Wasaporn
Chanput
abd,
Jurriaan
Mes
c,
Robert A. M.
Vreeburg
c,
Huub F. J.
Savelkoul
a and
Harry J.
Wichers
*abc
aCell Biology and Immunology Group, Wageningen University and Research Centre, Marijkeweg 40, P.O. Box 338, 6700 AH, Wageningen, The Netherlands. E-mail: harry.wichers@wur.nl
bLaboratory of Food Chemistry, Wageningen University and Research Centre, Bomenweg 2, P.O. Box 8129, 6700 EV, Wageningen, The Netherlands
cFood & Biobased Research, Wageningen University and Research Centre, Bornse Weilanden 9, P.O. Box 17, 6700 AA, Wageningen, The Netherlands
dDepartment of Food Science and Technology, Faculty of Agro-Industry, Kasetsart University, 50 Phahonyothin Road, Chatuchak, Bangkok, 10900, Thailand
First published on 1st November 2010
An assay was developed to study inflammation-related immune responses of food compounds on monocytes and macrophages derived from THP-1 cell line. First strategy focused on the effects after stimulation with either lipopolysaccharide (LPS) or Concanavalin A (ConA). Gene expression kinetics of inflammation-related cytokines (IL-1β, IL-6, IL-8, IL-10 and TNF-α), inflammation-related enzymes (iNOS and COX-2), and transcription factors (NF-κB, AP-1 and SP-1) were analyzed using RT-PCR. Time dependent cytokine secretion was investigated to study the inflammation-related responses at protein level. LPS stimulation induced inflammation-related cytokine, COX-2 and NF-κB genes of THP-1 monocytes and THP-1 macrophages with the maximum up-regulation at 3 and 6 h, respectively. These time points, were subsequently selected to investigate inflammation modulating activity of three well known immuno-modulating food-derived compounds; quercetin, citrus pectin and barley glucan. Co-stimulation of LPS with either quercetin, citrus pectin, or barley glucan in THP-1 monocytes and macrophages showed different immuno-modulatory activity of these compounds. Therefore, we propose that simultaneously exposing THP-1 cells to LPS and food compounds, combined with gene expression response analysis are a promising in vitro screening tool to select, in a limited time frame, food compounds for inflammation modulating effects.
The innate immune system relies on pathogen recognition receptors (PRRs) such as toll-like receptors (TLRs), to recognize conserved molecular structures of invading pathogens called pathogen associated molecular patterns (PAMPs). PAMPs, like lipopolysacharide (LPS), play a pivotal role in the initiation of a variety of host responses caused by infection with Gram-negative bacteria. Such action leads to systemic inflammatory response, for instance up-regulation of pro-and anti-inflammatory cytokine genes, resulting in secretion of cytokine proteins into the blood stream.5,6 Some transcription factors have been shown to be directly or indirectly related to the receptor-mediated expression of inflammation related-cytokine and inflammation-related enzyme genes. The transcription factor Nuclear Factor (NF)-κB is involved in the transcriptional regulation of the IL-1β, IL-6, IL-8, TNF-α, iNOS and COX-2 genes.7,8 The transcription factor AP-1 is associated with the regulation of IL-8 and TNF-α genes.7,9 Activation of the AP-1 transcription factor occurs by an increased the production of c-Jun and c-Fos proteins which need to form a dimeric complex binding the promoter region of AP-1.10 Expression of the IL-10 gene is regulated by SP-1 transcription factor.11,12
Immune responses are commonly determined by measuring the presence of cytokines in culture medium after challenging cells. However, these assays are often performed with relatively long exposure time (generally hours) in order to obtain cytokine levels above the threshold which can lead to the initiation of further signalling pathways. Furthermore, cytokine protein secretion is only partly related to the expression of cytokine-related genes and their upstream transcription factors, because of extensive regulation of the transcription and translation processes.13,14 We, therefore, investigated the gene expression kinetics of inflammation-related cytokines, inflammation-related enzymes and relevant transcription factors, together with time-dependent cytokine protein secretion. Genetically identical THP-1 monocytes and macrophages, which were stimulated with LPS and ConA, were used as a model. Furthermore, the application of this assay for screening immuno-modulatory effects of food-derived components was tested and discussed.
![]() | ||
| Fig. 1 Inflammation-related cytokine gene expression relative to GAPDH (ΔCt) of THP-1 monocytes and macrophages before stimulation. Data shown are the means + standard deviation (SD bars) from two independent biological replications. | ||
THP-1 cells, like primary monocytes and macrophages, expressed a variety of inflammation-related cytokine genes in response to LPS (Fig. 2A, C). The IL-6 gene showed, among the analyzed cytokine genes, the highest fold change of expression in both THP-1 monocytes and macrophages. Exposure of THP-1 monocytes to LPS strongly induced IL-1β, IL-6, IL-8, IL-10 and TNF-α gene expression, with maximal expression after 3 h of stimulation, except for IL-6 expression which gradually increased throughout the incubation time (Fig. 2A). All inflammation-related cytokine genes of THP-1 macrophages were also highly up-regulated by LPS-stimulation but less than those of monocytes, except IL-6, with a maximal expression after 6 h of stimulation (Fig. 2C). The onset of up-regulation of all analyzed inflammation-related cytokine genes appeared to be earlier in THP-1 monocytes (within 1 h) compared to that of macrophages (within 2 h) (Fig. 2A, C).
![]() | ||
| Fig. 2 Inflammation-related cytokine gene expression kinetics and cytokine secretion kinetics of THP-1 monocytes (A-B) and THP-1 macrophages (C-D) stimulated with 1 μg ml−1 LPS. Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown from RT-PCR are the means + standard deviation (SD bars) from two independent biological replications. | ||
In all experiments, controls were performed using non-stimulated cells (medium). ConA was chosen as a negative or weak stimulus of the innate immunity. Non-stimulated THP-1 monocytes and macrophages and those-stimulated with ConA showed no or very low effects on gene expression of the inflammation-related cytokine genes (Fig. 3A, C).
![]() | ||
| Fig. 3 Inflammation-related cytokine gene expression kinetics and cytokine secretion kinetics of THP-1 monocytes (A-B) and THP-1 macrophages (C-D) stimulated with 5 μg ml−1 ConA and non-stimulated (medium). Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown are the means from two technical measurements. | ||
![]() | ||
| Fig. 4 Inflammation-related enzyme and transcription factor gene expression kinetics of THP-1 monocytes (A) and THP-1 macrophages (B) stimulated with 1 μg ml−1 LPS. Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown are the means + standard deviation (SD bars) from two independent biological replications. | ||
| Gene | Accession number | Primer working concentration/μM | Sequence (5′→3′) |
|---|---|---|---|
| IL-1β | ncbi-n:NM_000576.2 | 0.1 | F- GTGGCAATGAGGATGACTTGTTC |
| R- TAGTGGTGGTCGGAGATTCGTA | |||
| IL-6 | ncbi-n:NM_000600.3 | 0.1 | F- AGCCACTCACCTCTTCAGAAC |
| R- GCCTCTTTGCTGCTTTCACAC | |||
| IL-8 | ncbi-n:NM_000584.2 | 0.1 | F- CTGATTTCTGCAGCTCTGTG |
| R- GGGTGGAAAGGTTTGGAGTATG | |||
| IL-10 | ncbi-n:NM_000572.2 | 0.4 | F- GTGATGCCCCAAGCTGAGA |
| R- CACGGCCTTGCTCTTGTTTT | |||
| TNF-α | ncbi-n:NM_000594.2 | 0.1 | F- CTGCTGCACTTTGGAGTGAT |
| R- AGATGATCTGACTGCCTGGG | |||
| iNOS (1) | ncbi-n:NM_000625.3 | 0.1 | F- CATCCTCTTTGCGACAGAGAC |
| R- GCAGCTCAGCCTGTACTTATC | |||
| iNOS (2) | ncbi-n:NM_000625.4 | 0.1 | F- GGCTGGAAGCCCAAGTACG |
| R- CTCAGGGTCACGGCCATTG | |||
| COX-2 | ncbi-n:NM_000963.2 | 0.1 | F- CAGCACTTCACGCATCAGTT |
| R- CGCAGTTTACGCTGTCTAGC | |||
| NF-κB | ncbi-n:NM_003998.2 | 0.4 | F- TGAGTCCTGCTCCTTCCA |
| R- GCTTCGGTGTAGCCCATT | |||
| SP-1 | ncbi-n:NM_138473.2 | 0.4 | F- GGTGCCTTTTCACAGGCTC |
| R- CATTGGGTGACTCAATTCTGCT | |||
| c-Jun | ncbi-n:NM_002228.3 | 0.4 | F- TGGAAACGACCTTCTATGACGA |
| R- GTTGCTGGACTGGATTATCAGG | |||
| c-Fos | ncbi-n:NM_005252.3 | 0.4 | F- GGATAGCCTCTCTTACTACCAC |
| R- TCCTGTCATGGTCTTCACAACG | |||
| GAPDH | ncbi-n:NM_002046.3 | 0.1 | F- TGCACCACCAACTGCTTAGC |
| R- GGCATGGACTGTGGTCATGAG |
IL-8 was the most predominant cytokine in the supernatant of both THP-1 monocytes and macrophages (Fig. 2B, D). IL-8 concentration in the supernatant increased over time and only in THP-1 macrophages reached a plateau within the tested time frame after 18 h of stimulation. The relative order in abundance of cytokines secreted from THP-1 monocytes and macrophages was similar to the order of their responsive genes relative to GAPDH (Fig. 1), except for IL-1β from THP-1 monocytes, of which the expression was relatively close to that of the IL-8 gene, but not at protein level. All analyzed cytokines, except for TNF-α from monocytes and IL-10 from macrophages, continued to accumulate over the incubation time (Fig. 2B, D). Cytokines secreted from ConA-stimulated THP-1 monocytes and macrophages were detected in relatively low amounts (Fig. 3B, D), except IL-8 from ConA-stimulated and non-stimulated THP-1 macrophages (Fig. 3D).
These results suggest that the RNA expression and protein secretion are correlated to a large extent. The lag-phase in up-regulation of the mRNA level was approximately 1 h before cytokine proteins were secreted at a detectable concentration. Cytokine production demonstrated more variable kinetics than the expression of corresponding genes, which results in less uniform time points in quantification of effects.
Data represented in Fig. 5 show the effect of quercetin, citrus pectin and barley glucan on modulation of LPS-induced responses. Quercetin, citrus pectin and barley glucan lowered the LPS-induced expression of most inflammation-related genes expressed by THP-1 monocytes, except TNF-α and COX-2 (Fig. 5A). Different effects were observed from THP-1 macrophages as compared to monocytes for specific food components. After 6 h of stimulation, quercetin reduced expression of all inflammation-related genes of LPS-stimulated THP-1 macrophages, except COX-2 (Fig. 5B). Less inflammatory reducing effects were found for citrus pectin compared to quercetin in THP-1 macrophages. Barley glucan appeared to enhance expression of inflammation-related genes of LPS-stimulated THP-1 macrophages (Fig. 5B) whereas in monocytes it had a reducing effect. Our results indicate that gene expression after simultaneous exposure of LPS with food components to THP-1 monocytes for 3 h and THP-1 macrophages for 6 h is an adequate model to examine inflammation-modulating activity of food compounds.
![]() | ||
| Fig. 5 Inflammation-related cytokine gene expression of 700 ng ml−1 LPS-stimulated THP-1 monocytes (A) and macrophages (B) with 50 μM quercetin (LPS + Q), 0.75 mg ml−1 citrus pectin (LPS + CP) and 100 g ml−1 barley glucan (LPS + BG). THP-1 monocytes were collected at 3 h and macrophages at 6 h after stimulation. Gene expression was expressed as relative gene expression towards GAPDH-expression and non-stimulated cells at time zero (ΔΔCt). Data shown are the means + standard deviation (SD bars) from independent biological replications. | ||
Differences in RNA stability, protein translation kinetics, post-translational modification factors and proteolytic processing events, make the production of individual cytokines unique.18 However, a general relation between mRNA and protein level in both LPS-stimulated THP-1 monocytes and macrophages was found in our studies. The higher mRNA expression level relative to GAPDH of inflammation-related cytokine genes and higher cytokine secretion level of LPS-stimulated THP-1 macrophages, as compared to monocytes, could be caused by higher expression of TLR4-mRNA (a PRR for LPS).19
LPS strongly up-regulated inflammation-related cytokine, COX-2 and NF-κB genes in THP-1 monocytes and macrophages, while no expression of the iNOS gene after LPS-stimulation was found. This last finding was in concordance with studies making use of PBMCs, indicating that human peripheral monocytes and their derived macrophages are not able to express the iNOS gene after LPS induction.20–23 However, some PBMC-based studies indicated the ability of LPS to up-regulate the iNOS gene.24,25 No unequivocal explanation for this controversy has been presented yet. Based on literature, it seems that species differences, genetic background, and perhaps details of experimental procedure play a role.7,20–25 The relatively low and short expression of c-Jun and c-Fos in LPS-stimulated THP-1 monocytes and macrophages can be explained by the fact that these genes are typical early response genes with a very short mRNA half life of only 35–45 min.26,27 A bi-phasic pattern of c-Fos gene expression in LPS-stimulated THP-1 macrophages was also reported.26,27 The binding activity of nuclear proteins to SP-1 target genes was constitutive and unchanged by LPS stimulation in THP-1 monocytes and murine macrophages11,28 but it can be up-regulated during the PMA or vitamin D3 induced differentiation process of THP-1 monocytes to regulate the expression of CD14.29,30 Therefore, it could be argued that SP-1 might not be an appropriate gene to serve as an indicator in LPS exposure of THP-1 monocytes and macrophages.
Accumulation of TNF-α in supernatants of both THP-1 monocytes and macrophages declined after 6 and 24 h of stimulation, respectively. The decline of TNF-α-accumulation in our studies was consistent with the findings in several studies which demonstrated that IL-10 can suppress TNF-α production in human monocytes and macrophages, or even cause diminished levels of TNF-α, IL-1β and IL-8 mRNA upon prolonged stimulation.31–33 However, to drive such mechanisms, IL-10 needs to bind to IL-10R-1 and IL-10R-2 which should cause a decrease in the measurable (unbound) amount of IL-10 in culture supernatants.34,35 Similar to our results, IL-10 cytokine accumulation by LPS-stimulated THP-1 monocytes slightly dropped at 6 h and increased again at 18 h after stimulation, while it dramatically decreased in THP-1 macrophages at 18–30 h after stimulation.
The beneficial health effects of quercetin and citrus pectin have been attributed to their anti-inflammatory activity,36–39 while β-glucans show their immunological effect by enhancing innate immunity through induction of cytokine production and phagocytosis.40 Incubating LPS-stimulated THP-1 monocytes for 3 h and macrophages for 6 h with the food compounds revealed different inflammation-modulating effects at mRNA level with similarity as described in the mentioned literature.
Studying effects of PAMPs and other (food based) immuno-modulating compounds using monocytes and macrophages isolated from PBMCs might be a more realistic model for human immune functioning. However, large variation between blood samples, time and cost efficiency make it difficult to apply this in a high throughput fashion. It has been indicated that the THP-1 cell line has shown to be an accurate model for native and monocytes-derived macrophages for studying LPS responses.3,4,41,42 Our findings suggested that LPS-stimulated THP-1 monocytes and macrophages are a sensitive in vitro system to analyze potential immunomodulatory activity of food components by using a detailed insight into the kinetics of mRNA expression. Therefore, THP-1 monocytes and macrophages could thus be a suitable and reliable model for screening a variety of components prior to a more detailed analysis with human derived cells.
The measurement was performed twice from one of two biological replicates.
| This journal is © The Royal Society of Chemistry 2010 |