45, 335–343 CrossRef CAS PubMed.
  61. X. Feng, H. Qin, Q. Shi, Y. Zhang, F. Zhou, H. Wu, S. Ding, Z. Niu, Y. Lu and P. Shen, Biochem. Pharmacol., 2014, 89, 503–514 CrossRef CAS PubMed.
  62. R. Simeonova, V. Vitcheva, G. Gorneva and M. Mitcheva, Arh. Hig. Rada Toksikol., 2012, 63, 7–14 CAS.
  63. L. Hoareau, K. Bencharif, P. Rondeau, R. Murumalla, P. Ravanan, F. Tallet, P. Delarue, M. Cesari, R. Roche and F. Festy, J. Inflammation, 2010, 7, 1 CrossRef PubMed.
  64. J. Couturier, I. C. Stancu, O. Schakman, N. Pierrot, F. Huaux, P. Kienlen-Campard, I. Dewachter and J. N. Octave, J. Neuroinflammation, 2016, 13, 20 CrossRef PubMed.
  65. N. Jana, A. Vidhu, D. Raini, L. Zhang, A. Saluja, J. Meng, K. Lisa, B. Santanu and R. Sabita, Sci. Rep., 2016, 6, 21094 CrossRef CAS PubMed.
  66. S. E. Doyle, R. M. O'Connell, G. A. Miranda, S. A. Vaidya, E. K. Chow, P. T. Liu, S. Suzuki, N. Suzuki, R. L. Modlin, W. C. Yeh, T. F. Lane and G. Cheng, J. Exp. Med., 2004, 199, 81–90 CrossRef CAS PubMed.
  67. M. R. Hutchinson, Y. Zhang, M. Shridhar, J. H. Evans, M. M. Buchanan, T. X. Zhao, P. F. Slivka, B. D. Coats, N. Rezvani, J. Wieseler, T. S. Hughes, K. E. Landgraf, S. Chan, S. Fong, S. Phipps, J. J. Falke, L. A. Leinwand, S. F. Maier, H. Yin, K. C. Rice and L. R. Watkins, Brain, Behav., Immun., 2010, 24, 83–95 CrossRef CAS PubMed.
  68. L. C. Green, D. A. Wagner, J. Glogowski, P. L. Skipper, J. S. Wishnok and S. R. Tannenbaum, Anal. Biochem., 1982, 126, 131–138 CrossRef CAS PubMed.

Footnote

These authors contributed to the work equally and should be regarded as co-first authors.

This journal is © The Royal Society of Chemistry 2016
Click here to see how this site uses Cookies. View our privacy policy here.