Diosgenin, a steroidal saponin, prevents hypertension, cardiac remodeling and oxidative stress in adenine induced chronic renal failure rats

Abstract

Patients with chronic renal failure (CRF) are at a high risk of developing cardiovascular diseases. The aim of the present study was to evaluate the effect of diosgenin on blood pressure, cardiac remodeling, contractile function and gene expression program in the context of oxidative stress in CRF rats. CRF was induced in rats by feeding them with 0.75% adenine-containing diet, and diosgenin was given orally everyday at the dose of 10, 20 and 40 mg kg⁻¹ body weight of animal. The effect of diosgenin on systolic blood pressure (SBP), activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx), angiotensin converting enzyme (ACE) activity and lipid peroxidation level in heart were evaluated. Cardiac function (dp/dt) and percentage rate pressure product (%RPP) recovery after ischemia/reperfusion (I/R) were evaluated by Langendorff isolated heart system, and gene expression levels were assessed by real-time PCR. Fibrotic remodeling of heart was assessed by histopathologic analyses. The outcome of this study demonstrated that a dose dependent treatment with diosgenin reduces hypertension in CRF animals, and a 40 mg kg⁻¹ dosage exhibited more pronounced effect on the blood pressure. Diosgenin enhances the antioxidant level, attenuates ACE activity, lipid peroxidation level and cardiac fibrosis. Ventricular function and %RPP recovery after I/R were also improved by the diosgenin treatment. CRF induced expression of transforming growth factor-β (TGF-β) and β-myosin heavy chain (β-MHC) were also suppressed by diosgenin. Taken together, these results suggest that diosgenin have enough potential to attenuate cardiac remodeling by reducing blood pressure and oxidative stress in the heart of CRF rats.

---

1. Introduction

Cardiovascular disease is one of the major causes of mortality and morbidity in patients with end stage renal disease (ESRD). It is characterized by multiple left ventricular abnormalities and the majority of dialyzed patients do not die from myocardial infarction, but as a result of sudden death due to adverse cardiac functions.^1,2

Left ventricular hypertrophy (LVH) is the most frequent cardiac complication in chronic renal disease and left ventricular remodeling consists of cardiomyocyte hypertrophy, interstitial cell proliferation, systolic or diastolic dysfunction and ventricular dilatation.^3,4 Correction of hypertension in dialysis patients results in significantly decreased LVH, which also exist paradoxical.⁵ Moreover, the rate of acute myocardial infarction (AMI) among patients with chronic kidney disease (CKD) is more than twice that of patients without CKD. Effective recovery from ischemia/reperfusion (I/R) is extremely poor and the cause of the excess mortality is likely to be multifactorial.⁶

Cardiac nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activity increased by 300% and elevated cardiac oxidative stress in uremic rats compared to normal controls.⁷ The effect of the antioxidant α-tocopherol on cardiac remodeling have proven that reducing the oxidative stress with antioxidants can prevent the cardiac remodeling and improve left ventricular function in uremic animals.⁸ Moreover, uremia-aggravated fibrosis and hypertrophy were suppressed by mineralocorticoid receptor (MR) antagonism through oxidative stress reduction.⁹

Diosgenin (3β-hydroxy-5-spirostene) (Fig. 1A), is a steroidal saponin found in several plants including fenugreek and dioscorea species. Earlier studies have suggested a lower incidence for coronary artery diseases in humans who have a high consumption of diet rich in phytoestrogens including diosgenin.¹⁰ Recent studies discovered that diosgenin abrogates the production of intracellular reactive oxygen species (ROS) and prevents lipid peroxidation in the aorta of diabetic animals.^11,12 Furthermore, studies from our laboratory also found that diosgenin has enough potential to inhibit the CRF induced vascular calcification and oxidative stress because it can enhance the activity of antioxidant enzymes in aorta and enhance coronary vascular flow.^13,14

Fig. 1 (A) Structure of diosgenin. (B) Schematic diagram of I/R protocol. (C) Effect of diosgenin on systolic blood pressure (0–5^th week). Values are represented as mean ± SD. (n = 6). Data were analyzed by one way ANOVA followed by Duncan's multiple range test. Values not sharing common letter (a, b and c) are significant with each other at P < 0.05.

No sufficient investigations have been carried out to study the protective activity of diosgenin on cardiac remodeling in a renal failure milieu. In continuation of our previous studies, which focused on vascular parameters, this is a novel study mainly focused on parameters related to cardiac remodeling. Therefore, the aim of the present study was to investigate the protective effect and mechanism of the action of diosgenin on blood pressure, cardiac function and functional recovery after I/R and the cardiac remodeling associated fetal gene expression program in adenine induced CRF rats.

2. Materials and methods

2.1 Animals and chemicals

Healthy male albino Wistar rats 8–10 weeks old (weighing 180–220 g), were obtained from the Central Animal House, Department of Experimental Medicine, Rajah Muthiah Medical College and Hospital, Annamalai University and maintained in an air-conditioned room (25 ± 3 °C) with a 12 h light/12 h dark cycle. Feed and water were provided ad libitum to all the animals. The study protocols were carried out in accordance with the guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals, New Delhi, India and approved by the Institutional Animal Ethics Committee of Rajah Muthiah Medical College and Hospital (Reg no. 160/1999/CPCSEA), Annamalai University, Annamalai nagar.

The Diosgenin and Hip–His–Leu substrate were purchased from Sigma-Aldrich. RNA isolation kit was purchased from Fluka. All other chemicals used in this study were of analytical grade and obtained from Merck and Himedia, India.

2.2 CRF rats and diosgenin treatment

CRF was induced in Wistar rats by feeding the animals with a diet containing 0.75% adenine for 5 weeks. Diosgenin was dissolved in corn oil (vehicle – 5 mL kg⁻¹) and administered to rats orally everyday using an intragastric tube for a period of 5 weeks. Each of the following groups consisted of six animals. Group I served as the control (animals fed with rat chow); Group II: control + diosgenin 40 mg kg⁻¹ body weight (b.w) of animal; Group III: CRF animals (fed diet with 0.75% adenine); Group IV: CRF + diosgenin 10 mg kg⁻¹ b.w of animal; Group V: CRF + diosgenin 20 mg kg⁻¹ b.w of animal; Group VI: CRF + diosgenin 40 mg kg⁻¹ b.w of animal. The vehicle was administered alone to the control (Group I) and CRF control rats (Group III) orally, daily for 5 weeks. After the completion of the experimental period, the rats were anesthetized and sacrificed by cervical dislocation.

2.3 Blood pressure measurement

Before taking blood pressure readings, animals were trained with the instrument for measuring the blood pressure. In all the groups of animals, systolic blood pressure (SBP) was noninvasively measured every week during the entire period of the study using a tail-cuff method (IITC, model 31, USA) according to the standard procedures. Values reported are the average of the lowest three readings. All the recordings and data analyses were done using a computerized data acquisition system and software.

2.4 Heart weight and collagen content

The heart was dissected out and then weighed. Heart weight-to-body weight ratio was calculated. As an estimate of collagen content, the hydroxyproline concentration was determined in left ventricular samples according to a previously described method.¹⁵ Briefly, lipids were extracted from myocardial samples and hydrolyzed with 6 N hydrochloric acid at 110 °C overnight. Hydrolyzates were neutralized with NaOH, and after extraction with activated charcoal, they were treated with chloramine-T and para-dimethyl-aminobenzaldehyde solution. Absorbance was read at 560 nm; hydroxyproline concentration was determined from the standard curve (expressed as mg g⁻¹ dry weight).

2.5 Histopathology of the heart

Excised heart samples from all the experimental groups were cleaned to remove blood and immediately fixed in 10% buffered neutral formalin. 5 μm thick tissue sections from heart were prepared from processed paraffin-embedded samples. Sections were stained with Masson's trichrome to obtain evidence of fibrotic changes in the heart tissue.

2.6 Evaluation of antioxidant status

Heart tissues were sliced into pieces and homogenized in 0.1 M Tris–HCl buffer in cold condition (pH 7.4) to obtain 20% homogenate (w/v). The homogenate was centrifuged at 560 × g for 10 min at 4 °C. The supernatant was separated and used for various biochemical estimations.

Superoxide dismutase (SOD) activity was assayed in heart by the method of Kakkar et al.¹⁶ The assay mixture contained 1.2 mL of sodium pyrophosphate buffer, 0.1 mL of phenazine methosulphate, 0.3 mL of nitroblue tetrazolium and an appropriately diluted enzyme preparation in a total volume of 3 mL. The reaction was initiated by the addition of 0.2 mL of nicotinamide adenine dinucleotide (NADH). After incubation at 30 °C for 90 s, the reaction was arrested by the addition of 1.0 mL of glacial acetic acid. The color density of the chromogen in n-butanol was measured at 510 nm against the butanol blank.

The activity of catalase (CAT) in heart was assayed by the method of Sinha.¹⁷ To 0.9 mL of phosphate buffer, 0.1 mL of tissue homogenate and 0.4 mL of H₂O₂ were added. The reaction was arrested after 60 s by adding 2.0 mL of dichromate–acetic acid mixture. The tubes were kept in a boiling water bath for 10 min and the color developed was read at 620 nm.

The activity of glutathione peroxidase (GPx) in heart was measured by the method of Rotruck et al.¹⁸ To 0.2 mL of Tris buffer, 0.2 mL of ethylene diamine tetraacetic acid (EDTA), 0.1 mL of sodium azide, and 0.5 mL of tissue homogenate were added. To the mixture, 0.2 mL of glutathione, followed by 0.1 mL of H₂O₂ was added. The contents were mixed well and incubated at 37 °C for 10 min along with a tube containing all the reagents except for the sample. After 10 min, the reaction was arrested by the addition of 0.5 mL of 10% TCA. The tubes were centrifuged and the supernatant was used for the estimation of glutathione.

Reduced glutathione (GSH) in heart was estimated by the method of Ellman.¹⁹ 0.5 mL of homogenate was pipetted out and precipitated with 2.0 mL of 5% TCA. A total of 2.0 mL of supernatant was withdrawn after centrifugation and 1.0 mL of Ellman's reagent and 4.0 mL of 0.3 M disodium hydrogen phosphate were added. The yellow color developed was read at 412 nm. Total protein was assayed by the method of Lowry et al.²⁰

2.7 Estimation of lipid peroxidation level

The level of thiobarbituric acid reactive substances (TBARS) in heart was estimated by the method of Niehaus and Samuelson.²¹ A total of 0.5 mL of tissue homogenate was diluted with 0.5 mL of double distilled water and mixed well, and then 2.0 mL of thiobarbituric acid (TBA)–trichloroacetic acid (TCA)–hydrochloric acid (HCL) reagent was added. The mixture was kept in boiling water bath for 15 min. After cooling, the tubes were centrifuged for 10 min and the supernatant was withdrawn for measurement. The absorbance was read at 535 nm against the reagent blank.

The estimation of tissue lipid hydroperoxides (LOOH) was performed by the method of Jiang et al.²² Fox reagent (0.9 mL) was mixed with 0.1 mL of tissue homogenate and incubated for 30 min at room temperature. The color developed was read at 560 nm.

2.8 Determination of ACE activity

The ACE activity in heart was measured by a spectrophotometric assay.²³ ACE activity in tissue homogenate was measured by the hydrolysis of Hip–His–Leu. Briefly, Hip–His–Leu was hydrolyzed into hippuric acid and His–Leu by ACE. Hippuric acid was extracted by ethyl acetate and determined at 228 nm. ACE activity was expressed as mU per mg protein.

2.9 Ventricular function-Langendorff isolated heart study

The left ventricular function of the rat heart was assessed using the Langendorff heart preparation. Briefly, after anesthesia, the heart was excised and placed in a cold (4 °C) Krebs Henseleit bicarbonate solution [composition (in mM): 118 NaCl, 4.7 KCl, 1.2 MgSO₄, 1.2 KH₂PO₄, 2.3 CaCl₂, 25.0 NaHCO₃, 11.0 glucose]. The heart was then attached to a cannula through aorta and retrogradely perfused with the Krebs solution maintained at 37 °C and continuously gassed with a mixture of 95% O₂–5% CO₂. Perfusion pressure was kept constant at 80 mmHg. Isovolumetric recordings of the rate of pressure development (+dp/dt) and rate of pressure decline (−dp/dt) were obtained from an elastic water-filled balloon, which was introduced into the left ventricle through a left atrial incision. The ventricular balloon was connected via fluid-filled tubing to a pressure transducer (ADInstruments) linked with a PowerLab data acquisition unit (ADInstruments) for continuous the assessment of ventricular performance.²⁴

2.10 Langendorff isolated heart I/R protocol

After the measurement of dp/dt, hearts were subjected to the I/R protocol to discover the protective effect of diosgenin pretreatment. The following groups were subjected to I/R protocol; Group I: I/R control; Group II: I/R control + diosgenin 40 mg kg⁻¹; Group III: CRF I/R; Group IV: CRF I/R + diosgenin 40 mg kg⁻¹. Isolated rat hearts obtained from all the abovementioned four groups were perfused with Krebs buffer solution for 10 min to stabilize the cardiac functions and then subjected to 30 min of global ischemia, followed by 60 min of reperfusion (Fig. 1B). The rate pressure product [RPP = (LVSP − LVEDP) × HR] was calculated as percentage by dividing the RPP of reperfusion by the RPP of pre-ischemic and multiplying it by hundred.²⁵

2.11 Gene expression analysis

After the investigation, heart tissues were subjected to total RNA extraction using an RNA isolation kit (Fluka). The integrity, quality and quantity of the RNA were determined by nano-drop spectrometer. 1 μg of RNA was used for quantitative reverse transcription–polymerase chain reaction (qRT–PCR) using the SYBR green method. SYBR Green Quantitative qRT–PCR Kit (Sigma Aldrich, USA) was utilized as per manufacturer's instructions for reverse transcription and amplification. Primer sequences for the forward primers (FP) and reverse primers (RP) were as follows; transforming growth factor-β (TGF-β) FP: ATGACATGAACCGACCCTTC and RP: GTAGTTGGTATCCAGGGCTCTC, β-myosin heavy chain (β-MHC) FP: GTAGACAAGGGCAAAGGCAA and RP: GGATGATGCAGCGTACAAAG, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) FP: ACCACAGTCCATGCCATCAC and RP: TCCACCACCCTGTTGCTGTA. The amplification specificity of all the primers was confirmed through agarose gel electrophoresis of the PCR products. The relative fold change method was utilized for calculating the differential expression between the samples.²⁶

2.12 Statistical analysis

Values are represented as mean ± SD for six rats in each group. Data were analyzed by one way analysis of variance (ANOVA) followed by Duncan's multiple range test (DMRT) using SPSS version 11.5 (SPSS, Chicago, IL). The limit of statistical significance was set at P < 0.05.

3. Results

3.1 Systolic blood pressure (SBP) and effective dose

Blood pressure was measured for all the groups, the dose of 20 mg kg⁻¹ and 40 mg kg⁻¹ b.w of diosgenin significantly reduced the SBP compared with CRF (P < 0.05). 40 mg kg⁻¹ dose showed more pronounced antihypertensive activity compared with 20 mg kg⁻¹. Therefore, 40 mg kg⁻¹ dose was selected for further evaluation. Fig. 1C indicates the systolic blood pressure changes in all the experimental groups.

3.2 Cardiac fibrosis and ACE activity

The relative heart weight-to-body weight ratio (heart weight in mg per body weight in g) and hydroxyproline level were increased significantly in the CRF animals. Treatment with 40 mg kg⁻¹ diosgenin significantly (P < 0.05) prevented the hypertrophy in the heart. Fig. 2A and B illustrate the heart weight-to-body weight ratio and hydroxyproline level, respectively. With regards to ACE, CRF significantly (P < 0.05) enhanced the activity of ACE in heart compared with the control, whereas diosgenin treatment significantly (P < 0.05) reduced the ACE activity. Fig. 2C shows the cardiac ACE activity.

Fig. 2 (A) Effect of diosgenin on heart weight-to-body weight ratio. (B) Effect of diosgenin on hydroxyproline level in heart. (C) Effect of diosgenin on cardiac ACE activity. Values are represented as mean ± SD. (n = 6). Data were analyzed by one way ANOVA followed by Duncan's multiple range test. Values not sharing common letter (a, b and c) are significant with each other at P < 0.05.

3.3 Oxidative stress and antioxidant status

The activities of enzymatic antioxidants SOD, CAT and GPx, and level of non-enzymatic antioxidant GSH, levels of TBARS and LOOH are shown in Table 1. CRF significantly (P < 0.05) decreased the activity of the abovementioned enzymes, level of GSH and increased the formation of lipid peroxidation products in the heart. Treatment with 40 mg kg⁻¹ diosgenin significantly (P < 0.05) enhanced the activity of enzymatic antioxidants, level of GSH and reduced the level of lipid peroxidation products in the heart.

Table 1 Effect of diosgenin on antioxidant and lipid peroxidation level in heart^a

Parameter	Control	Control + diosgenin	CRF	CRF + diosgenin
a U^* = enzyme concentration required to inhibit the chromogen produced by 50% in one minute under standard condition. U^# = μmol of H2O2 consumed/minute. U^% = μg of GSH utilized/minute. Values are represented as mean ± SD. (n = 6). Data were analyzed by one way ANOVA followed by Duncan's multiple range test. Values not sharing common superscript (a, b and c) are significant with each other at P < 0.05.
SOD (U* per mg protein)	6.82 ± 0.38^a	6.71 ± 0.43^a	3.69 ± 0.4^b	5.17 ± 0.58^c
CAT (U^# per mg protein)	50.65 ± 4.77^a	51.02 ± 5.07^a	30.21 ± 4.22^b	42.88 ± 3.43^c
GPx (U^% per mg protein)	6.55 ± 0.31^a	6.48 ± 0.24^a	4.06 ± 0.29^b	5.12 ± 0.36^c
GSH (μg mg^−1 protein)	8.51 ± 0.42^a	8.47 ± 0.52^a	4.89 ± 0.55^b	6.91 ± 0.68^c
TBARS (mmol/100 g wet tissue)	0.53 ± 0.03^a	0.51 ± 0.02^a	1.33 ± 0.13^b	0.77 ± 0.05^c
LOOH (mmol/100 g wet tissue)	55.43 ± 4.02^a	54.17 ± 3.72^a	122.17 ± 6.05^b	69.29 ± 4.73^c

---

3.4 Cardiac performance-Langendorff study

In this study, the rate of LV pressure rise +dp/dt (mmHg s⁻¹) and LV pressure decline −dp/dt (mmHg s⁻¹) in heart of CRF rats were significantly reduced (P < 0.05), whereas diosgenin treatment significantly (P < 0.05) promoted the ventricular function compared with CRF. Fig. 3A illustrates the +dp/dt and −dp/dt values.

Fig. 3 (A) Effect of diosgenin on ventricular function. (B) Percentage rate pressure product (%RPP) recovery after reperfusion. Values are represented as mean ± SD. (n = 6). Data were analyzed by one way ANOVA followed by Duncan's multiple range test. Values not sharing common letter (a, b and c) are significant with each other at P < 0.05.

3.5 Effect of diosgenin on functional recovery of the heart after I/R

Percentage RPP (%RPP) recovery was significantly (P < 0.05) decreased in chronic renal failure-I/R (CRF-I/R) when compared with the I/R-control group. Diosgenin pre-treatment in control (I/R control + diosgenin) and CRF (CRF-I/R + diosgenin) rats significantly increased the percentage recovery of RPP compared with the untreated I/R control and CRF-I/R hearts after reperfusion. There was no significant difference between the percentage RPP of diosgenin treated control and diosgenin treated CRF animals. Fig. 3B demonstrates percentage RPP recovery in various experimental groups.

3.6 Masson's trichrome staining of heart

The heart sections with Masson's trichrome staining show elevated accumulation of collagen and interstitial fibrosis in CRF heart, whereas diosgenin treatment reduces the abovementioned changes. Fig. 4 illustrates the histological changes of heart with Masson's trichrome stain.

Fig. 4 Effect of diosgenin on cardiac fibrosis. Representative images of heart tissue sections stained with Masson's trichrome. Control rat heart shows normal structural arrangement (A), heart from control + diosgenin 40 mg kg⁻¹ shows no pathogenic signatures (B), CRF heart shows interstitial fibrosis as indicated by arrow-mark (C) and CRF + diosgenin 40 mg kg⁻¹ shows no fibrotic changes (D).

3.7 Gene expression in heart

The heart of a CRF rat shows significantly (P < 0.05) elevated mRNA expression of TGF-β and β-MHC compared with the control when normalised against GAPDH expression. Diosgenin treatment significantly (P < 0.05) suppressed the expression of the abovementioned genes in CRF rat heart. Fig. 5 shows the relative fold changes in gene expression.

Fig. 5 Effect of diosgenin on hypertrophy marker gene expression. Figure indicates the relative expression fold changes of TGF-β (A) and β-MHC (B). Values are represented as mean ± SD. (n = 6). Data were analyzed by one way ANOVA followed by Duncan's multiple range test. Values not sharing common letter (a, b and c) are significant with each other at P < 0.05.

4. Discussion

CRF induced hypertension mainly contributes to the dysfunction of the circulatory system. An earlier study reported that green tea extracts prevent the development of cardiac hypertrophy in experimental renal failure, which may be related to the attenuation of hypertension.²⁷ CRF associated hyperphosphatemia induced endothelial dysfunction and vascular deregulation are the major contributors of the pathogenic condition.²⁸ In this study, diosgenin prevents the increase of SBP in CRF rats, which clearly shows its antihypertensive potential. Our preliminary study demonstrated that diosgenin treatment does not have significant impact on elevated renal failure markers.¹³ This directly indicates that the action of diosgenin on hypertension and cardiac remodeling would be independent of the renal function.

Cardiac hypertrophy correlates with increased blood pressure, increased fibrosis, and collagen deposition with reduced cardiac function. Collagen accumulation occurs in the heart during heart failure and contributes to the stiffening of the heart walls, impaired relaxation, impaired filling, and reduced cardiac output.²⁹ In this study, the elevated cardiac weight in CRF was prevented by diosgenin treatment; this may be due to the antihypertensive potential of diosgenin, which in turn reduces the pressure load induced hypertrophy. With regards to cardiac fibrosis, CRF increases the collagen content, as indicated by the hydroxyproline level and histopathology analysis.¹⁵ Michea et al. reported that oxidative stress generated during an uremic condition has the potential to induce fibrosis.⁹ In addition, Kai et al. explored that the ROS production would contribute to the perivascular inflammation and subsequent myocardial fibrosis.³⁰ Moreover, cardiac oxidative stress promotes the development of cardiac fibrosis by upregulating TGF-β1 expression, which subsequently enhances cardiac collagen synthesis and suppresses collagen degradation in hypertensive rats.³¹ From the oxidative stress and antioxidant point of view, a recent study provides evidence that the antioxidant apocynin attenuates oxidative stress and cardiac fibrosis in angiotensin II (Ang II)-induced cardiac diastolic dysfunction in mice.³² Furthermore, Ang II is also suggested to have pressure-independent effect on the ROS production.³⁰ Therefore, consistent with the previous studies,^12,13 the present study also found that diosgenin, with the antioxidant potential, enhances the activity of enzymatic and non-enzymatic antioxidant network along with ACE inhibitory activity; thus, it decreases the oxidative stress and fibrosis.

To further explore the antioxidant potential, we focused on the enzymatic and non-enzymatic antioxidant system. Free radical scavenging enzymes, such as SOD, CAT and GPx, are involved in the decomposition of superoxide and hydrogen peroxide before they interact to form the more reactive hydroxyl radical.^33,34 In this study, significantly lowered activities of the enzymatic antioxidants, namely, SOD, CAT and GPx, were observed in the heart of CRF rats. The decrease in the activities of SOD and CAT might be due to their increased utilization for scavenging ROS and their inactivation by excessive oxidants. GPx offers protection to the cellular and subcellular membranes from peroxidative damage by eliminating hydrogen peroxide and lipid peroxides, and the declined activity may be due to the reduced availability of GSH.³⁵ Michea et al. already explored that the uremic condition, which aggravates oxidative stress via increased free radicals, plays a major role in uremic heart hypertrophy through the cardiac MR activation.⁹ Lipid peroxidation, arising from the reaction of free radicals with lipids, has been linked with altered membrane structure and enzyme inactivation. Its end products, measured as TBARS and LOOH, were seen to be highly increased in the heart tissues, clearly indicating increased oxidative stress in CRF rats.³⁶ Results from the current study have shown that diosgenin increases the antioxidant level and decreases oxidative stress. Moreover, the anti-lipid peroxidation potential of diosgenin due to its antioxidant property is also already discovered.³⁷ From these evidences, we can conclude that the cardioprotective effect of diosgenin would be at least partially due to its effect on the lipid peroxidation and function of the antioxidant system.

Cardiac contractile dysfunction is one of the major pathogenic features of cardiac remodeling. The Langendorff isolated heart study found that CRF induces ventricular dysfunction, while the treatment with diosgenin prevents it. It was previously known that high dietary phosphorus and hyperphosphatemia have significant effects on cardiac fibrosis in uremic patients.² However, the excess production and accumulation of extracellular matrix (ECM) structural proteins, or fibrosis, results in enhanced stiffness and dysfunction of the myocardium.^38,39 Lipid peroxidation affects membrane permeability and alters membrane bound enzymes/ion channels, which disturbs ion transport, leads to Ca²⁺ overload and also demonstrates direct cardiac depression by malondialdehyde at the ventricular myocyte level possibly through oxidative stress.⁴⁰ These dysfunctional responses may result from the redox modification of proteins involved in excitation-contraction coupling and/or mitochondrial energy production.⁴¹ In this study, the results shows that diosgenin treatment reduces cardiac fibrosis and oxidative stress by its antihypertensive activity and increases the potential of enzymatic and non-enzymatic antioxidant system, thus improving the ventricular function.

The functional recovery of the uremic heart after I/R is very poor compared with normal animal hearts.⁶ Uremia accelerated oxidative stress⁹ and reduced tolerance of the heart in renal failure rats after ischemia may be the major problem hindering the ventricular recovery.⁴² Vasanthi et al. explored that the extract of Dioscorea bulbifera contains diosgenin, which ameliorates myocardial I/R injury by improving ventricular function and inhibiting cardiomyocyte necrosis and apoptosis.⁴³ Consistent with the abovementioned report, our study also demonstrates that the oral administration of diosgenin offers cardio-protection and improved functional recovery of the CRF heart after I/R.

At the molecular level, cardiac remodeling associates with genetic reprogramming.⁴⁴ The upregulated gene TGF-β is a locally generated cytokine that has been implicated as a major contributor to tissue fibrosis, and studies in humans and experimental models have indicated increased myocardial TGF-β expression during cardiac hypertrophy and fibrosis.^45,46 The upregulation of β-MHC transcription has been used as an early and sensitive marker of cardiac hypertrophy. In general, α-MHC is normally a predominant isoform in heart, and expression of β-MHC contributes to the overall poor functioning of the hypertrophic ventricle.⁴⁷ Therefore, the effect of diosgenin on the expression of TGF-β and β-MHC isoform may lead to an preventive effect on cardiac remodeling, which in turn improves the cardiac function.

5. Conclusion

Oxidative stress has been identified as one unifying mechanism in the pathogenesis of CKD and CVD. Cardiac oxidative stress promotes the development of cardiac fibrosis and remodeling. Antioxidants may need to be given as a pharmacotherapy with the aim of reducing the burden of these chronic diseases. Major findings from the present study demonstrated that diosgenin reduces cardiac remodeling by preventing hypertension and fibrotic changes through its beneficial effect on oxidative stress and antioxidant system, thus enhancing the cardiac function in CRF rats. Furthermore, diosgenin improves the functional recovery of CRF heart after I/R injury. Our findings illustrate that in the future, diosgenin will be used as a beneficial molecule for the treatment of CKD.

References

1. M. Baumann, K. Leineweber, M. Tewiele, K. Wu, T. R. Türk, S. Su, M. Gössl, T. Buck, B. Wilde, U. Heemann, A. Kribben and O. Witzke, Nephrol., Dial., Transplant., 2010, 25, 1817–1824.
2. K. Amann, J. T. Rnig, B. Kugel, M. L. Gross, K. Tyralla, A. El-Shakmak, A. S. Szabo and E. Ritz, Kidney Int., 2003, 63, 1296–1301.
3. H. Nakamura, M. Tokumoto, M. Mizobuchi, C. S. Ritter, J. L. Finch, M. Mukai and E. Slatopolsky, Am. J. Nephrol., 2010, 31, 292–302.
4. G. A. Stewart, R. T. Gansevoort, P. B. Mark, E. Rooney, T. A. Mcdonagh, H. J. Dargie, R. Stuart, C. Rodger and A. G. Jardine, Kidney Int., 2005, 67, 217–226.
5. W. M. McClellan, Med. Clin. North Am., 2005, 89, 419–445.
6. C. J. Byrne, K. McCafferty, J. Kieswich, S. Harwood, P. Andrikopoulos, M. Raftery, C. Thiemermann and M. M. Yaqoob, Circulation, 2012, 125, 1256–1265.
7. K. Husain, L. Ferder, M. Mizobuchi, J. Finch and E. Slatopolsky, Am. J. Nephrol., 2009, 29, 465–472.
8. K. Amann, J. Törnig, M. Buzello, A. Kuhlmann, M. L. Gross, M. Adamczak, M. Buzello and E. Ritz, Kidney Int., 2002, 62, 877–884.
9. L. Michea, A. Villagrán, A. Urzúa, S. Kuntsmann, P. Venegas, L. Carrasco, M. Gonzalez and E. T. Marusic, Hypertension, 2008, 52, 295–300.
10. M. Esfandiarei, J. T. Lam, S. A. Yazdi, A. Kariminia, J. N. Dorado, B. Kuzeljevic, H. T. Syyong, K. Hu and C. van Breemen, J. Pharmacol. Exp. Ther., 2011, 336, 925–939.
11. K. W. Choi, H. J. Park, D. H. Jung, T. W. Kim, Y. M. Park, B. O. Kim, E. H. Sohn, E. Y. Moon, S. H. Um, D. K. Rhee and S. Pyo, Vasc. Pharmacol., 2010, 53, 273–280.
12. L. Pari, P. Monisha and A. M. Jalaludeen, Eur. J. Pharmacol., 2012, 691, 143–150.
13. J. Manivannan, T. R. Barathkumar, J. Sivasubramanian, P. Arunagiri, B. Raja and E. Balamurugan, Mol. Cell. Biochem., 2013, 13, 1588–1598.
14. J. Manivannan, J. Shanthakumar, P. Arunagiri, B. Raja and E. Balamurugan, Biochimie, 2014, 102, 183–187.
15. D. Susic, J. Varagic, J. Ahn, L. Matavelli, D. Edward and E. D. Frohlich, Am. J. Physiol.: Heart Circ. Physiol., 2007, 292, H175–H179.
16. P. Kakkar, B. Das and P. N. Viswanathan, Indian J. Biochem. Biophys., 1984, 21, 130–132.
17. A. K. Sinha, Anal. Biochem., 1972, 47, 389–394.
18. J. T. Rotruck, A. L. Pope, H. E. Ganther, A. B. Swanson, D. G. Hafeman and W. G. Hoekstra, Science, 1973, 179, 588–590.
19. G. L. Ellman, Arch. Biochem. Biophys., 1959, 82, 70–77.
20. O. H. Lowry, N. J. Rosebrough, A. L. Farr and A. L. Randall, J. Biol. Chem., 1951, 193, 265–275.
21. W. G. Niehaus and B. Samuelson, Eur. J. Biochem., 1968, 6, 126–130.
22. Z. Y. Jiang, J. V. Hunt and S. P. Wolff, Anal. Biochem., 1992, 202, 384–389.
23. D. K. Sharma, A. Manral, V. Saini, A. Singh, B. P. Srinivasan and M. Tiwari, Eur. J. Pharmacol., 2012, 691, 198–208.
24. A. Fenning, G. Harrison, R. Rose'meyer, A. Hoey and L. Brown, Am. J. Physiol.: Heart Circ. Physiol., 2005, 289, H1408–H1416.
25. O. Senthamizhselvan, J. Manivannan, T. Silambarasan and B. Raja, Eur. J. Pharmacol., 2014, 736, 131–137.
26. T. D. Schmittgen and K. J. Livak, Nat. Protoc., 2008, 3, 1101–1108.
27. S. Priyadarshi, B. Valentine, C. Han, O. V. Fedorova, A. Y. Bagrov, J. Liu, S. M. Periyasamy, D. Kennedy, D. Malhotra, Z. Xie and J. I. Shapiro, Kidney Int., 2003, 63, 1785–1790.
28. R. L. Sutliff, E. R. Walp, A. M. El-Ali, S. Elkhatib, K. A. Lomashvili and W. C. O'Neill, Am. J. Physiol.: Renal, Fluid Electrolyte Physiol., 2011, 301, F78–F83.
29. E. M. Seymour, A. M. Singer, M. R. Bennink, R. V. Parikh, A. Kirakosyan, P. B. Kaufman and F. Steven, J. Gerontol., Ser. A, 2008, 63, 1034–1042.
30. H. Kai, T. Mori, K. Tokuda, N. Takayama, N. Tahara, K. Takemiya, H. Kudo, Y. Sugi, D. Fukui, H. Yasukawa, F. Kuwahara and T. Imaizumi, Hypertens. Res., 2006, 29, 711–718.
31. W. Zhao, T. Zhao, Y. Chen, R. A. Ahokas and Y. Sun, Mol. Cell. Biochem., 2008, 317, 43–50.
32. Y. Q. Li, X. B. Li, S. J. Guo, S. L. Chu, P. J. Gao, D. L. Zhu, W. Q. Niu and N. Jia, Acta Pharmacol. Sin., 2013, 34, 352–359.
33. J. Wu, J. G. Hecker and N. Chiamvimonvat, Adv. Drug Delivery Rev., 2009, 61, 351–363.
34. S. K. Wattanapitayakul and J. A. Bauer, Pharmacol. Ther., 2001, 89, 187–206.
35. H. Li, Y. H. Xie, Q. Yang, S. W. Wang, B. L. Zhang, J. B. Wang, W. Cao, L. L. Bi, J. Y. Sun, S. Miao, J. Hu, X. X. Zhou and P. C. Qiu, PLoS One, 2012, 7, e48872.
36. T. Silambarasan and B. Raja, Eur. J. Pharmacol., 2012, 679, 81–89.
37. K. S. Jayachandran, H. R. Vasanthi and G. V. Rajamanickam, Mol. Cell. Biochem., 2009, 327, 203–210.
38. J. Diez, R. Querejeta, B. Lopez, A. Gonzalez, M. Larman and J. L. Martinez Ubago, Circulation, 2002, 105, 2512–2517.
39. I. Manabe, T. Shindo and R. Nagai, Circ. Res., 2002, 91, 1103–1113.
40. D. V. Folden, A. Gupta, A. C. Sharma, S. Y. Li, J. T. Saari and J. Ren, Br. J. Pharmacol., 2003, 139, 1310–1316.
41. S. K. Shenouda, K. C. Lord, E. McIlwain, P. A. Lucchesi and K. J. Varner, Cardiovasc. Res., 2008, 79, 662–670.
42. R. Dikow, L. P. Kihm, M. Zeier, J. Kapitza, J. Törnig, K. Amann, C. Tiefenbacher and E. Ritz, J. Am. Soc. Nephrol., 2004, 15, 1530–1536.
43. H. R. Vasanthi, S. Mukherjee, D. Ray, K. S. Pandian Jayachandran, I. Lekli and D. K. Das, Food Funct., 2010, 1, 278–283.
44. K. Pandya and O. Smithies, Circ. Res., 2011, 109, 609–610.
45. S. Rosenkranz, Cardiovasc. Res., 2004, 63, 423–432.
46. M. O. Bolyut, L. O'Neill, A. L. Meredith, O. H. Bing, W. W. Brooks, C. H. Conrad, M. T. Crow and E. G. Lakatta, Circ. Res., 1994, 75, 23–32.
47. M. Krenz and J. Robbins, J. Am. Coll. Cardiol., 2004, 44, 2390–2397.

---