Transcription profiles of LPS-stimulated THP-1 monocytes and macrophages: a tool to study inflammation modulating effects of food-derived compounds

Wasaporn Chanput abd, Jurriaan Mes c, Robert A. M. Vreeburg c, Huub F. J. Savelkoul a and Harry J. Wichers *abc
aCell Biology and Immunology Group, Wageningen University and Research Centre, Marijkeweg 40, P.O. Box 338, 6700 AH, Wageningen, The Netherlands. E-mail: harry.wichers@wur.nl
bLaboratory of Food Chemistry, Wageningen University and Research Centre, Bomenweg 2, P.O. Box 8129, 6700 EV, Wageningen, The Netherlands
cFood & Biobased Research, Wageningen University and Research Centre, Bornse Weilanden 9, P.O. Box 17, 6700 AA, Wageningen, The Netherlands
dDepartment of Food Science and Technology, Faculty of Agro-Industry, Kasetsart University, 50 Phahonyothin Road, Chatuchak, Bangkok, 10900, Thailand

Received 9th August 2010 , Accepted 11th October 2010

First published on 1st November 2010


Abstract

An assay was developed to study inflammation-related immune responses of food compounds on monocytes and macrophages derived from THP-1 cell line. First strategy focused on the effects after stimulation with either lipopolysaccharide (LPS) or Concanavalin A (ConA). Gene expression kinetics of inflammation-related cytokines (IL-1β, IL-6, IL-8, IL-10 and TNF-α), inflammation-related enzymes (iNOS and COX-2), and transcription factors (NF-κB, AP-1 and SP-1) were analyzed using RT-PCR. Time dependent cytokine secretion was investigated to study the inflammation-related responses at protein level. LPS stimulation induced inflammation-related cytokine, COX-2 and NF-κB genes of THP-1 monocytes and THP-1 macrophages with the maximum up-regulation at 3 and 6 h, respectively. These time points, were subsequently selected to investigate inflammation modulating activity of three well known immuno-modulating food-derived compounds; quercetin, citrus pectin and barley glucan. Co-stimulation of LPS with either quercetin, citrus pectin, or barley glucan in THP-1 monocytes and macrophages showed different immuno-modulatory activity of these compounds. Therefore, we propose that simultaneously exposing THP-1 cells to LPS and food compounds, combined with gene expression response analysis are a promising in vitro screening tool to select, in a limited time frame, food compounds for inflammation modulating effects.


Introduction

Monocytes and macrophages are an important part of the innate arm of the immune system. These cells are involved in inflammatory processes, with a profound capacity to synthesize and secrete pro- and anti-inflammatory cytokines.1,2 THP-1 cells, a human leukemia monocytic cell line, have widely been used as a model to study the immune response capacity of monocytes and monocyte-derived macrophages, because of similarities in their responses when compared to the monocyte fraction present in peripheral blood mononuclear cells (PBMCs).3,4

The innate immune system relies on pathogen recognition receptors (PRRs) such as toll-like receptors (TLRs), to recognize conserved molecular structures of invading pathogens called pathogen associated molecular patterns (PAMPs). PAMPs, like lipopolysacharide (LPS), play a pivotal role in the initiation of a variety of host responses caused by infection with Gram-negative bacteria. Such action leads to systemic inflammatory response, for instance up-regulation of pro-and anti-inflammatory cytokine genes, resulting in secretion of cytokine proteins into the blood stream.5,6 Some transcription factors have been shown to be directly or indirectly related to the receptor-mediated expression of inflammation related-cytokine and inflammation-related enzyme genes. The transcription factor Nuclear Factor (NF)-κB is involved in the transcriptional regulation of the IL-1β, IL-6, IL-8, TNF-α, iNOS and COX-2 genes.7,8 The transcription factor AP-1 is associated with the regulation of IL-8 and TNF-α genes.7,9 Activation of the AP-1 transcription factor occurs by an increased the production of c-Jun and c-Fos proteins which need to form a dimeric complex binding the promoter region of AP-1.10 Expression of the IL-10 gene is regulated by SP-1 transcription factor.11,12

Immune responses are commonly determined by measuring the presence of cytokines in culture medium after challenging cells. However, these assays are often performed with relatively long exposure time (generally hours) in order to obtain cytokine levels above the threshold which can lead to the initiation of further signalling pathways. Furthermore, cytokine protein secretion is only partly related to the expression of cytokine-related genes and their upstream transcription factors, because of extensive regulation of the transcription and translation processes.13,14 We, therefore, investigated the gene expression kinetics of inflammation-related cytokines, inflammation-related enzymes and relevant transcription factors, together with time-dependent cytokine protein secretion. Genetically identical THP-1 monocytes and macrophages, which were stimulated with LPS and ConA, were used as a model. Furthermore, the application of this assay for screening immuno-modulatory effects of food-derived components was tested and discussed.

Results

Gene expression kinetics of THP-1 monocytes and macrophages stimulated with LPS and ConA

Expression of genes for inflammation-related cytokines. Pro- and anti-inflammatory cytokine gene expression was analyzed in undifferentiated and differentiated THP-1 cells, designated as THP-1 monocytes and THP-1 macrophages, respectively. In this analysis, mRNA expression level of the pro-inflammatory cytokine genes IL-1β, IL-6, IL-8 and TNF-α, and of the anti-inflammatory cytokine gene IL-10 were determined by qPCR. In both non-stimulated THP-1 monocytes and macrophages at time zero, IL-8 was the most abundant gene relative to GAPDH, followed by IL-1β and TNF-α genes, respectively (Fig. 1). IL-6 and IL-10 exhibited low abundance in both cell types. All cytokine genes were higher expressed in non-stimulated THP-1 macrophages than in monocytes (Fig. 1).
Inflammation-related cytokine gene expression relative to GAPDH (ΔCt) of THP-1 monocytes and macrophages before stimulation. Data shown are the means + standard deviation (SD bars) from two independent biological replications.
Fig. 1 Inflammation-related cytokine gene expression relative to GAPDH (ΔCt) of THP-1 monocytes and macrophages before stimulation. Data shown are the means + standard deviation (SD bars) from two independent biological replications.

THP-1 cells, like primary monocytes and macrophages, expressed a variety of inflammation-related cytokine genes in response to LPS (Fig. 2A, C). The IL-6 gene showed, among the analyzed cytokine genes, the highest fold change of expression in both THP-1 monocytes and macrophages. Exposure of THP-1 monocytes to LPS strongly induced IL-1β, IL-6, IL-8, IL-10 and TNF-α gene expression, with maximal expression after 3 h of stimulation, except for IL-6 expression which gradually increased throughout the incubation time (Fig. 2A). All inflammation-related cytokine genes of THP-1 macrophages were also highly up-regulated by LPS-stimulation but less than those of monocytes, except IL-6, with a maximal expression after 6 h of stimulation (Fig. 2C). The onset of up-regulation of all analyzed inflammation-related cytokine genes appeared to be earlier in THP-1 monocytes (within 1 h) compared to that of macrophages (within 2 h) (Fig. 2A, C).


Inflammation-related cytokine gene expression kinetics and cytokine secretion kinetics of THP-1 monocytes (A-B) and THP-1 macrophages (C-D) stimulated with 1 μg ml−1 LPS. Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown from RT-PCR are the means + standard deviation (SD bars) from two independent biological replications.
Fig. 2 Inflammation-related cytokine gene expression kinetics and cytokine secretion kinetics of THP-1 monocytes (A-B) and THP-1 macrophages (C-D) stimulated with 1 μg ml−1 LPS. Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown from RT-PCR are the means + standard deviation (SD bars) from two independent biological replications.

In all experiments, controls were performed using non-stimulated cells (medium). ConA was chosen as a negative or weak stimulus of the innate immunity. Non-stimulated THP-1 monocytes and macrophages and those-stimulated with ConA showed no or very low effects on gene expression of the inflammation-related cytokine genes (Fig. 3A, C).


Inflammation-related cytokine gene expression kinetics and cytokine secretion kinetics of THP-1 monocytes (A-B) and THP-1 macrophages (C-D) stimulated with 5 μg ml−1 ConA and non-stimulated (medium). Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown are the means from two technical measurements.
Fig. 3 Inflammation-related cytokine gene expression kinetics and cytokine secretion kinetics of THP-1 monocytes (A-B) and THP-1 macrophages (C-D) stimulated with 5 μg ml−1 ConA and non-stimulated (medium). Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown are the means from two technical measurements.
Expression of genes for inflammation-related enzymes. Apart from inflammation-related cytokine genes, two candidate inflammation-related enzyme genes, COX-2 and iNOS, were also investigated in THP-1 monocytes and macrophages stimulated with LPS and ConA. Incubation of THP-1 monocytes with LPS led to an induction of COX-2 gene expression within 0.5 h and reached the highest expression after 3 h of stimulation (Fig. 4A). For THP-1 macrophages, the first up-regulation of the COX-2 gene was observed after 2 h and the highest expression was after 6 h of stimulation (Fig. 4B). The overall COX-2 gene expression in LPS-stimulated THP-1 macrophages was approximately 10 times higher than that of monocytes. ConA only weakly induced COX-2 gene expression in THP-1 monocytes (data not shown). In contrast to the inflammation-related cytokine genes, the expression level of the COX-2 gene relative to GAPDH (ΔCt) in LPS-stimulated THP-1 monocytes and macrophages was similar (data not shown). The expression of the iNOS gene could not be detected in both LPS-and ConA-stimulated THP-1 monocytes and macrophages throughout the incubation time, although two different iNOS primer sets in Table 1 have been used (data not shown).
Inflammation-related enzyme and transcription factor gene expression kinetics of THP-1 monocytes (A) and THP-1 macrophages (B) stimulated with 1 μg ml−1 LPS. Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown are the means + standard deviation (SD bars) from two independent biological replications.
Fig. 4 Inflammation-related enzyme and transcription factor gene expression kinetics of THP-1 monocytes (A) and THP-1 macrophages (B) stimulated with 1 μg ml−1 LPS. Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown are the means + standard deviation (SD bars) from two independent biological replications.
Table 1 Sequence of Real Time-PCR primers
Gene Accession number Primer working concentration/μM Sequence (5′→3′)
IL-1β ncbi-n:NM_000576.2 0.1 F- GTGGCAATGAGGATGACTTGTTC
R- TAGTGGTGGTCGGAGATTCGTA
IL-6 ncbi-n:NM_000600.3 0.1 F- AGCCACTCACCTCTTCAGAAC
R- GCCTCTTTGCTGCTTTCACAC
IL-8 ncbi-n:NM_000584.2 0.1 F- CTGATTTCTGCAGCTCTGTG
R- GGGTGGAAAGGTTTGGAGTATG
IL-10 ncbi-n:NM_000572.2 0.4 F- GTGATGCCCCAAGCTGAGA
R- CACGGCCTTGCTCTTGTTTT
TNF-α ncbi-n:NM_000594.2 0.1 F- CTGCTGCACTTTGGAGTGAT
R- AGATGATCTGACTGCCTGGG
iNOS (1) ncbi-n:NM_000625.3 0.1 F- CATCCTCTTTGCGACAGAGAC
R- GCAGCTCAGCCTGTACTTATC
iNOS (2) ncbi-n:NM_000625.4 0.1 F- GGCTGGAAGCCCAAGTACG
R- CTCAGGGTCACGGCCATTG
COX-2 ncbi-n:NM_000963.2 0.1 F- CAGCACTTCACGCATCAGTT
R- CGCAGTTTACGCTGTCTAGC
NF-κB ncbi-n:NM_003998.2 0.4 F- TGAGTCCTGCTCCTTCCA
R- GCTTCGGTGTAGCCCATT
SP-1 ncbi-n:NM_138473.2 0.4 F- GGTGCCTTTTCACAGGCTC
R- CATTGGGTGACTCAATTCTGCT
c-Jun ncbi-n:NM_002228.3 0.4 F- TGGAAACGACCTTCTATGACGA
R- GTTGCTGGACTGGATTATCAGG
c-Fos ncbi-n:NM_005252.3 0.4 F- GGATAGCCTCTCTTACTACCAC
R- TCCTGTCATGGTCTTCACAACG
GAPDH ncbi-n:NM_002046.3 0.1 F- TGCACCACCAACTGCTTAGC
R- GGCATGGACTGTGGTCATGAG


Expression of genes for inflammation-related transcription factors. LPS caused considerable up-regulation of NF-κB gene expression in both THP-1 monocytes and macrophages up to 30 h with the highest expression after 3 h and 6 h of stimulation, respectively (Fig. 4). c-Jun and c-Fos gene expression in LPS-stimulated THP-1 macrophages was up-regulated for a rather short period 0.5–3 h after stimulation. A bi-phasic pattern was found in c-Fos gene expression of THP-1 macrophages treated with LPS (Fig. 4B). SP-1 gene expression was not affected by LPS stimulation in both THP-1 monocytes and macrophages (Fig. 4). No up-regulation from any of the studied transcription factor genes was observed in ConA-stimulated and non-stimulated THP-1 monocytes and macrophages (data not shown).

Time-dependent cytokine secretion of THP-1 monocytes and macrophages stimulated with LPS and ConA

Stimulating THP-1 monocytes and macrophages with LPS resulted in a dramatic increase in the secretion of IL-1β, IL-6, IL-8, IL-10 and TNF-α (Fig. 2B, 2D). At time zero of THP-1 monocytes and macrophages, all cytokines were present at a basal level of 20 to 30 pg ml−1. Inflammatory cytokine production by THP-1 macrophages was higher than in monocytes, likely as a consequence of higher abundance of inflammation-related cytokine genes relative to GAPDH in non-stimulated THP-1 macrophages than in monocytes, as described above (Fig. 1).

IL-8 was the most predominant cytokine in the supernatant of both THP-1 monocytes and macrophages (Fig. 2B, D). IL-8 concentration in the supernatant increased over time and only in THP-1 macrophages reached a plateau within the tested time frame after 18 h of stimulation. The relative order in abundance of cytokines secreted from THP-1 monocytes and macrophages was similar to the order of their responsive genes relative to GAPDH (Fig. 1), except for IL-1β from THP-1 monocytes, of which the expression was relatively close to that of the IL-8 gene, but not at protein level. All analyzed cytokines, except for TNF-α from monocytes and IL-10 from macrophages, continued to accumulate over the incubation time (Fig. 2B, D). Cytokines secreted from ConA-stimulated THP-1 monocytes and macrophages were detected in relatively low amounts (Fig. 3B, D), except IL-8 from ConA-stimulated and non-stimulated THP-1 macrophages (Fig. 3D).

These results suggest that the RNA expression and protein secretion are correlated to a large extent. The lag-phase in up-regulation of the mRNA level was approximately 1 h before cytokine proteins were secreted at a detectable concentration. Cytokine production demonstrated more variable kinetics than the expression of corresponding genes, which results in less uniform time points in quantification of effects.

Modulating effects of quercetin, citrus pectin and barley glucan on the expression of inflammation-related genes in LPS-stimulated THP-1 monocytes and macrophages

The effect of co-stimulation of LPS and purified food compounds was determined after stimulation at 3 h and 6 h of THP-1 monocytes and macrophages respectively, since the maximal gene expression response was observed at these time points (Fig. 2A, C). Quercetin, citrus pectin and barley glucan, were chosen as food-derived compounds. Exposure of the cells to quercetin, citrus pectin and barley glucan or the solvent control (DMSO) and PBS did not show any altered expression of the measured genes (data not shown), indicating that these compounds do not posses direct inflammation-enhancing properties.

Data represented in Fig. 5 show the effect of quercetin, citrus pectin and barley glucan on modulation of LPS-induced responses. Quercetin, citrus pectin and barley glucan lowered the LPS-induced expression of most inflammation-related genes expressed by THP-1 monocytes, except TNF-α and COX-2 (Fig. 5A). Different effects were observed from THP-1 macrophages as compared to monocytes for specific food components. After 6 h of stimulation, quercetin reduced expression of all inflammation-related genes of LPS-stimulated THP-1 macrophages, except COX-2 (Fig. 5B). Less inflammatory reducing effects were found for citrus pectin compared to quercetin in THP-1 macrophages. Barley glucan appeared to enhance expression of inflammation-related genes of LPS-stimulated THP-1 macrophages (Fig. 5B) whereas in monocytes it had a reducing effect. Our results indicate that gene expression after simultaneous exposure of LPS with food components to THP-1 monocytes for 3 h and THP-1 macrophages for 6 h is an adequate model to examine inflammation-modulating activity of food compounds.


Inflammation-related cytokine gene expression of 700 ng ml−1 LPS-stimulated THP-1 monocytes (A) and macrophages (B) with 50 μM quercetin (LPS + Q), 0.75 mg ml−1 citrus pectin (LPS + CP) and 100 g ml−1 barley glucan (LPS + BG). THP-1 monocytes were collected at 3 h and macrophages at 6 h after stimulation. Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown are the means + standard deviation (SD bars) from independent biological replications.
Fig. 5 Inflammation-related cytokine gene expression of 700 ng ml−1 LPS-stimulated THP-1 monocytes (A) and macrophages (B) with 50 μM quercetin (LPS + Q), 0.75 mg ml−1 citrus pectin (LPS + CP) and 100 g ml−1 barley glucan (LPS + BG). THP-1 monocytes were collected at 3 h and macrophages at 6 h after stimulation. Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown are the means + standard deviation (SD bars) from independent biological replications.

Discussion

In this study, a new test method to investigate immuno-modulating effects of food-derived compounds was developed based on the THP-1 cell line. Two stimuli were chosen with different actions on the cellular responses. LPS is widely used as a potent and prototypical inducer of cytokine production in innate immunity which begins with the orchestration of monocytes.7,15 ConA, a lectin from jack-bean (Canavalia ensiformis), was reported to function as a T-lymphocyte mitogen in adaptive immunity,16 and to control some non-immune responses of THP-1 monocytes such as growth, proliferation, metabolism and survival processes.17

Differences in RNA stability, protein translation kinetics, post-translational modification factors and proteolytic processing events, make the production of individual cytokines unique.18 However, a general relation between mRNA and protein level in both LPS-stimulated THP-1 monocytes and macrophages was found in our studies. The higher mRNA expression level relative to GAPDH of inflammation-related cytokine genes and higher cytokine secretion level of LPS-stimulated THP-1 macrophages, as compared to monocytes, could be caused by higher expression of TLR4-mRNA (a PRR for LPS).19

LPS strongly up-regulated inflammation-related cytokine, COX-2 and NF-κB genes in THP-1 monocytes and macrophages, while no expression of the iNOS gene after LPS-stimulation was found. This last finding was in concordance with studies making use of PBMCs, indicating that human peripheral monocytes and their derived macrophages are not able to express the iNOS gene after LPS induction.20–23 However, some PBMC-based studies indicated the ability of LPS to up-regulate the iNOS gene.24,25 No unequivocal explanation for this controversy has been presented yet. Based on literature, it seems that species differences, genetic background, and perhaps details of experimental procedure play a role.7,20–25 The relatively low and short expression of c-Jun and c-Fos in LPS-stimulated THP-1 monocytes and macrophages can be explained by the fact that these genes are typical early response genes with a very short mRNA half life of only 35–45 min.26,27 A bi-phasic pattern of c-Fos gene expression in LPS-stimulated THP-1 macrophages was also reported.26,27 The binding activity of nuclear proteins to SP-1 target genes was constitutive and unchanged by LPS stimulation in THP-1 monocytes and murine macrophages11,28 but it can be up-regulated during the PMA or vitamin D3 induced differentiation process of THP-1 monocytes to regulate the expression of CD14.29,30 Therefore, it could be argued that SP-1 might not be an appropriate gene to serve as an indicator in LPS exposure of THP-1 monocytes and macrophages.

Accumulation of TNF-α in supernatants of both THP-1 monocytes and macrophages declined after 6 and 24 h of stimulation, respectively. The decline of TNF-α-accumulation in our studies was consistent with the findings in several studies which demonstrated that IL-10 can suppress TNF-α production in human monocytes and macrophages, or even cause diminished levels of TNF-α, IL-1β and IL-8 mRNA upon prolonged stimulation.31–33 However, to drive such mechanisms, IL-10 needs to bind to IL-10R-1 and IL-10R-2 which should cause a decrease in the measurable (unbound) amount of IL-10 in culture supernatants.34,35 Similar to our results, IL-10 cytokine accumulation by LPS-stimulated THP-1 monocytes slightly dropped at 6 h and increased again at 18 h after stimulation, while it dramatically decreased in THP-1 macrophages at 18–30 h after stimulation.

The beneficial health effects of quercetin and citrus pectin have been attributed to their anti-inflammatory activity,36–39 while β-glucans show their immunological effect by enhancing innate immunity through induction of cytokine production and phagocytosis.40 Incubating LPS-stimulated THP-1 monocytes for 3 h and macrophages for 6 h with the food compounds revealed different inflammation-modulating effects at mRNA level with similarity as described in the mentioned literature.

Studying effects of PAMPs and other (food based) immuno-modulating compounds using monocytes and macrophages isolated from PBMCs might be a more realistic model for human immune functioning. However, large variation between blood samples, time and cost efficiency make it difficult to apply this in a high throughput fashion. It has been indicated that the THP-1 cell line has shown to be an accurate model for native and monocytes-derived macrophages for studying LPS responses.3,4,41,42 Our findings suggested that LPS-stimulated THP-1 monocytes and macrophages are a sensitive in vitro system to analyze potential immunomodulatory activity of food components by using a detailed insight into the kinetics of mRNA expression. Therefore, THP-1 monocytes and macrophages could thus be a suitable and reliable model for screening a variety of components prior to a more detailed analysis with human derived cells.

Materials and methods

Chemicals and cell culture

The human monocytic leukemia cell line THP-1 (American Type Culture Collection, Rockville, Md.) was grown in RPMI 1640 culture medium (Lonza, Switzerland) supplemented with fetal bovine serum (FBS; Invitrogen, UK.) and penicillin/streptomycin (P/S) (Invitrogen) to 10% and 1% respectively, at 37 °C in 5% CO2 in a humidified incubator. Cells were sub-cultured twice per week. THP-1 cells change their culture properties after prolonged periods in culture, cells were therefore discarded and replaced by frozen stocks after 25 passages. LPS (E.coli 0111:B4), Concanavalin A (ConA), quercetin, citrus pectin and barley glucan were purchased from Sigma (St. Louis, MO, USA), the latter three of the highest possible purity grade to respectively 99%, ≥74% galacturonic acid and >95%.

Macrophage differentiation and stimulation

The mature macrophage-like state was induced by treating THP-1 monocytes (106 cells ml−1) for 48 h with 100 ng ml−1 phorbol 12-myristate 13-acetate (PMA; Sigma Chemical) in 12-wells cell culture plates (Greiner, Germany) with 1 ml cell suspension in each well. It has been demonstrated that this differentiation method of THP-1 cells resulted in the expression of macrophage specific surface markers CD11b and CD36 and also phagocytic activity.43 Differentiated, plastic-adherent cells were washed once with sterile phosphate-buffered saline (PBS; Sigma Chemical, USA) and RPMI 1640 medium without PMA but containing 10% FBS and 1% P/S. THP-1 monocytes (undifferentiated cells) and THP-1 macrophages (differentiated cells) were treated with ether 1 μg ml−1 LPS or 5 μg ml−1 ConA, which concentrations were chosen according to our preliminary optimization studies. RPMI 1640 medium containing 10% FBS and 1% P/S was used as a control. Both types of cells were harvested at different time points ranging from 0–30 h to investigate gene expression kinetics, while cell-free culture supernatants were collected and stored at −80 °C to measure time-dependent cytokine secretion. The experiments were performed by two independent biological replications, started from a new batch of cells.

Gene expression kinetics by Real-Time PCR

Total RNA was isolated by using RNeasy mini kit (Qiagen, USA) with a RNase-free DNase (Qiagen) treatment for 15 min according to the manufacturer's instructions. Complementary DNA (cDNA) was synthesized from isolated RNA with iScript cDNA synthesis kit (Bio-Rad, USA). Of the synthesized cDNA 200 ng was mixed with 10 μl of IQ™ SYBR Green Supermix (Bio-rad) and primer pairs in a 20 μl reaction volume and preheated at 95 °C for 90 s, followed by PCR for 40 cycles, denaturing temperature of 95 °C for 10 s, annealing temperature of 58 °C for 10 s, and elongation temperature of 72 °C for 15 s, and finally elongation temperature of 72 °C for 2 min. Primer sets (see Table 1) were tested by dilution series of cDNA from LPS-stimulated THP-1 monocytes to analyze PCR efficiency. Amplified PCR products were also analyzed by ethidium bromide stained agarose gel to check for amplification of a single product. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was chosen for normalisation because this gene was stably expressed in both THP-1 monocytes and macrophages, both in challenged and unchallenged cells (data not shown). The PCR products of all samples were subjected to a melting curve analysis to verify the single amplification product. The relative messenger RNA (mRNA) expression were exhibited in two ways; firstly, the expression relative to GAPDH, calculated as ΔCt [ΔCt = 2^(CtGAPDH-Ctsample)].44 Secondly, the values expressed as fold change relative to the value at time point zero, calculated as ΔΔCt [ΔΔCt = 2^(ΔCt GAPDH- ΔCt sample)].44 All experiments were performed with the same amount of cells (106 cells per ml) and the same quantity of RNA input. qPCR was performed twice on each sample.

Time-dependent cytokine secretion by cytometric bead array

Cytokine secretion (IL-1β, IL-6, IL-8, IL-10 and TNF-α) in cell-free culture supernatants of THP-1 monocytes and macrophages was measured by cytometric bead array (CBA) analysis (BD Biosciences, USA) according to the manufacturer's guidelines. Briefly, a mixture of 5 capture bead populations (50 μl) with distinct fluorescence intensities coated with capture antibody proteins for the above mentioned cytokines was first mixed with each sample or standard (50 μl) and incubated in the dark for 1 h on an orbital shaker. Additionally, PE-conjugated detection antibodies (50 μl) were added to form sandwich complexes and then incubated in dark for 2 h on an orbital shaker. Subsequently, the samples were resuspended in 200 μl of wash buffer before acquisition on a FACScan cytometer (BD Bioscience). The sample results were analyzed using FCAP™ Array analysis software.

The measurement was performed twice from one of two biological replicates.

Food-derived compounds on LPS-stimulated cells

THP-1 cells were stimulated with either 50 μM quercetin, 0.75 mg ml−1 citrus pectin, or 100 μg ml−1 barley glucan, with and without the presence 700 ng ml−1 LPS. The LPS concentration was reduced from 1 μg ml−1 to 700 ng ml−1 to achieve a lower up-regulation of inflammation-related genes. Expression kinetics of inflammation-related genes with 700 ng ml−1 LPS were similar to 1 μg ml−1 LPS, but with a reduced amplitude (data not shown). The concentrations of food compounds were chosen according to preliminary optimization studies and literature search.39,45,46 After stimulation, THP-1 monocytes and macrophages were harvested at 3 h and 6 h, respectively. Expression of inflammation-related genes was determined. The experiments were performed by two independent biological replications, started from a new batch of cells.

Conclusion

A rather short incubation time is required for gene expression analysis, this approach facilitates the use of less sterile samples and allows a more reliable read-out for the early triggering events in which responses by various effector molecules such as cytokines and post-translational events have not yet occurred. This makes it possible to differentiate between primary food-cell signals and secondary cell-cell signals. RT-PCR is a method to analyze gene expression, which is very straight forward, can be performed in almost every molecular lab, is cost-effective compared to microarray analysis, and can be very accurate and informative when using a key selection of functional indicator genes. Analysing cytokine secretion profiling has some major drawbacks compared to gene expression analysis as longer incubation is needed to be detectable resulting in more uncertainties due to occurrence of forward and backward responses from various secreted cytokines. Also, every run needs many extra samples for calibration curves. These remarks together with the findings described in this paper show that gene expression measurement can give reproducible results and even on a wider spectrum of responses than cytokine measurements.

Acknowledgements

This work was supported by the Thai Commission on Higher Education, Ministry of Education, Thailand.

References

  1. F. Cipollone, A. Iezzi, M. Fazia, M. Zucchelli, B. Pini, C. Cuccurullo, D. De Cesare, G. De Blasis, R. Muraro, R. Bei, F. Chiarelli, A. M. Schmidt, F. Cuccurullo and A. Mezzetti, Circulation, 2003, 108, 1070–1077 CrossRef CAS .
  2. R. Ross, N. Engl. J. Med., 1999, 340, 115–126 CrossRef CAS .
  3. J. Auwerx, Experientia, 1991, 47, 22–31 CrossRef CAS .
  4. O. Sharif, V. Bolshakov, S. Raines, P. Newham and N. Perkins, BMC Immunol., 2007, 8, 1 CrossRef .
  5. R. Karima, S. Matsumoto, H. Higashi and K. Matsushima, Mol. Med. Today, 1999, 5, 123–132 CrossRef CAS .
  6. P. Tripathi and A. Aggarwal, Current Science, 2006, 90, 519–531 CAS .
  7. M. Guha and N. Mackman, Cell. Signalling, 2001, 13, 85–94 CrossRef CAS .
  8. T. Kikuchi, K. Hagiwara, Y. Honda, K. Gomi, T. Kobayashi, H. Takahashi, Y. Tokue, A. Watanabe and T. Nukiwa, J. Antimicrob. Chemother., 2002, 49, 745–755 CrossRef CAS .
  9. J. P. Mishra, S. Mishra, K. Gee and A. Kumar, J. Biol. Chem., 2005, 280, 26825–26837 CrossRef CAS .
  10. W. H. A. Dokter, M. T. Esselink, M. R. Halie and E. Vellenga, Blood, 1993, 81, 337–343 CAS .
  11. H. D. Brightbill, S. E. Plevy, R. L. Modlin and S. T. Smale, J. Immunol., 2000, 164, 1940–1951 CAS .
  12. W. Ma, W. Lim, K. Gee, S. Aucoin, D. Nandan, M. Kozlowski, F. Diaz-Mitoma and A. Kumar, J. Biol. Chem., 2001, 276, 13664–13674 CAS .
  13. L. Anderson and J. Seilhamer, Electrophoresis, 1997, 18, 533–537 CrossRef CAS .
  14. S. P. Gygi, Y. Rochon, B. R. Franza and R. Aebersold, Mol. Cell. Biol., 1999, 19, 1720–1730 CAS .
  15. L. M. Harrison, W. C. E. van Haaften and V. L. Tesh, Infect. Immun., 2004, 72, 2618–2627 CrossRef CAS .
  16. K. Ogawa, O. Kaminuma, H. Okudaira, H. Kikkawa, K. Ikezawa, N. Sakurai and A. Mori, Clin. Exp. Immunol., 2002, 130, 475–483 CrossRef CAS .
  17. T. Matsuo, K. Hazeki, O. Hazeki, T. Katada and M. Ui, Biochem. J., 1996, 315, 505–512 CAS .
  18. P. S. Hegde, I. R. White and C. Debouck, Curr. Opin. Biotechnol., 2003, 14, 647–651 CrossRef CAS .
  19. K. A. Zarember and P. J. Godowski, J. Immunol., 2002, 168, 554–561 CAS .
  20. M. Denis, J. Leukocyte Biol., 1994, 55, 682–684 Search PubMed .
  21. M. Schneemann, G. Schoedon and C. Bogdan, Nat. Immunol., 2002, 3, 102 CrossRef CAS .
  22. M. Schneemann, G. Schoedon, S. Hofer, N. Blau, L. Guerrero and A. Schaffner, J. Infect. Dis., 1993, 167, 1358–1363 CAS .
  23. O. A. Skorokhod, E. Schwarzer, M. Ceretto and P. Arese, Malar. J., 2007, 6, 73 CrossRef .
  24. S. Hougee, A. Sanders, J. Faber, Y. M. F. Graus, W. B. Van Den Berg, J. Garssen, H. F. Smit and M. A. Hoijer, Biochem. Pharmacol., 2005, 69, 241–248 CrossRef CAS .
  25. J. B. Weinberg, M. A. Misukonis, P. J. Shami, S. N. Mason, D. L. Sauls, W. A. Dittman, E. R. Wood, G. K. Smith, B. McDonald, K. E. Bachus, A. F. Haney and D. L. Granger, Blood, 1995, 86, 1184–1195 CAS .
  26. Y. C. Kuo, N. S. Yang, C. J. Chou, L. C. Lin and W. J. Tsai, Molecular Pharmacology, 2000, 58, 1057–1066 CAS .
  27. S. Okada, S. Obata, M. Hatano and T. Tokuhisa, Int. Immunol., 2003, 15, 1275–1282 CrossRef CAS .
  28. Y. Hirata, Y. Masuda, H. Kakutani, T. Higuchi, K. Takada, A. Ito, Y. Nakagawa and H. Ishii, Biochem. Pharmacol., 2008, 75, 1504–1514 CrossRef CAS .
  29. T. Langmann, C. Buechler, S. Ries, A. Schaeffler, C. Aslanidis, M. Schuierer, M. Weiler, K. Sandhoff, P. J. De Jong and G. Schmitz, J. Lipid Res., 1999, 40, 870–880 CAS .
  30. D. E. Zhang, C. J. Hetherington, S. Tan, S. E. Dziennis, D. A. Gonzalez, H. M. Chen and D. G. Tenen, J. Biol. Chem., 1994, 269, 11425–11434 CAS .
  31. L. Armstrong, N. Jordan and A. Millar, Thorax, 1996, 51, 143–149 CrossRef CAS .
  32. K. W. Moore, A. O'Garra, R. De Waal Malefyt, P. Vieira and T. R. Mosmann, Annu. Rev. Immunol., 1993, 11, 165–190 CrossRef CAS .
  33. T. A. Sato, J. A. Keelan and M. D. Mitchell, J. Immunol., 2003, 170, 158–166 CAS .
  34. G. H. Giambartolomei, V. A. Dennis, B. L. Lasater, P. K. Murthy and M. T. Philipp, Infect. Immun., 2002, 70, 1881–1888 CrossRef CAS .
  35. A. H. Sprague and R. A. Khalil, Biochem. Pharmacol., 2009, 78, 539–552 CrossRef CAS .
  36. A. W. Boots, L. C. Wilms, E. L. R. Swennen, J. C. S. Kleinjans, A. Bast and G. R. M. M. Haenen, Nutrition, 2008, 24, 703–710 CrossRef CAS .
  37. C. H. Chen, M. T. Sheu, T. F. Chen, Y. C. Wang, W. C. Hou, D. Z. Liu, T. C. Chung and Y. C. Liang, Biochem. Pharmacol., 2006, 72, 1001–1009 CrossRef CAS .
  38. M. P. Nair, S. Mahajan, J. L. Reynolds, R. Aalinkeel, H. Nair, S. A. Schwartz and C. Kandaswami, Clin. Vaccine Immunol., 2006, 13, 319–328 CrossRef CAS .
  39. H. Salman, M. Bergman, M. Djaldetti, J. Orlin and H. Bessler, Biomed. Pharmacother., 2008, 62, 579–582 CrossRef CAS .
  40. I. J. Thompson, P. C. F. Oyston and D. E. Williamson, Expert Rev. Anti-Infect. Ther., 2010, 8, 339–352 CrossRef CAS .
  41. F. Habeeb, G. Stables, F. Bradbury, S. Nong, P. Cameron, R. Plevin and V. A. Ferro, Methods, 2007, 42, 388–393 CrossRef CAS .
  42. L. Reyes, M. K. Davidson, L. C. Thomas and J. K. Davis, Infect. Immun., 1999, 67, 3188–3192 CAS .
  43. L. Zhou, L.h. Shen, L.h. Hu, H. Ge, J. Pu, D.j. Chai, Q. Shao, L. Wang, J.z. Zeng and B. He, Mol. Cell. Biochem., 2010, 335, 283–289 CrossRef CAS .
  44. K. J. Livak and T. D. Schmittgen, Methods, 2001, 25, 402–408 CrossRef CAS .
  45. S. Y. Cho, S. J. Park, M. J. Kwon, T. S. Jeong, S. H. Bok, W. Y. Choi, W. I. Jeong, S. Y. Ryu, S. H. Do, C. S. Lee, J. C. Song and K. S. Jeong, Mol. Cell. Biochem., 2003, 243, 153–160 CrossRef CAS .
  46. R. Tada, F. Ikeda, K. Aoki, M. Yoshikawa, Y. Kato, Y. Adachi, A. Tanioka, K.i. Ishibashi, K. Tsubaki and N. Ohno, Immunol. Lett., 2009, 123, 144–148 CrossRef CAS .

This journal is © The Royal Society of Chemistry 2010
Click here to see how this site uses Cookies. View our privacy policy here.