Isolation and characterization of an electrochemically active and cyanide-degrading bacterium isolated from a microbial fuel cell

Abstract

A facultative anaerobic bacterium capable of generating electricity and degrading cyanide was isolated from a microbial fuel cell and was designated as MC-1. According to its morphological characteristics and the sequence analysis of 16S rDNA, the isolated bacterium was identified as a strain of Klebsiella sp. Cyclic voltammetry showed that the strain MC-1 exhibited high electrochemical activity. The preliminary electricity-production experiment showed that the strain MC-1 could use glucose–cyanide mixtures for electricity production in a microbial fuel cell (MFC). The maximum voltage was 412 mV, and the chemical oxygen demand (COD) removal rate and cyanide degradation rate were 88.34% and 99.51%, respectively, when the MFC was fed with glucose–cyanide mixtures. The results demonstrated that the strain MC-1 was promising for the bioremediation of cyanide-containing wastewater in MFCs.

---

1. Introduction

Cyanide salts were important reagents used in industries such as metal plating, ore leaching, pesticide manufacturing, coal gasification and synthetic fibers.^1–5 Because cyanide is highly toxic to living organisms, cyanide-containing wastewater must be detoxified before discharging it into the environment. At present, cyanide-containing wastewater is mainly treated by chemical oxidation methods but these methods are expensive and cannot completely degrade cyanide.⁶ The use of biological processes for the treatment of industrial and hazardous liquid wastes were well established because biological treatment can provide a simple and cost effective solution to the treatment of liquid wastes, while providing high quality and environmentally acceptable effluents. Previous reports have shown that biological processes were employed to detoxify cyanide in cyanide-containing wastewater.^7,8 Microbial degradation can completely metabolise cyanide into non-toxic products through diverse degradation pathways, e.g., hydrolytic, oxidative, reductive, and substitution/transfer. In the previous studies, Pseudomonas, Bacillus and Klebsiella oxytoca have been isolated and used to degrade cyanide by suspended and fixed film systems under aerobic or anaerobic environment.^9–11 Microbial processes for cyanide biodegradation was first used to treat cyanide-rich wastewater at the Homes take Gold Mine but its continued development and application was limited primarily by physical and economic factors.^7,12

Microbial fuel cell (MFC) technology holds promise for biological wastewater treatment because of its capability for simultaneous wastewater treatment and electrical energy production.^13,14 Some researchers have reported that MFCs could be used to treat domestic and industrial wastewater. Some biotoxic substances and recalcitrant organics in industrial wastewater have been proven to be inhibitors to electricity generation in MFCs. It has been reported that some recalcitrant organics could be biodegradated or used in MFCs after suitable acclimation. Catal et al.¹⁵ investigated furfural and phenolic compounds as substrates in a single-chamber air-cathode MFC for electricity generation. Their results indicate that only 5-HMF can directly produce electricity in the MFC in the absence of other electron donors. 2-furaldehyde, benzyl alcohol and acetophenone inhibited electricity generation even at concentrations less than 0.2 mM. Luo et al.¹⁶ investigated pyridine as a substrate for electricity generation in the G-MFC after acclimation for 90 days. Their results showed that pyridine with concentrations up to 500 mg L⁻¹ was biodegraded efficiently and was not detectable within 12 h. Kaewkannetra et al.¹⁷ explored agro-industrial wastewater as a resource collected from cassava mills for electricity generation in MFCs. Their results showed that the MFCs could generate electricity from full-strength cyanide laden wastewater with a maximum power density of 1771 mW m⁻², whilt simultaneously treating the cyanide laden cassava mill wastewater effectively. From a research point of view, MFC may be a powerful tool for industrial wastewater treatment.

Effective electricity generation using biotoxic and recalcitrant compounds as fuel in MFCs may require the screening of new bacteria capable of tolerating and degrading these compounds.¹⁵ Currently, the reported electricigens are Geobacter sp.,^18–20 Shewanella sp.,^21,22 Pseudomonas sp.,²³ Rhodopseudomonas palustris,²⁴ Tolumonas osonensis,²⁵ which carry out metabolism using readily biodegradable organic matter such as glucose, sodium acetate, formic acid. The electricity-producing capacity of the electricigens declines for the biodegradation of cyanide-containing wastewater in MFCs because cyanide can strongly inhibit the activity and metabolism of most microorganisms. Therefore, if an electricity-producing and cyanide-degrading strain is screened, it will be of great significance for the treatment of cyanide-containing wastewater.

In the study reported here, an electrochemically active and cyanide-degrading strain was successfully obtained from a microbial fuel cell, which was identified to be Klebsiella sp. MC-1. The electrochemical activity of the strain MC-1 was characterized by cyclic voltammetry. The strain MC-1 was employed as a biocatalyst in an MFC for cyanide degradation and electricity generation.

2. Materials and methods

2.1 Cyanide solution and other materials

A cyanide stock solution (1000 mg L⁻¹) was prepared by dissolving NaCN (purity ≥ 97%) in deionized distilled water, and the pH of the solutions was maintained at 10.3 and was adjusted using 1 N NaOH. All the other chemicals were of analytical grade and were used as-received, unless stated otherwise.

2.2 Isolation procedures

The bacterial strain was isolated from the anode biofilm of a microbial fuel cell through the acclimation of cyanide–glucose mixtures. A piece (1 cm³) of anode was transferred to a sterile 150 mL serum bottle containing 100 mL of liquid medium. The liquid medium contained (g L⁻¹) glucose 0.5, cyanide 0.05, tryptone 2.0, yeast 1.0, ferric citrate 2.5, (NH₄)₂SO₄ 0.4, K₂HPO₄ 0.4, and NaCl 0.1 (adjusted to pH 8.0–9.5 with NaOH). Glucose and ferric citrate in the liquid medium were used as the electron donor and acceptor, respectively. The solid medium was prepared by adding 2% (w/w) agar to the liquid medium. The serum bottle was sealed and shaken vigorously to separate the microbial cells from the carbon felt and incubated in an anaerobic incubator (YQX-II, CIMO, Shanghai, China). After incubation for 3 days, the cell suspension was then properly diluted in a sterile 1% NaCl solution. The bacterial strains were isolated by the Hungate roll-tube technique.²⁶ A single colony was selected and inoculated in a sterilized liquid medium and allowed to grow in laboratory conditions at 30 °C for at least 48–72 h. The suspension of strain MC-1 was used as the inocula for the MFC experiments.

2.3 Morphological characterization

A light microscope (Jenalumar, Carl Zeiss Jena GmbH, Jena, Germany) was used to observe cell morphology and determine the Gram reaction. For scanning electron microscopy, cells grown at 4 °C for 50 h were fixed with 2% glutaraldehyde in 0.1 M K₂HPO₄/KH₂PO₄ buffer at pH 7 for more than 2 h. They were then washed with the buffer and dehydrated in acetone on cellulose-filter membranes. After freeze-drying with a freeze dryer (LGJ-10C, Sihuan, Beijing, China), specimens were coated with gold using an ion sputter coater (E-1045, Hitachi, Tokyo, Japan) and observed with a scanning electron microscope (Quanta200, FEI, Netherland).

2.4 16S rDNA gene sequencing and analysis

Polymerase chain reaction (PCR) amplification of the 16S rDNA gene fragment was carried out by PCR (Perkin Elmer, Foster City, Calif., USA) using a pair of universal primers:²⁷ 27f: AGAGTTTGATCCTGGCTCAG and 1492r: GGTTACCTTG TTACGACTT. The nucleotide sequence containing 1440 base pairs was obtained from the Beijing Sunbiotech Co., Ltd. and queried against the BLAST program (http://www.Ncbi.nlm.nih.gov, NCBI, Bethesda, Md., USA); high homologous sequences were aligned with 16S rDNA gene sequences of related organisms using CLUSTAL-X. A phylogenetic tree based on the alignment was constructed using the program MEGA 4 by the Neighbor-Joining method.²⁸

2.5 The determination of the Klebsiella sp. MC-1 growth curve

For the determination of the Klebsiella sp. MC-1 growth curve, 1 mL of inocula was loaded in a 50 mL serum bottle and 30 mL sterile phosphate buffer medium with glucose–cyanide mixtures were then added. The bottle was capped and placed in an incubator shaker at 30 °C and 150 rpm for 120 h. Samples were obtained from the bottle at different times and determined by the trubidimetry method measuring optical density at 600 nm (OD_600nm).

2.6 Electrochemical analysis

Cyclic voltammetry was employed to investigate electrochemically active compounds in the presence of the medium released by the bacteria, which are involved in the shuttling of electrons.²⁹ The cells were washed and suspended in phosphate buffer (50 mM, pH = 7) with 0.1 M NaCl. The cyclic voltammograms of the cell suspensions were obtained using an electrochemical workstation (CHI660D, Shanghai, China). A glassy carbon working electrode, a platinum counter electrode, and an Ag/AgCl reference electrode were used in an electrochemical cell with a working volume of 100 mL. The working electrode was polished with aluminium–water slurry on cotton wool prior to each measurement. Oxygen-free nitrogen was gassed through the cell for 20 min before measurements. A scan rate of 100 mV s⁻¹ was employed over the range from 0.8 to −0.2 V.

2.7 MFC reactors and operation

A two-chamber MFC (Fig. 1) was designed and constructed. The total volume of each chamber was approximately 110 mL. A proton exchange membrane (Nafion 112, Dupont) was placed between the chambers with a projecting area of 36 cm². Carbon cloth (COS, Beijing Sanye Carbon Co., Ltd) anode and cathode were placed in the two chambers and titanium wire (1 mm in diameter) was used to connect the electrodes. MFCs were operated in fed-batch mode with an external resistance of 1000 Ω. The MFC was started using the suspension of strain MC-1 in the anode chamber and 50 mM K₃Fe(CN)₆ and 50 mM phosphate buffer solution in the cathode chamber at room temperature (25 ± 5 °C). Voltage was measured and recorded using a data acquisition system (AD8201H, Ribohua Co., Ltd) after every 3 min.

Fig. 1 Schematic drawing of the microbial fuel cell.

Substrates used in the anode included cyanide and the mixtures of glucose and cyanide. The MFC was operated with 500 mg L⁻¹ glucose as the fuel at the beginning. After electrical output reached a steady state, the MFC was operated sequentially using the mixtures of glucose and cyanide and cyanide as the substrates. In addition to the substrates, the anodic solution also contained Na₂HPO₄ 4.09 g L⁻¹ and Na₂HPO₄·H₂O (2.93 g L⁻¹), NH₄Cl (0.31 g L⁻¹), KCl (0.13 g L⁻¹), NaCl (0.1 g L⁻¹), Wolfes' trace mineral solution (5 mL L⁻¹) and Wolfes' vitamin solution (5 mL L⁻¹)³⁰ and was maintained under anaerobic conditions.

2.8 Analyses

Cyanide was assayed by an isonicotinic acid–barbituric acid method. Cyanide reacts with KH₂PO₄ solution and chloramines-T, and then the isonicotinic acid–barbituric acid reagent was added to form a soluble violet-blue product, which was measured at 600 nm with a spectrophotometer.³¹ COD was analyzed according to the standard method.³²

3. Results and discussion

3.1 Isolation and characterization of Klebsiella sp. MC-1

Based on light-microscopy and scanning electron microscopy observations, colonies were buff, domed and appeared to have slime around them (Fig. 2). The cells were Gram-negative (Figure not shown) and rod-shaped with 0.3 to 0.8 μm in width and 2.5 to 5.0 μm in length. These cells were interwoven by nanowires (Fig. 3), which had high conductivity and could transfer from electron to electrode under the condition of long distance.^33,34

Fig. 2 Colony morphology photo of the Klebsiella sp. MC-1.

Fig. 3 Cell morphology of the strain MC-1 by scanning electron micrographs.

In order to identify the strains, we cloned 1.5 kb DNA fragments, containing more than 99% of the 16S rRNA gene of the strain, and determined their complete nucleotide sequence. The sequence similarity was compared with those of the reference organisms obtained from GenBank data libraries (Fig. 4). It was clearly shown that the strain MC-1 (designated as Klebsiella sp. MC-1) belonged to the Klebsiella subphylum, which was nearly 99% homologous with that of Klebsiella sp. TJ_DMAB (GenBank accession no. JF701187).

Fig. 4 Phylogenetic tree based on the results of a neighbor-joining analysis of 16Sr DNA sequences for the strain MC-1 and various other members of the Gammaproteobacteria. Accession numbers for the sequences were indicated in parentheses. The bootstrap values at the nodes were calculated using 1000 replicates. Bar 0.5% sequence divergence.

3.2 Growth of the strain Klebsiella sp. MC-1

The time-course removal of cyanide during the growth of strain MC-1 on 500 mg L⁻¹ glucose and 30 mg L⁻¹ cyanide is shown in Fig. 5. The degradation of cyanide was coupled to the growth of the strain MC-1. Cyanide degradation was low during the lag phase, and the removal rate of cyanide was only 2.3%, which was attributed to the poor metabolic activity of the strain MC-1. The exponential growth phase of the growth starts after a lag period of about 25 h, and the rate of cyanide degradation increased linearly with increasing biomass. The highest cell density was achieved just before the stationary phase at about 65 h after inoculation. The removal rate of cyanide reached 99.82% at 75 h, which was because of the biodegradation of the strain MC-1. In the biodegradation of cyanide, bacteria convert cyanides to carbonate and ammonia.⁷ These results showed that the strains MC-1 performed well in the biodegradation of cyanide.

Fig. 5 Time course of cyanide biodegradation by the strain MC-1 during growth on liquid medium containing 500 mg L⁻¹ glucose and 30 mg L⁻¹ cyanide.

3.3 Electrochemical activity

The electrochemical activity of the strain MC-1 was investigated by the cyclic voltammetry method (Fig. 6). The cyclic voltammogram of the fresh medium with the cell suspensions of the strain MC-1 showed reduction and oxidation peaks at 102 mV and 299 mV, vs. the Ag/AgCl reference electrode, respectively; while the fresh medium had no reduction or oxidation peaks. These results supported the conclusion that the electrochemically active compound, responsible for electron transfer to electrodes, was excreted by the strain MC-1. In addition, other Klebsiella species have been reported to be electrochemically active bacteria in MFCs. Zhang et al.³⁵ obtained Klebsiella pneumonia L17 from subterranean forest sediment and confirmed its capability of electricity generation from glucose and starch, and proposed that the established biofilm transferred electrons directly to the electrode. Xia et al.³⁶ employed a new Klebsiella sp. ME17 to understand their electrogenesis mechanisms and indicated that ME17 excreted quinone-like substances to facilitate extracellular electron transfer during the production of electricity.

Fig. 6 Cyclic voltammogram curves of the cell suspensions of Klebsiella sp. MC-1 and the fresh medium.

3.4 Voltage output of the MFC using different concentrations of glucose and cyanide

The MFC was operated with different concentrations of glucose and cyanide, including (1) 500 mg L⁻¹ glucose, (2) a mixture of 500 mg L⁻¹ glucose and 30 mg L⁻¹ cyanide, (3) a mixture of 500 mg L⁻¹ glucose and 50 mg L⁻¹ cyanide, (4) a mixture of 500 mg L⁻¹ glucose and 80 mg L⁻¹ cyanide, (5) 50 mg L⁻¹ cyanide. Voltage curves of 5 operation cycles are shown in Fig. 7. Electricity generated in the MFC decreased with the increasing cyanide concentration. When using a mixture of 500 mg L⁻¹ glucose and 30 mg L⁻¹ cyanide as the fuel, the maximum voltage output and the time period for voltages higher than 383 mV were nearly similar to the use of 500 mg L⁻¹ glucose as the sole fuel. The results suggested that the low concentration (<30 mg L⁻¹) of cyanide did not affect electricity generation. Kim et al.³⁷ reported that metabolic inhibitors effected electricity production in microbial fuel cells, and found slight improvements in current generation when they added cyanide albeit at low concentrations (up to 1.5 mM). With increasing cyanide concentration, the maximum voltage output was reduced but the time period was prolonged. This might be due to cyanide inhibiting the growth of organisms because it is toxic and results in a low voltage. When using 50 mg L⁻¹ cyanide as the sole fuel, the voltage started increasing after 5.4 h. Cyanide was degraded nearly completely at the end of each time period under different concentrations of the mixture of glucose and cyanide or just cyanide. Power generation of the MFC using cyanide–glucose mixtures was higher than that using cyanide alone because glucose can be biodegraded more easily to supply electrons for increasing the metabolic rate of the strain MC-1, which enhanced cyanide to be metabolized, or co-metabolized.^38,39 In our research, Klebsiella sp. MC-1 in the anode of the MFC after acclimation could generate electricity using cyanide as the fuel in the absence of glucose. This might be because of the conversion of cyanide into simple organic molecules by enzymes or the assimilation of cyanide in the microbe as a nitrogen and carbon source.^7,40

Fig. 7 Electricity voltage output obtained from the MFC using glucose, glucose–cyanide mixtures and cyanide.

3.5 COD removal and cyanide degradation using glucose–cyanide mixtures as a substrate in the MFC

The cell voltage, COD removal rate and cyanide biodegradation rate in the MFC were investigated when the glucose–cyanide mixtures were used as the substrate (Fig. 8). Cyanide was degraded quickly at the initial stages. Similar degradation of quinoline and furfural in MFC has been reported.^16,41 The maximum voltage output was 412 mV when cyanide was degraded to a low concentration (<5 mg L⁻¹). The degrading efficiency of cyanide and the removal efficiency of COD were 99.51% and 88.34%, respectively, at 40 h. The removal rate of COD reached up to 85% when voltage was declined to low levels. These results indicated that the strain MC-1 in the MFC was significantly effective in treating the mixtures of cyanide and glucose, and power generation was consistent with the removal of organic matter.

Fig. 8 Comparison of voltage output with COD and cyanide removal using 500 mg L⁻¹ glucose and 30 mg L⁻¹ cyanide as the MFC fuel.

4. Conclusions

In this study, a Klebsiella sp. MC-1 was isolated, belonging to the Klebsiella subphylum, and could generate stable electricity using glucose–cyanide mixtures as fuel. Using this bacterium, a maximum voltage of 412 mV was obtained using glucose–cyanide mixtures as the substrate in a two-chamber MFC. In addition, COD removal rate and cyanide biodegradation rate were 88.34% and 99.51%, respectively, when the voltage declined to low levels at 40 h. These results indicated that the MFC technology should be a potential method for the biodegradation of cyanide-containing wastewater. The exact mechanism of cyanide degradation by Klebsiella sp. MC-1, the determination of operating parameters and the scale-up of the MFC for the treatment of cyanide-containing wastewater requires further investigation.

Acknowledgements

This research was supported by China ocean mineral resources research program (no. DY125-15-T-08) and the National Natural Sciences Foundation of China (Grant no. 21176026; 21176242).

References

1. S. R. Wild, T. Rudd and A. Neller, Sci. Total Environ., 1994, 156, 93–107.
2. J. Mosher and L. Figueroa, Miner. Eng., 1996, 9, 573–581.
3. Z. S. Shen, B. B. Han and R. Wickramasinghe, Water Environ. Res., 2004, 76, 15–22.
4. Z. Wang, X. Xu, Z. Gong and F. Yang, J. Hazard. Mater., 2012, 235, 78–84.
5. J. V. Ros-Lis, R. Martínez-Máñez and J. Soto, Chem. Commun., 2002, 2248–2249.
6. C. Y. Chen, C. M. Kao and S. C. Chen, Chemosphere, 2008, 71, 133–139.
7. R. R. Dash, A. Gaur and C. Balomajumder, J. Hazard. Mater., 2009, 163, 1–11.
8. S. Ebbs, Curr. Opin. Biotechnol., 2004, 15, 231–236.
9. C.-F. Wu, X.-M. Xu, Q. Zhu, M.-C. Deng, L. Feng, J. Peng, J.-P. Yuan and J.-H. Wang, Appl. Microbiol. Biotechnol., 2014, 98, 3801–3807.
10. C. Chen, C. Kao and S. Chen, Chemosphere, 2008, 71, 133–139.
11. M. Huertas, L. Sáez, M. Roldán, V. Luque-Almagro, M. Martínez-Luque, R. Blasco, F. Castillo, C. Moreno-Vivián and I. García-García, J. Hazard. Mater., 2010, 179, 72–78.
12. T. Mudder and M. Botz, Chemistry and treatment of cyanidation wastes, Mining Journal Books, London, UK, 2001.
13. X. W. Liu, X. F. Sun, Y. X. Huang, G. P. Sheng, K. Zhou, R. J. Zeng, F. Dong, S. G. Wang, A. W. Xu, Z. H. Tong and H. Q. Yu, Water Res., 2010, 44, 5298–5305.
14. Z. Du, H. Li and T. Gu, Biotechnol. Adv., 2007, 25, 464–482.
15. T. Catal, Y. Fan, K. Li, H. Bermek and H. Liu, J. Power Sources, 2008, 180, 162–166.
16. Y. Luo, G. Liu, R. Zhang and C. Zhang, J. Power Sources, 2010, 195, 190–194.
17. P. Kaewkannetra, W. Chiwes and T. Chiu, Fuel, 2011, 90, 2746–2750.
18. C. Dumas, R. Basseguy and A. Bergel, Electrochim. Acta, 2008, 53, 5235–5241.
19. D. E. Holmes, S. K. Chaudhuri, K. P. Nevin, T. Mehta, B. A. Methé, A. Liu, J. E. Ward, T. L. Woodard, J. Webster and D. R. Lovley, Environ. Microbiol., 2006, 8, 1805–1815.
20. N. S. Malvankar, M. T. Tuominen and D. R. Lovley, Energy Environ. Sci., 2012, 5, 5790–5797.
21. L. A. Fitzgerald, E. R. Petersen, R. I. Ray, B. J. Little, C. J. Cooper, E. C. Howard, B. R. Ringeisen and J. C. Biffinger, Process Biochem., 2012, 47, 170–174.
22. B. H. Kim, T. Ikeda, H. S. Park, H. J. Kim, M. S. Hyun, K. Kano, K. Takagi and H. Tatsumi, Biotechnol. Tech., 1999, 13, 475–478.
23. T. H. Pham, N. Boon, P. Aelterman, P. Clauwaert, L. De Schamphelaire, L. Vanhaecke, K. De Maeyer, M. Hofte, W. Verstraete and K. Rabaey, Appl. Microbiol. Biotechnol., 2008, 77, 1119–1129.
24. D. Xing, Y. Zuo, S. Cheng, J. M. Regan and B. E. Logan, Environ. Sci. Technol., 2008, 42, 4146–4151.
25. J. M. Luo, J. Yang, H. H. He, T. Jin, L. Zhou, M. Wang and M. H. Zhou, Bioresour. Technol., 2013, 139, 141–148.
26. R. Humane, Methods Microbiol., 1969, 3, 117.
27. J. A. Frank, C. I. Reich, S. Sharma, J. S. Weisbaum, B. A. Wilson and G. J. Olsen, Appl. Environ. Microbiol., 2008, 74, 2461–2470.
28. K. Tamura, J. Dudley, M. Nei and S. Kumar, Mol. Biol. Evol., 2007, 24, 1596–1599.
29. A. Nandy, V. Kumar and P. P. Kundu, Enzyme Microb. Technol., 2013, 53, 339–344.
30. R. M. Atlas, Handbook of microbiological media, CRC press, 2004.
31. S. Nagashima and T. Ozawa, Int. J. Environ. Anal. Chem., 1981, 10, 99–106.
32. A. P. H. Association and A. W. W. Association, Standard methods for the examination of water and wastewater, 14th edn, 1976, p. 550.
33. Y. Gorby, C. Davis and E. Atekwana, in AGU Spring Meeting Abstracts, 2006, p. 03.
34. G. Reguera, K. D. McCarthy, T. Mehta, J. S. Nicoll, M. T. Tuominen and D. R. Lovley, Nature, 2005, 435, 1098–1101.
35. L. Zhang, S. Zhou, L. Zhuang, W. Li, J. Zhang, N. Lu and L. Deng, Electrochem. Commun., 2008, 10, 1641–1643.
36. X. Xia, X. X. Cao, P. Liang, X. Huang, S. P. Yang and G. G. Zhao, Appl. Microbiol. Biotechnol., 2010, 87, 383–390.
37. B. Kim, H. Park, H. Kim, G. Kim, I. Chang, J. Lee and N. Phung, Appl. Microbiol. Biotechnol., 2004, 63, 672–681.
38. D. M. White, T. A. Pilon and C. Woolard, Water Res., 2000, 34, 2105–2109.
39. M. M. Figueira, V. S. Ciminelli, M. C. d. Andrade and V. R. Linardi, Can. J. Microbiol., 1996, 42, 519–523.
40. N. Gupta, C. Balomajumder and V. Agarwal, J. Hazard. Mater., 2010, 176, 1–13.
41. C. Zhang, G. Liu, R. Zhang and H. Luo, J. Environ. Sci. Health, Part A: Toxic/Hazard. Subst. Environ. Eng., 2010, 45, 250–256.

---