Emma A.
Fairhall†
a,
Karen
Wallace†
ab,
Steven A.
White
a,
Guo C.
Huang
c,
James A.
Shaw
a,
Sid C.
Wright
a,
Keith A.
Charlton
b,
Alastair D.
Burt
a and
Matthew C.
Wright
*a
aInstitute of Cellular Medicine, Newcastle University, Newcastle Upon Tyne, UK. E-mail: M.C.Wright@ncl.ac.uk
bSchool of Medical Sciences, University of Aberdeen, Aberdeen, UK
cDepartment Diabetes and Endocrinology, Rayne Institute, Kings College London, London, UK
First published on 25th October 2012
Reduction in the use of animals in toxicology is an important goal despite the continued need to assess drug and chemical safety in man. However, a limitation to in vitro screening for drug and chemical toxicity is the lack of available human hepatocytes and the difficulties associated with generating fully functional hepatocytes from stem cells. Previously, we have shown that a rat pancreatic acinar cell line is capable of trans-differentiating into fully functional hepatocyte-like cells in response to glucocorticoid via a serine/threonine protein kinase mechanism alone. Here we demonstrated that differentiation only occurs with glucocorticoids, not other steroids. We also investigated the potential of human pancreatic cells to undergo the same process. Analysis of adult human pancreata at the level of mRNA, protein and by immunohistochemical staining demonstrated that long term systemic exposure to glucocorticoid therapy resulted in differentiation of exocrine tissue to hepatocyte-like tissue. Glucocorticoid treatment of human pancreatic acinar cells in culture also resulted in trans-differentiation to hepatocyte-like cells. Both in vivo and in vitro, trans-differentiation of pancreas cells to hepatocytes was associated with an induction of SGK1 variant transcripts that have been previously shown to drive B-13 differentiation to hepatocytes. Adult exocrine human pancreas therefore responds in a similar qualitative fashion to that previously observed in rodents exposed to elevated glucocorticoid – that of a differentiation into hepatocyte-like cells. Understanding the enhanced response of B-13 cells to glucocorticoid and engineering this response in a replicating human acinar cell could generate an unlimited supply of functional human hepatocytes in vitro that could be useful in a variety of applications, including screening drugs and chemicals for hepatic metabolism and toxicity.
We have spent the last few years both defining the mechanisms that regulate the differentiation process and putting the B-13 response to glucocorticoid into a physiological context. We sought to investigate whether the trans-differentiation of acinar cells to hepatocytes is a physiologically feasible outcome in normal cells, both in vitro and in vivo. In a series of papers, we have shown that the B-13 to B-13/H trans-differentiation is regulated by Wnt signalling and serine/threonine protein kinase (SGK1) induction4,5 and is related to a pathophysiological response of the rodent pancreas to glucocorticoid.7,8 B-13 cells appear to be hyper-responsive to glucocorticoid with respect to hepatic differentiation, but the response occurs in normal rodent pancreas acinar cells as a result of physiologically abnormally high concentrations of glucocorticoid, both in vitro and in vivo.6 It has yet to be established precisely why pancreatic acinar cells should specifically trans-differentiate into hepatocytes in response to glucocorticoid (in contrast to other tissues which are relatively unaffected). However, it is likely associated with the acinar cell's propensity to revert to a proliferative embryonic ductal phenotype (as seen in vitro;9,10 the close developmental relationship between liver and pancreas11 and the promotion of tissue maturation by glucocorticoids.6
Since a long term aim of this program of research is to isolate (or engineer) a human equivalent of the B-13 cell, we examined whether the B-13 response to dexamethasone (DEX) – a synthetic glucocorticoid – is specific to glucocorticoids or whether the response occurs to other steroids. In addition, we sought evidence that an hepatocyte phenotype occurs in human pancreatic cells in vivo and in vitro.
We show that B-13 cells differentiate into B-13/H cells in response to several glucocorticoids but not to a range of other steroid classes. We also demonstrate that long term treatment with glucocorticoid in man results in liver levels of expression of hepatocyte markers in the human pancreas, and that culturing human acinar cells with glucocorticoid also results in expression of genes specific to hepatocytes. These changes were associated with an induction in SGK1 variant gene expression and suggest a human B-13 equivalent is a realistic prospect if the glucocorticoid hyper-responsive mechanism in B-13 cells can be replicated in human cells.
![]() | ||
| Fig. 1 The model B-13 rat pancreatic acinar cell line trans-differentiates into hepatocytes in response to glucocorticoid treatments but not in response to other steroids or nuclear receptor agonists. A, typical light micrographs of parent B-13 cell line (upper) and B-13/H cells (lower) observed after 14 days treatment with 10 nM DEX. B, RT-PCR analysis for the indicated transcript. PCR con, amplification reaction in the absence of input RNA during the reverse transcription step. C, Western blot for the indicated protein after treatment with the indicated concentration of glucocorticoids or other compounds for 14 days. Note, that trans-differentiation to B-13/H cells results in a block in mitosis (and these cells remain viable for at least 60 days in this state.2–4 In the absence of trans-differentiation, B-13 cells require sub-culture to prevent cell death and so cells treated with other compounds required sub-culturing. The normal endogenous concentrations in rats were used when greater than 10 nM, to compare with dexamethasone. For the non-glucocorticoids the rat serum levels are reported to be: progesterone, 250 nM in pregnancy;32 17β-estradiol, 40 pM;32 dihydrotestosterone and testosterone, <15–30 nM, based on the concentration of testosterone;33 aldosterone, 0.2 nM34 1,25 dihydroxyvitamin D, based on circulating 25 hydroxyvitamin D of 80 nM in humans35 and thyroxine, 10 nM.36 These approx. concentrations were used or increased to 10 nM to avoid false negative results. D, immunohistochemical staining for CYP2E1 and/or amylase. No 1° Ab, staining under identical conditions without the addition of primary antibodies. All data typical of at least 10 separate experiments. | ||
To establish whether trans-differentiation is a response that can occur on exposure to other steroids, the B-13 cell was screened for its response to a range of glucocorticoids and other steroids. Fig. 1C demonstrates that B-13 cells responded to the endogenous rat glucocorticoid corticosterone at both normal endogenous (300 nM)12 and elevated Cushing's disease levels (1.5 μM)8 as well as to a range other synthetic clinically-employed glucocorticoids: prednisolone, DEX and betamethasone (Fig. 1C). In contrast, no other steroids or nuclear receptor activators directed the B-13 cells to a B-13/H phenotype (data not shown) or induced the expression of hepatocyte genes (Fig. 1C). Fig. 1C also indicates that B-13/H cells express similar levels of CYP2E1 and CPSI as freshly isolated rat hepatocytes, confirming their quantitative comparability to normal liver hepatocytes in terms of expression levels.
Immunocytochemical staining confirmed that cells B-13/H cells retained expression of both amylase and CYP2E1 and that it was not a sub-set of cells within the culture expressing CYP2E1 only (Fig. 1D). These data indicate that the appearance of B-13/H cells in vitro is a specific response to glucocorticoids that does not occur in response to other steroids or ligands of other closely-related nuclear receptors, and that B-13/H appearance is dependent on trans-differentiation from acinar cells.
![]() | ||
| Fig. 2 Screening human pancreas samples for the expression of hepatic markers. A, RT-PCR for the indicated transcript. PCR control, amplification in the absence of RNA in the 1st strand cDNA synthesis step. B, Western blot for the indicated protein. C, Immunohistochemical staining for CYP3A4 in sections from control human liver and pancreas and in pancreas sections from NP10, no primary control – identical staining without primary antibody incubation. | ||
![]() | ||
| Fig. 3 Immunohistochemical staining of human pancreas and liver sections. (A) Sections were stained for the exocrine pancreas marker amylase or liver markers CYP2E1 and CPS-I. Control pancreas was obtained from a patient with no record of extended systemic glucocorticoid therapy and no overt pancreatic abnormalities in H and E-stained sections. Two human pancreas samples from patients (HP1 and HP2) maintained on systemic glucocorticoid were available as archived paraffin blocks only. HP1 was a 65 year old male that had been maintained on prednisolone for 8 months for the treatment of pemphigoid. The patient underwent a pancreaticoduodenectomy for a pancreatic adenocarcinoma. HP2 was a 35 year old female recipient who received a simultaneous pancreas kidney transplant for end stage diabetic nephropathy. Her immunosuppressive regimen included prednisolone. Approximately 1 year after implantation the pancreas had to be removed because of sepsis and pancreas graft rejection/thrombosis. Liver sections were prepared from normal tissue at the margins of an hepatectomy for a secondary tumour. Mild steatosis observed is common. (B) Further high powered fields from HP2 immunostained for CYP2E1, demonstrating positive staining in both acinar and ductal cells. In general, positive cells were observed in acinar regions in occasionally in duct cells. Similar results were observed in sections from HP1, data not included. | ||
Previous work has identified that SGK1 is markedly up-regulated in B-13 cells when treated with glucocorticoid, most notably an alternatively transcribed variant 3 (also termed variant C).4 Transfecting B-13 cells with expression vectors encoding the different human SGK1 variants demonstrated that SGK1 v3 (and an unassigned human-specific F variant) directed B-13 cells into hepatocytes without glucocorticoid treatment, demonstrating a pivotal role for specific SGK1 transcript induction in the trans-differentiation response.4Fig. 2D demonstrates that transcripts for SGK1 v3 and SGK1 variant F were detectable in NP08 and NP10 pancreata, with the highest expression in NP10 (the patient maintained long term on systemic glucocorticoid and showing extensive evidence of hepatocyte gene expression in their pancreas at resection).
To establish whether adult human pancreatic acinar cells are capable of trans-differentiation to hepatocyte-like cells in vitro, acinar cells were isolated and cultured with or without the addition of 10 μM dexamethasone (DEX), a synthetic glucocorticoid. Fig. 4A indicates that cells from patient NP8 expressed a range of hepatic markers at the mRNA level (CYP2E1, CPSI, albumin, CYP3A4) in response to DEX treatment, with no expression detected in cells cultured in basal media. Cells from patient NP10 – which already expressed hepatic markers – retained the expression of the hepatic markers when cultured with DEX, except for albumin mRNA. CYP1A1 mRNA, which was not induced in NP08 cells by DEX, was induced from undetectable levels by DEX in NP10 cells (Fig. 4A). Fig. 4B demonstrates that cultured human acinar cells retained the expression of amylase and that treatment with DEX resulted in the co-expression of CYP2E1 and amylase as previously observed with B-13 cells.1–4 Thus, DEX treatment likely results in the trans-differentiation of acinar cells to hepatocyte-like cells, rather than hepatic differentiation of a progenitor cell present within the culture. Furthermore, whereas acinar cells became more fibroblastic in morphology with time in culture, the addition of DEX promoted a more epithelial morphology. Fig. 4C shows the levels of expression of SGK1 variants after culture for 14 days with or without the addition of glucocorticoid. DEX treatment induced all SGK1 variants in cells isolated from patient NP08 (which trans-differentiated into hepatocytes in response to DEX), whereas cells from patient NP09 (which trans-differentiated into hepatocytes in response to DEX with low efficiency – data not shown) only showed induction of SGK1 v1 transcript and no expression at any time of SGK1 v3 and F (Fig. 4C). Acinar cells from patient NP10 (which already contained hepatocytes due to prolonged therapy with glucocorticoid) showed retained or further induction of SGK1 variant transcripts with DEX treatment (Fig. 4C).
![]() | ||
| Fig. 4 Human pancreatic acinar cells in culture express hepatocyte marker genes in response to treatment with glucocorticoid – trans-differentiation correlates with SGK1 v3 and F induction. Human pancreatic acinar cells were isolated as outlined in the methods section and where indicated, treated with 10 μM dexamethasone (DEX) or ethanol vehicle as control. After 14 days, cells were harvested and analyzed. (A) RT-PCR for the indicated transcript. PCR control, amplification in the absence of RNA in the 1st strand cDNA synthesis step. (B) Immunohistochemical staining for amylase and CYP2E1 in human acinar cells cultured in control medium or medium supplemented with 10 μM DEX for 14 days. Cells were fixed and co-stained amylase (brown) and CYP2E1 (blue) – data typical of staining from cells isolated from 5 individuals. C, RT-PCR for SGK1 variant transcript expression in human acinar cells treated for 14 days with (+) or without (−) 10 μM DEX for 14 days. | ||
An intriguing question is why hepatocyte-like cells appear in the pancreas in response to excessive glucocorticoid exposure? In addition to their role in playing a regulatory role in metabolism, glucocorticoids have an important role in cellular differentiation. Glucocorticoid levels are low in the developing fetus because placental 11β hydroxysteroid dehydrogenase 2 inactivates maternal glucocorticoid.18 In humans and many animal species, there is a rise in glucocorticoid concentrations during late pregnancy that parallels the increased maturity of fetal organs.19 The importance of glucocorticoids in development is clearly illustrated in the lung, where therapeutic use reduces the incidence of respiratory distress in premature birth.20,21 It is likely therefore, that normal glucocorticoid concentrations promote the maturation of tissues toward a neonatal phenotype. This is supported by empirical observations with stem cell differentiation to mature cell types and has resulted in glucocorticoid frequently being incorporated into media designed to promote differentiation to mature phenotypes.22–26 Since pancreatic tissue is a default state of differentiation for embryonic pancreatic cells capable of being directed toward an hepatic phenotype,27 it is likely that the mechanism(s) which promotes this process remains functional in adult cells and/or may modulate differentiation when normal adult cells are exposed to high levels of glucocorticoid.
Recent data from this laboratory has shown that B-13 cells have a number of chromosomal changes (but retain a 4n complement of chromosomes),28 a feature typical of many dividing cells that have been propagated for some time in vitro but not undergone transformation, such as embryonic stem cell lines.29 However, B-13 do not grow in soft agar or form tumours in NOD/SCID mice, indicating that they retain a requirement for anchorage-dependent growth and responsiveness to factors which prevent un-controlled cell growth.28 Interestingly, B-13 cells only engraft in to the liver and pancreas.28
The importance of understanding the genetic changes that have occurred in the B-13 cells as well as the mechanisms that control differentiation lies in the fact that a human equivalent would have extensive basic research and clinical value. Human hepatocytes are a scarce resource and a human B-13 equivalent would provide a plentiful supply of functional cells to be generated in vitro. Also, because the B-13 progenitor cell is proliferative, recombinant DNA technologies can be applied to manipulate the cells and to generate hepatocytes with genetic alterations. Hepatocytes are a valuable resource for screening drugs and chemical metabolism and toxicity.6 Stably transfecting variant drug metabolizing enzyme or drug transporter genes in human B-13 cell lines would significantly advance testing for drug and chemical metabolism and toxicity in man.
| Patient code | Age/Sex | Disease status |
|---|---|---|
| Tissue at the margins of the resection with a normal macroscopic appearance, and as far away from the tumor as possible, were sampled in these studies. For pathology archived block samples – HP1 and HP2 – which were only available as fixed tissue – see Fig. 3 legend. | ||
| NP06 | 78/♂ | Pancreaticoduodectomy for an ampullary adenocarcinoma. Pancreatic parenchyma demonstrated mild focal atrophy but no evidence of chronic pancreatitis. No history of systemic glucocorticoid therapy. |
| NP07 | 47/♀ | Pancreaticoduodectomy for distal cholangiocarcinoma. Pancreatic parenchyma lobular structure preserved with patchy atrophy, fibrosis and inflammation consistent with obstructive pancreatitis. Islets of Langerhans appear normal. No history of systemic glucocorticoid therapy. |
| NP08 | 52/♂ | Pancreaticoduodectomy for a pancreatic ductal adenocarcinoma. Background pancreatic parenchyma preserved with a normal lobular architecture. Islets of Langerhans appear normal. No history of systemic glucocorticoid therapy. |
| NP09 | 75/♂ | Pancreaticoduodectomy and liver resection for a gall bladder adenocarcinoma. Pancreatic parenchyma shows normal lobular architecture with no metaplastic or dysplastic changes in the pancreatic ducts. Islets of Langerhans show normal distribution and size. No history of systemic glucocorticoid therapy. |
| NP10 | 87/♀ | Distal pancreatectomy, splenectomy and nephrectomy for ductal adenocarcinoma of the tail of the pancreas. Background parenchyma shows pancreatic atrophy, patchy chronic inflammation. Patient had diabetes and polymyalgia rheumatica. Received prednisolone therapy for at least 20 years. |
| Oligo ID | 5′-3′ sequence | An'ling conditions (°C) | Comments |
|---|---|---|---|
| SGK1 Isoform 1 (NM_005627.3) is the wild type form SGK1A along with the 3 other forms identified by Simon et al.37 – isoform 2 (NM_001143676.1) is SGK1D; isoform 3 (NM_001143677.1) is SGK1C and isoform 4 (NM_001143678.1) is SGK1B. The SGK1F form sequence has been directly submitted to NCBI only – acc# CAI19718 and # FM205710. | |||
| RT-PCR | |||
| hCYP2E1US | TCCTTCACCCGGTTGGCCCA | 58 | Will amplify human CYP2E1 (NM_000773.3) cDNA sequence of 93 bp. |
| hCYP2E1DS | CACCGCCTTGTAGCCGTGCA | ||
| hCYP3A4US | ACGGGACTATTTCCACCACCCCC | 56 | Will amplify human CYP3A4 (NM_017460.3) cDNA sequence of 322 bp. |
| hCYP3A4DS | CTGACAAAGGCCCCACGCCAA | ||
| hCYP1A1US | TTCCCTGATCCTTGTGATCCCAGGC | Will amplify human CYP1A1 (NM_000499.3) cDNA sequence of 781 bp. | |
| hCYP1A1DS | AGAGCCAACCACCTCCCCGAA | 56 | |
| hC/EBPβUS | CCAGCCACCAGCCCCCTCACTAATA | 58 | Will amplify human CAAT/EBPβ (NM_005194.2) cDNA sequence of 264 bp. |
| hC/EBPβDS | CCAAGCAGTCCGCCTCGTAGT | ||
| hALBUMINUS | AGCTGCCTGCCTGTTGCCAAA | 56 | Will amplify human albumin (NM_000477.5) cDNA sequence of 135 bp. |
| hALBUMINDS | AGGCGAGCTACTGCCCATGC | ||
| hCPSIUS | TTTAGCCGAGGCCCATGCCACA | 58 | Will amplify human CPSI variant 1 (NM_001122633.1) cDNA sequence of 238 bp. US primer does not hybridise to variant 2 (NM_001875.3) |
| hCPSIDS | CCAGCAACAGAGGATGGATGGCC | ||
| hAMYLASEUS | ACATGGGGCTGGAGGAGCCT | 55 | Will amplify human amylase – alpha 2A (NM_000699.2) and human amylase alpha 2B (NM_020978.3) cDNAs sequences of 170 and 172 bp respectively. |
| hAMYLASEDS | TGGTGGCCCAACCCAATCAT | ||
| rmhGAPDHUS | TGACATCAAGAAGGTGGTGAAG | 50 | Will amplify rat (NM_017008), human (NM_002046) or mouse (NM_008084) glyceraldehyde 3 phosphate dehydrogenase cDNA sequence of 243 bp. |
| rmhGAPDHUS | TGACATCAAGAAGGTGGTGAAG | ||
| hSGK1v1US | CGAGCCGGTCTTTGAGCGCTAAC | 55 | Will amplify human SGK1 variant 1 (NM_005627.3) cDNA sequence of 118 bp. Also referred to as SGK1A and wild type sequence. |
| hSGK1v1DS | GAATTGCCACCATGCCCCTCATCC | ||
| hSGK1v2US | CCCTCTGCCTTTCTGGCGCTGTTC | 55 | Will amplify human SGK1 variant 2 (NM_001143676.1) cDNA sequence of 140 bp. Also referred to as SGK1D. |
| hSGK1v2DS | CTGGAGGCGGCTTGAGAGAGGAG | ||
| hSGK1v3US | GAACAGGGATAGCCGTCTCTGGC | 55 | Will amplify human SGK1 variant31 (NM_001143677.1) cDNA sequence of 121 bp. Also referred to as SGK1C. |
| hSGK1v3DS | TTCTGGAGGCTGGAGGTAGAGCC | ||
| hSGK1v4US | AAAAGGCGTTTTCGGAAGCGACCC | 55 | Will amplify human SGK1 variant 4 (NM_001143678.1) cDNA sequence of 140 bp. Also referred to as SGK1B. |
| hSGK1v4DS | CAGACGAGAGCGACCGGCGAG | ||
| hSGK1FUS | TCTCCTCCTTCATCCACAGCTTTCA | 55 | Will amplify a novel human SGK1 variant (CAI19718) cDNA sequence of 211 bp. Also referred to as SGK1F. |
| hSGK1FDS | TGGACGACGGGCCAAGGTTG | ||
:
200 dilution); anti-amylase (Santa-Cruz – SC12821 1
:
300 dilution), and left to incubate overnight at 4 °C. Samples were washed twice in 1 × PBS before applying secondary antibodies for 1 hour at RT – alkaline phosphatase conjugated donkey polyclonal anti-rabbit IgG (Abcam – ab97061) and peroxidise conjugated rabbit anti-goat IgG (Sigma – A5420) both at a 1
:
200 dilution. Samples were washed twice in 1 × PBS before colour development was carried out using BCIP®/NBT substrate system followed by Liquid DAB + substrate chromogen system for CYP2E1 (alkaline peroxidase activity) and Amylase (HRP activity) expression respectively. In all cases control sections were stained without primary antibody incubation for each individual antibody used. After colour development slides were rinsed briefly in H2O and counterstained using nuclear fast red (Vector laboratories) when required. Samples were sequentially dehydrated through 50%, 75%, 95%, 100% ethanol and finally into xylene before mounting in depex™.
Rat and human hepatocytes were prepared by collagenase perfusion essentially as previously described.30 B-13 cells were routinely cultured in Dulbecco's minimum essential medium supplemented with 10% (v/v) FCS, 80 μg ml−1 penicillin and 80 μg ml−1 streptomycin. All cells were incubated at 37 °C in an humidified incubator gassed with 5% CO2 in air. Steroids and other compounds were all purchased from the Sigma Chem Co. (Poole, UK) and were added to medium from 1000-fold concentrated ethanol vehicle solvated stocks, control cells were treated with 0.1% (v/v) ethanol alone as control.
Footnote |
| † Joint first authors. |
| This journal is © The Royal Society of Chemistry 2013 |