Response of chlorinated hydrocarbon transformation and microbial community structure in an aquifer to joint H₂ and O₂

Abstract

Hydrogen (H₂) and oxygen (O₂) are critical electron donors and acceptors to promote the anaerobic and aerobic microbial transformation of chlorinated hydrocarbons (CHCs), respectively. Electrochemical technology can effectively supply H₂ and O₂ directly to an aquifer. However, the response of CHC transformation and microbial community structure to joint H₂ and O₂ are still unclear. In this work, microcosms containing different combinations of H₂ and O₂ were constructed with natural sediments and nine mixed CHCs. The joint H₂ and O₂ microcosm (H₂/O₂ microcosm) significantly promoted the biotransformation of trichloroethylene (TCE), trans-dichloroethene (tDCE) and chloroform (CF). Illumina sequencing analyses suggested that a particular microbial community was formed in the H₂/O₂ microcosm. The specific microbial species included Methyloversatilis, Dechloromonas, Sediminibacterium, Pseudomonas, Acinetobacter, Curvibacter, Comamonas and Acidovorax, and the relative abundance of the tceA, phe and soxB genes synchronously increased. These results suggested that some specific microbes are potential CHC converters using H₂ and O₂ as energy sources, and aerobic and anaerobic transformations exist simultaneously in the H₂/O₂ microcosm. It provides a theoretical basis for establishing efficient green remediation technologies for CHC contaminated aquifers.

---

1 Introduction

Chlorinated hydrocarbons (CHCs) are widely used in various industrial applications.¹ Due to improper disposal, CHCs have become common pollutants in soil and groundwater.^2–4 Many of them accumulate in the fatty tissue of organisms and show various degrees of toxicity for humans and ecosystems,⁵ so it is necessary to study their migration and transformation. The previous research mainly focuses on individual CHC transformation, but CHCs are often present in aquifers as complex mixtures of contaminants.⁶ In addition, chloroform (CF), chlorinated ethenes, and chlorinated ethanes have been shown to inhibit the dechlorinating activity of organohalide respiring bacteria.⁶ Carbon tetrachloride (CT) and especially CF have been observed to inhibit the reductive dehalogenation of perchloroethylene (PCE) and trichloroethylene (TCE).⁷ Hence, a better understanding of mixed CHC transformation under laboratory conditions may provide a basis for groundwater remediation when multiple contaminants are present.

Anaerobic and aerobic biotransformation has been proven to be suitable methods for the bioremediation of CHC contaminated sites.^8,9 Organohalide respiration is an effective means of CHC transformation in anaerobic environments by microorganisms such as Dehalococcoides and Desulfuromonas.^4,10,11 Reductive dehalogenase enzymes (RDases) are critical enzymes for organohalide respiration, cleaving the carbon–chlorine bond, such as the pceA gene encoded PCE-RDase and the tceA gene encoded TCE-RDase.¹⁰ Under aerobic conditions, CHCs can be co-metabolically degraded during microbial metabolism processes using other growth substrates or be directly used as growth substrates by some microbial species, such as Pseudomonas sp., Bacillus sp. and Stenotrophomonas sp.^10,12,13 Monooxygenases are critical enzymes for aerobic biodegradation of chloroethene.¹⁴ Therefore, the above functional microorganisms play an essential role in CHC transformation.

However, the transformation of CHCs via microbial pathways is often limited by the restricted electron donors and electron acceptors. Several electron donors, including methanol, butyrate, lactate, benzoate and hydrogen (H₂), have been reported to enhance the reductive dechlorination of CHCs in the field and laboratory studies.^15–17 In most cases, H₂ produced during the fermentation of organic compounds was the actual electron donor and showed the best ability to promote reductive dechlorination.^15,18 However, when H₂ stimulated the activity of dehalogenation microbes, it might also enhance the growth of competing microbial populations, such as methanogens, acetogens, sulphate and nitrate reducers, which was unfavourable for reductive dechlorination.^10,19

Meanwhile, some microbes can utilize O₂ as an electron acceptor to degrade CHCs.^12,13 Therefore, introducing O₂ into the subsurface through bioventing/biosparging or injecting O₂ releasing materials (magnesium peroxide or calcium peroxide) becomes an effective strategy for the in situ bioremediation of organic-contaminated sites.^20–22 It is well known that O₂, as an excellent electron acceptor, can promote the growth of many aerobic and facultative microorganisms,²³ but seriously inhibit anaerobic microbes, such as methanogens, acetogens, sulphate and nitrate reducers.^4,24 Therefore, H₂ and O₂ play essential roles in regulating microbial communities and CHCs transformation.

In addition, due to the lower energetic yield of the metabolic reaction, bacteria are less inclined to undertake reductive dechlorination (anaerobic biotransformation) of low-chlorinated cis-dichloroethene (cDCE) and vinyl chloride (VC), thus they often accumulate at sites where PCE and TCE are transformed through organohalide respiration.¹⁰ Compared to anaerobic biotransformation, aerobic biotransformation is more efficient for CHCs with fewer chlorine substituents.^8,10 Therefore, H₂ and O₂ were sequentially used to promote the transformation of CHCs.^25–27 In recent years, the newly developed electrochemical technology provided both H₂ and O₂ simultaneously via water electrolysis to the aquifer and effectively converted CHCs.²⁸ However, the transformation of CHCs triggered by the joint H₂/O₂ and their effects on the microbial communities remains unclear. The synergistic regulation mechanism needs to be explored.

In this work, the response of CHCs transformation and microbial communities to joint H₂/O₂ (produced from electrochemical technology) were studied in the lab, with nine mixed CHCs selected as representative contaminants, including chlorinated alkenes (PCE, TCE and trans-dichloroethene (tDCE)) and chlorinated alkanes (1,1,2,2-tetrachloroethane (1,1,2,2-TeCA), 1,1,2-trichloroethane (1,1,2-TCA), 1,2-dichloroethane (1,2-DCA), CT, CF and dichloromethane (DCM)). In addition, the quantification of microbial functional genes related to CHCs' aerobic and anaerobic transformation was detected to verify the relationship between the CHCs transformation and the microbial community composition. This work will provide a theoretical basis for establishing efficient green remediation technologies for CHCs contaminated aquifers.

2 Materials and methods

2.1 Chemicals

PCE (99%), TCE (99.5%), tDCE (98%), 1,1,2,2-TeCA (99.8%), 1,1,2-TCA (99%), 1,2-DCA (99%), CT (99%), CF (99%), and DCM (99.5%) were obtained from J&K Scientific Ltd., China. Sodium azide (NaN₃) was obtained from Sinopharm Chemical Reagent Co., China. All chemicals used were of analytical grade or above. Ultrapure water (18.25 MU cm, ZOOMWO-M) was used for all the experiments. The H₂ (99%), O₂ (99%) and N₂ (99%) were purchased from Wuhan Iron & Steel (Group) Oxygen Co., Ltd.

2.2 Sediments characterization

The sediments for experiments were collected from an abandoned chemical factory site in Tianjin (China) at a depth of ∼5 m. The place was contaminated with high concentrations of chlorinated solvents. The contents of CHCs and other main chemical characteristics of the sediments are displayed in Table S1.†

2.3 Chlorinated hydrocarbon transformation experiments

The experimental device used in this study for different microcosms was made of a 300 mL screw glass bottle, shown in Fig. 1. It consisted of a glass bottle and collapsible Teflon bag. A fluorine rubber hose connected the two units. The liquid and sediment sampling points were located at about 3.5 and 1 cm from the bottom of the glass bottle, respectively. The sole H₂ and O₂ were obtained by water electrolysis and collected in different collapsible Teflon bags. The gas content of joint H₂/O₂ microcosm is 100 mL H₂ and 50 mL O₂. The individual N₂, H₂ and O₂ microcosms were conducted as control, with 150 mL of N₂, H₂ and O₂, respectively. The microorganism was inhibited by 1 g L⁻¹ sodium azide for abiotic control.

Fig. 1 Experimental device used for different microcosms. The collapsible Teflon bag was used to supply N₂, H₂, O₂ and H₂/O₂, which through the gas inlet point into the glass bottle. Liquid/sediment samples were taken from liquid sampling point and sediment sampling point, respectively. Liquid sampling point was a Teflon valve, sediment sampling point was fluorine rubber hose, which was sealed with a water stopper. Noninvasive O₂ sensor was used for dissolved oxygen measurement.

The experiments were prepared in an anaerobic chamber (Coy Laboratory Products Inc., Michigan). Forty grams of wet sediment, 200 mL of deionized water (purged with N₂ for 30 min to remove dissolved O₂) and the mixed stocking solution of nine CHCs including PCE, TCE, tDCE, 1,1,2,2-TeCA, 1,1,2-TCA, 1,2-DCA, CT, CF, and DCM were added to the experimental devices. The initial concentration of each CHC was 30 μM. The Teflon bags containing gases were connected with the glass bottles. Microcosms were prepared in triplicates for each experimental treatment. The initial substrate concentrations were measured after one hour of shaking at 25 °C and 150 rpm. The initial concentration of each CHC in the aqueous phase is shown in Table 1.

Table 1 Initial concentration of CHCs in microcosms

No.	Pollutants	Concentration (μM)
1	Perchloroethylene	42.97 ± 8.10
2	Trichloroethylene	39.13 ± 5.76
3	trans-Dichloroethene	30.18 ± 2.35
4	1,1,2,2-Tetrachloroethane	27.46 ± 3.45
5	1,1,2-Trichloroethane	28.11 ± 1.90
6	1,2-Dichloroethane	28.73 ± 1.80
7	Carbon tetrachloride	31.11 ± 3.17
8	Chloroform	33.42 ± 1.64
9	Dichloromethane	28.04 ± 2.03

---

The experimental devices were shaken at 25 °C on a rotary shaker at 150 rpm. One millilitre liquid sample was collected from the upper outlet of the bottle after several minutes of settlement and then added into a 42 mL brown bottle with 40 mL ultrapure water to determine the concentration of CHCs. Sediment samples were collected from the bottom outlet of the bottle and immediately frozen at −20 °C for further DNA extraction and 16S rRNA sequence analysis, which were prepared in triplicates. The sediments were digested in a Microwave Digestion System (MARS 5, CEM, USA) with concentrated nitric acid to determine cation components.

2.4 Analytical methods

The concentration of CHCs and possible transformation intermediates were determined by automatic purge and trap-gas chromatography-mass spectrometry (PT-GC-MS) (PT: Atomx, Teledyne Tekmar, USA; GC-MS: Thermo Fisher Scientific Inc., USA). Compounds were separated by an Aligent DB-624 capillary column (30 m × 0.25 mm × 1.4 μm), and the MS detector was operated in a full scan mode. The oven temperature was held at 35 °C for 2 min, heated at a rate of 5 °C min⁻¹ to 100 °C, held for 2 min and then heated at a rate of 10 °C min⁻¹ to 200 °C and held for 1 min. The inlet and MS transfer line temperatures were set at 220 and 280 °C, respectively.

Total organic carbon (TOC) was measured by an Elemental Analyzer (multi EA 4000, JENA, Germany). Cation components in the sediments were measured by ICP-OES (Agilent 5100, USA), and anion components were measured by an ion chromatograph (Eco IC, Metrohm, Switzerland). Immediately after sampling, the oxidation–reduction potential (ORP) of the aqueous phase was measured by a pH meter (PHS-3C, Rex of Shanghai Co., Ltd. China) with an ORP composite electrode (Rex 501), and dissolved hydrogen (DH) was measured by a DH meter (DH200, CLEAN, USA). The dissolved oxygen (DO) was measured by a noninvasive oxygen meter (FIBOX 4, PreSens, Germany), with oxygen sensor spots previously glued onto the inner wall of the glass bottle.

2.5 DNA extraction and quantification of 16S rRNA gene

According to the manufacturer's instructions, DNA was extracted using PowerSoil® DNA Isolation Kits (MO BIO, USA). The primers of 341F (CCTACGGGAGGCAGCAG) and 515R (ATTACCGCGGCTGCTGGCA) were used to amplify the 16S rRNA gene.²⁹ The qPCR was performed on an ABI QuantStudio 3 (Version 1.4.1 software, Applied Biosystems, USA), and each sample was duplicated.³⁰

2.6 Taxonomic and functional microbial composition analyses

Sequencing was performed on an Illumina MiSeq instrument (MiSeq, Illumina, USA) at the Personal Biotechnology Company (Shanghai, China), using 338F (ACTCCTACGGGAGGCAGCA) and 806R (GGACTACHVGGGTWTCTAAT) primers to amplify the V3 and V4 regions of 16S rRNA genes. The microbial community was analysed using QIIME 2 (2019.4), and taxonomy was assigned using the Greengenes 13.8 database. Microbial diversity and abundance were estimated using the software Mothur (version 1.35.1, USA). The raw sequence data have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (BioProject accession number PRJNA797955).

2.7 Quantification of functional genes by qPCR

The relative abundance of genes related to trichloroethylene transformation, phenol transformation and sulfur oxidation were quantified by qPCR. The primers of tceA-500F (TAATATATGCCGCCACGAATGG) and tceA-795R (AATCGTATACCAAGGCCCGAGG) were used to amplify the trichloroethylene dehalogenation gene tceA.³¹ The primers of TBMD-F (GCCTGACCATGGATGCSTACTGG) and TBMD-R (CGCCAGAACCACTTGTCRRTCCA) were used to amplify the phenol monooxygenase gene phe.³² The primers of 710F (ATCGGYCAGGCYTTYCCSTA) and 1184R (MAVGTGCCGTTGAARTTGC) were used to amplify the sulfur oxidation gene soxB.³³ The 16S rRNA gene of each sample was used to normalize the data. The relative abundance was calculated by the 2^−ΔΔC_T method.²³

3 Results

3.1 The transformation of chlorinated hydrocarbons in various gas conditions

The transformation of each CHC under different H₂ and O₂ conditions in the mixed solution was observed (Fig. 2), and the mass balance and variance analysis of CHCs were listed in Table S2.† The microcosm with N₂ served as an anaerobic control with no electron donor and acceptors addition, and that with NaN₃ was set as an abiotic control because NaN₃ could inhibit microbial activity. As shown in Fig. 2a, PCE concentration gradually decreased over time in the NaN₃ microcosm, indicating the abiotic transformation of PCE. Some reduced components, mainly Fe(II)-bearing minerals, can directly reduce CHCs with higher chlorine substituents.³⁴ There was a minimal difference between the PCE variation in NaN₃ and N₂ microcosms, indicating limited PCE biotransformation occurred in N₂ microcosms. Generally, CHCs with more chlorine substituents, such as PCE, are easier to be transformed through anaerobic dechlorination.¹⁰ The minimal PCE transformation observed in this N₂ microcosm might be due to the relatively higher ORP of the sediment (Fig. S6†). The addition of H₂ slightly improved the PCE removal compared with NaN₃ and N₂ microcosms, suggesting H₂ promoted the anaerobic biotransformation of PCE. As shown in Fig. S6,† the ORP in H₂ microcosm decreased to −281 mV in two-day incubation, which should be the main reason for the stimulation of PCE anaerobic biotransformation. In the O₂ and H₂/O₂ microcosms, the removal of PCE mainly occurred in the first two days. About 19.26 μM PCE was removed in the O₂ microcosm, while the coexistence of H₂ inhibited PCE reduction. Generally, compared to anaerobic biotransformation, aerobic biotransformation is more efficient for CHCs with fewer chlorine substituents.^2,8,10 Therefore, the fast reduction of PCE in O₂ and H₂/O₂ microcosms in the first two days was more likely due to chemical reaction. When subsurface sediment is exposed to oxygen, some reduced substances, such as Fe(II)-bearing minerals, can activate molecular O₂ to produce hydroxyl radical (˙OH) and superoxide (O₂˙⁻)^35,36 to chemically oxidize chlorinated alkenes.^37–39

Fig. 2 Transformation of chlorinated ethenes (PCE (a), TCE (b), tDCE (c)) and chlorinated methanes (CT (d), CF (e), DCM (f)) in the different supplying conditions of H₂ and O₂ and with NaN₃ as abiotic control.

TCE remarkably increased 78.56% in the NaN₃ microcosm in 15 days (Fig. 2b). TCE is a common intermediate in transforming other CHCs, such as 1,1,2,2-TeCA and PCE.^10,17 About 16.74 μM PCE and 27.43 μM 1,1,2,2-TeCA in NaN₃ microcosm were removed in our research (Table S2†). The total PCE and 1,1,2,2-TeCA reduction (44.17 μM) were much higher than the TCE increase (21.32 μM) in the NaN₃ microcosm. Therefore, it is proposed that the accumulated TCE was intermediate during the abiotic transformation of PCE and 1,1,2,2-TeCA, and TCE might also be abiotically transformed further. Contrastingly, the TCE concentration did not significantly increase in all biotic microcosms, with the most apparent reduction occurring in joint H₂/O₂ microcosm (Fig. 2b). The difference in the TCE variations between the joint H₂/O₂ microcosm and the abiotic control was 38.39 μM, contributed by the biotransformation. Compared with sole O₂ and sole H₂ treatments, the joint H₂/O₂ promoted 17.51 and 9.98 μM TCE removal.

The concentration of tDCE in NaN₃, N₂, and H₂ microcosms did not significantly change (Fig. 2c and Table S2†), suggesting neither chemically nor biologically reduction happened. The addition of O₂ slightly promoted tDCE removal due to chemical oxidation or biological degradation.¹⁰ In contrast, tDCE decreased by 54% (14.59 μM) in H₂/O₂ microcosm. No other intermediates such as vinyl chloride (VC) or ethene were detected in our experiment systems.

The transformation of three chlorinated methanes in 15 days is displayed in Fig. 2d–f and Table S2.† CT showed different transformation trends in five microcosms (Fig. 2d). It continuously declined in the NaN₃ microcosm, and 24% (7.70 μM) was removed in 15 days. In the N₂ microcosm, CT decreased by 46% (13.10 μM), indicating anaerobic biotransformation of CT happened. The addition of H₂ enhanced CT anaerobic transformation as 71% (23.92 μM) of CT was removed in 15 days. In O₂ and H₂/O₂ microcosms, just like PCE, CT only decreased about 20% fastly on the first day, supposedly due to the oxidative transformation by the reactive oxygen species such as superoxide (O₂˙⁻).^40,41

CF contents in NaN₃ and O₂ microcosms did not significantly change after 15 day incubation (Fig. 2e and Table S2†), meaning no chemical and biological transformation occurred. In N₂ and H₂ microcosms, CF increased 13% (4.42 μM) and 25% (8.27 μM) in 15 days, respectively. CF is a potential intermediate of CT dechlorination.⁴² The increased CF should come from CT dechlorination. However, the increased CF amounts were less than the decreased CT, indicating that CF was further transformed in these two microcosms. By calculating the difference between decreased CT and increased CF, the CF lessened were 8.68 and 15.64 μM in N₂ and H₂ microcosms, respectively. Therefore, H₂ also promoted CF transformation. In H₂/O₂ microcosm, 20% CF (7.28 μM) decreased in 15 days, demonstrating CF transformation was significantly enhanced compared with the sole H₂ and O₂ microcosms. Previous studies have shown that CF can be co-metabolized under anaerobic and aerobic conditions.⁴³ Bouwer & McCarty observed that a significant fraction of radiolabeled CF was converted to CO₂ in anaerobic bioreactors, indicating alternative processes other than reductive hydrogenolysis.⁴³

DCM showed no significant variation in the microcosms except that 2.53 μM DCM decreased in H₂/O₂ microcosm, indicating a slight promotion of DCM transformation by H₂/O₂. However, no further intermediates were detected.

The three chlorinated ethanes, 1,1,2,2-TeCA, 1,1,2-TCA, and 1,2-DCA, showed no remarkable differences among the five microcosms (Fig. S1†), even though 1,1,2,2-TeCA decreased almost entirely in 15 days. It has been previously reported that 1,1,2,2-TeCA was transformed abiotically by dehydrochlorination, a non-redox reaction without electrons.^17,44

In conclusion, TCE, CT and CF could be biologically transformed under anaerobic N₂ and H₂ conditions, and TCE and tDCE could be degraded under O₂ conditions. The joint H₂/O₂ promoted the biotransformation of TCE, CF and tDCE.

3.2 Microbial community shift during chlorinated hydrocarbons transformation

Microorganisms play essential roles in the transformation of CHCs. After adding CHCs and incubating in various microcosms, the total biomass was evaluated through quantity of 16S rRNA by qPCR, and microbial community information/structure were analyzed by high-throughput sequence analysis of 16S rRNA gene amplicons. Fig. S2† showed that the microbial numbers per gram sediment in the four gas-treated microcosms were in the magnitude of 6–7 and exhibited a slight increase after 2 d incubation but with minimal differences among the treatments. Clustering and principal coordinate analysis (PCoA) was conducted to show the dissimilarity of the microbial communities in different microcosms (Fig. 3). The first two axes in the PCoA graph accounted for 29.4% and 14% of the community structure variation, respectively. It was demonstrated that the microbial communities with N₂ and H₂ treatments followed a similar evolution route along the PCo2 direction. After 15 d incubation in N₂ and H₂ microcosms, the final microbial communities were very close. The microbial community with O₂ treatment shifted in the same direction as that in N₂ and H₂ microcosms in 10 days and returned to the original state after 15 d incubation. However, the microbial community in joint H₂ and O₂ shifted along the PCo1 direction, and the final microbial community after the 15 d experiment was far from the other treatments, suggesting a distinct microbial community. After 15 d incubation, the microbial species abundance (observed species and Chao 1 indices) and diversity (Shanon and Simpson indices) were remarkably different (Fig. S3†). The joint H₂/O₂ treatment induced higher microbial species abundance than the original and O₂-treated sediment but lower than that treated with N₂ and H₂. In contrast, the diversity in H₂/O₂ microcosm was the highest among all treatments.

Fig. 3 Distance matrix and PCoA analysis of microbial communities with different treatments.

The most abundant ten microbial phyla in different microcosms with incubation time are displayed in Fig. S4.† Firmicutes was the major phylum constituting 95.9% of total bacterial reads in the initial sediment sample. The relative abundance of Proteobacteria and Actinobacteria remarkably increased after 15 d cultivation in the four microcosms. In the H₂/O₂ microcosm, the abundance of Proteobacteria (65.2%) was much higher than that in N₂, H₂ and O₂ microcosms (15.6, 20.5, and 3.2%, respectively). Besides, Bacteroidetes also obviously increased in the H₂/O₂ microcosm (6.9%) compared to the N₂, H₂ and O₂ microcosms (1.0%, 1.3% and 0.2%, respectively) after 15 d cultivation.

To more clearly distinguish the taxonomic differences among treatments and find out the specific microbial species and their taxonomic relationship, the taxonomic tree from phylum to species in packed circles were drawn, and the first ten genera were marked in Fig. 4. The red circles (the size represented its abundance) were the specific species in the H₂/O₂ microcosm. Almost all the genera of Methyloversatilis and Dechloromonas, which belong to the same family, and Sediminibacterium were only observed in the H₂/O₂ microcosm. Some species in the genera Pseudomonas, Acinetobacter, Curvibacter, Comamonas, and Acidovorax were specific in the H₂/O₂ microcosm.

Fig. 4 Taxonomic tree diagram of the microbial communities before and after 15 days of incubation in the four microcosms. In the figure, the largest circle represents the phylum level. The progressively smaller circle represents class, order, family, genus, and species in gradient order. Different colours are used to distinguish taxonomic levels. The innermost dot represents the first 100 ASVs of abundance, and its size (area) is proportional to the abundance of that ASV. Each ASV dot is displayed as a pie chart, showing the composition proportion of the ASV in each group. The larger the sector area is, the higher the abundance of the taxon in the corresponding group is. Each dot is coloured with the specific taxonomic attribute of the ASV at the genus level.

To clarify the microbes potentially involved in CHCs transformation, the variation of genera with time in different microcosms was analyzed (Fig. 5). The results showed that Pseudomonas significantly increased in the later stage (10–15 days) of cultivation in N₂ and H₂ microcosms (Fig. 5a). The addition of H₂ promoted the growth of Pseudomonas (0.1–10.3%) compared to that in the N₂ microcosm (0.1–7.5%). It increased in the first ten days and then obviously decreased in the O₂ microcosm, with the highest abundance of 2.0%. Pseudomonas rose dramatically in the first two days and fluctuated in the H₂/O₂ microcosm, with the highest abundance of 3.9%. Curvibacter increased considerably in the first ten days and then obviously decreased in the O₂ microcosm, and the highest abundance was 3.7% (Fig. 5b), while Curvibacter (0–4.2%) increased throughout the experiment in H₂/O₂ microcosm. Acinetobacter (highest abundance 12.6%) significantly increased in H₂/O₂ microcosm while only increased in the later stage (10–15 days) in N₂ and H₂ microcosms. The addition of H₂ promoted the growth of Acinetobacter (0.1–5.0%) compared to the N₂ microcosm (0.1–1.8%) (Fig. 5c). Meanwhile, Acinetobacter showed an ignorable change in the O₂ microcosm. Throughout the experiment, the relative abundance of Sediminibacterium (0–6.8%), Methyloversatilis (0–22.1%), and Dechloromonas (0–7.2%) strongly increased in H₂/O₂ microcosm (Fig. 5d–f), which were only found in minor proportions (<0.3% abundance) in other microcosms.

Fig. 5 Relative abundance variation of different genera (a to f) potentially involved in CHCs transformation.

The promotion of joint H₂ and O₂ on the CHCs transformation may be due to the aerobic and anaerobic microbes. Therefore, the quantification of microbial functional genes related to CHCs' aerobic and anaerobic transformation was detected. The reductive dehalogenases encoded by the tceA gene is responsible for TCE reduction.⁴⁵ The phenol monooxygenase encoded by the phe gene can degrade TCE co-metabolically under aerobic conditions.⁴⁶ The soxB gene encodes subunit of the sox enzyme system that is essential for sulfur-oxidizing bacteria, which has been found to degrade chloroethylenes.^23,47 Fig. 6 shows the changes in the relative abundance of the above functional genes with experimental time. In H₂/O₂ microcosm, the relative abundance of the tceA gene increased significantly along with the time (Fig. 6a), and after 15 days of cultivation, the tceA relative abundance was up to 16 ± 5 folds. Comparatively, the relative abundance of the tceA gene did not increase in the O₂ microcosm, and it was even below detection in N₂ and H₂ microcosms throughout the experiment. The phe gene only increased in H₂/O₂ microcosm, and the relative abundance was up to 936 ± 123 folds after 15 days of cultivation (Fig. 6b). The relative abundance of soxB gene in H₂/O₂ microcosm increased in the first ten days and decreased after that, which was finally raised to 1973 ± 250 folds after 15 d cultivation (Fig. 6c).

Fig. 6 Fold change of relative abundance of tceA (a), phe (b) and soxB (c) genes in different microcosms.

4 Discussion

4.1 Joint H₂/O₂ enhanced chlorinated hydrocarbons transformation

Our results demonstrated that, compared to the N₂, H₂, and O₂ controls, the joint H₂/O₂ promoted TCE, tDCE, and CF transformation (Fig. 2). Under anaerobic conditions, reductive microbial dechlorination is the main route for CHCs biotransformation.⁴ In this process, the CHCs serve as the terminal electron acceptor, and molecular H₂ typically serves as the electron donor.⁴ The CHCs with a high degree of chlorine substitution are generally more readily bio-transformed under anaerobic conditions but are often recalcitrant to aerobic degradation.⁴⁸

Under aerobic conditions, microbial degradation of CHCs mainly occurs through aerobic metabolic degradation (CHCs used as electron donors) and aerobic co-metabolic degradation (with degradation of CHCs occurring fortuitously during microbial metabolism processes using other growth substrates).¹⁰ O₂ is an effective electron acceptor, and oxidative CHCs degradation is more efficient with decreasing number of chlorine substituents.^8,10 TCE, tDCE, and CF can be biotransformed under either anaerobic or aerobic conditions, while biotransformation of PCE and CT occurs almost exclusively under anaerobic conditions.^43,49 This research proves that joint H₂/O₂ can enhance the transformation of CHCs with two and three chlorine substituents, which could be biotransformed under both anaerobic and aerobic conditions.

4.2 Specific microbes in joint H₂/O₂

Compared with N₂, H₂ and O₂ microcosms, the joint H₂/O₂ microcosm possesses a particular microbial community with specific species in the genera Methyloversatilis, Dechloromonas, Sediminibacterium, Pseudomonas, Acinetobacter, Curvibacter, Comamonas, and Acidovorax. In contrast, the relative abundance of the tceA, phe and soxB genes increased significantly.

Previous studies have indicated that Pseudomonas was capable of aerobic metabolic and anaerobic reductive dechlorination of TCE,^10,49 possibly determined by different species, which can explain the diverse behaviours of this genus in aerobic and anaerobic microcosms. The Pseudomonas in N₂ and H₂ microcosms increased after ten days, indicating that the anaerobic Pseudomonas grew slowly. Those in H₂/O₂ microcosm rose in the first two days, suggesting aerobic or facultative aerobic Pseudomonas in it.

Acinetobacter can utilize 3-chloroaniline and 4-chlorobenzoic acid under anaerobic conditions.^50,51 It may also play an essential role in the degradation of tDCE under aerobic conditions.⁵² Sediminibacterium is a facultative anaerobe, which exists in groundwater polluted by CHCs, and it is associated with the aerobic degradation of VC.⁵³ Methyloversatilis universalis is the only species identified in the Methyloversatilis genus. This aerobic versatile methylotrophic bacterium can grow with chlorinated herbicide benazolin-ethyl (4-chloro-2-oxobenzothiazolin-3-yl-acetic acid) as the sole carbon source.⁵⁴ Dechloromonas was possibly responsible for CF reductive dechlorination.⁵⁵ Our results show that Acinetobacter, Sediminibacterium, Methyloversatilis, and Dechloromonas are the specific genera and bloom in H₂/O₂ microcosm, indicating that they potentially transform CHCs through an aerobic or anaerobic pathway.

The genus Curvibacter is an aerobic chemoorganotroph,⁵⁴ which might be associated with the degradation of organic contaminants such as phthalate ester.⁵⁶ Our results show that this genus gradually increases in H₂/O₂ microcosm, possibly relating to aerobic metabolic or co-metabolic degradation of CHCs. Further studies are needed to prove this hypothesis.

In addition, in H₂/O₂ microcosm, the relative abundance of phe and soxB functional genes increased. Some genera, such as Acinetobacter, Pseudomonas and Dechloromonas, have been associated with the bioremediation of aromatic hydrocarbons.^55,57 Many aromatic hydrocarbons degrading bacteria can co-metabolically degrade chloroethene, such as TCE, cDCE and VC.¹⁰ Acinetobacter can utilize dimethyl sulfide (DMS) as the sole sulfur source and degrade TCE and three DCE isomers.⁴⁷ Hence, the H₂/O₂ microcosm might be conducive to the aerobically co-metabolic degradation of CHCs. In the microcosms, sediment from the chlorinated hydrocarbon-contaminated aquifer was used. The organic compounds in the sediment could be used as co-metabolic substrates. Meanwhile, the reductive dechlorination gene tceA also increased significantly in H₂/O₂ microcosm, indicating the anaerobic transform of TCE also existed, even though the anaerobic dechlorinating bacteria were not dominated in the systems.

4.3 Mechanisms of chlorinated hydrocarbons transformation in joint H₂/O₂

According to the microbial community analysis, the enhanced TCE, tDCE, and CF transformation by joint H₂/O₂ might follow the mechanism as below.

(1) The specific microbes adapted to the joint H₂/O₂ environment have a transformation function. The microbial species in the genera Methyloversatilis, Dechloromonas, Sediminibacterium, Pseudomonas and Acinetobacter, can potentially transform CHCs. Some might use H₂ and O₂ as energy sources for transformation. It was also observed that the H₂ concentration sharply increased to 0.5 mg L⁻¹ in two days in H₂ and H₂/O₂ microcosms (Fig. S5a†). However, it decreased to 0.4 mg L⁻¹ after two days in the H₂/O₂ microcosm. On the other hand, the O₂ concentration in H₂/O₂ microcosm was lower than that in the sole O₂ microcosm throughout the experiment (Fig. S5b†), indicating that more H₂ and O₂ were consumed in the H₂/O₂ microcosm than in the sole H₂ and O₂ systems. These results proposed that the microbes utilizing H₂ or O₂ co-existed or some microbes consuming both H₂ and O₂ existed in the H₂/O₂ microcosm. Hydrogen-oxidizing bacterias (HOB) are facultative autotrophic bacteria that can use H₂ as electron donor and O₂ as an electron acceptor to fix carbon dioxide.⁵⁸ In addition, in H₂/O₂ microcosm, the specific genera Pseudomonas has been reported as HOB, and genera Methyloversatilis and Dechloromonas belong to the same family Rhodocyclaceae, some genera of which have been reported as HOB, such as Paracoccus.^59,60 Microbes capable of simultaneously utilizing H₂ and O₂ may have the ability to transform CHCs. Further study is needed to isolate the specific microbes and identify their transformation ability together with consumption of H₂ and O₂ in the microcosms with different proportions of H₂ and O₂.

(2) The aerobic and anaerobic transformations of CHCs may co-exist in the joint H₂/O₂ environment and simultaneously transform CHCs, which are confirmed by the synchronous increase of aerobic phe and soxB genes and anaerobic tceA gene in this system (Fig. 6). Previous studies have demonstrated that under aerobic conditions, anaerobic dechlorination bacteria and aerobic VC degraders co-exist in the sediment of a hyporheic riverbed zone with high organic carbon, and both reductive dechlorination and aerobic co-metabolic degradation of VC occur at the same time.^61,62 Recent findings have revealed that the surface of sediment particles can form biofilms, and the presence of facultative aerobic bacteria colonizing the outer layers of sediment biofilms, which rapidly consume O₂ and protect the strict anaerobes such as organohalide-respiring bacteria in core microniches.⁶¹ Fig. S6† shows the ORP variation in different microcosms. The ORP value was between −104 to −195 mV in H₂/O₂ microcosm. Thus, reductive dechlorination might be possible, especially in the inner section of sediment particles in such a low ORP environment. However, further exploration is needed to clarify the aerobic and anaerobic zonation for chlorinated hydrocarbon transformation.

(3) Hydrogen can promote the aerobic biodegradation of CHCs with fewer chlorine substituents.² O₂ is toxic to anaerobic microorganisms.⁶³ Hydroxyl radical (˙OH) and superoxide (O₂˙⁻) produced by the oxidation of reduced substances in anaerobic sediments can kill some microorganisms.^64,65 In the H₂/O₂ microcosm, the O₂ concentration was lower than that in the sole O₂ microcosm throughout the experiment, especially in the first seven days (Fig. S5b†). Therefore the presence of H₂ may relieve the oxidative stress on the anaerobe or facultative anaerobes, which may be another reason for the promotion of chlorinated alkene removal.

5 Conclusions

The joint H₂/O₂ enhanced the transformation of TCE, tDCE, and CF. A particular microbial community with higher diversity formed. The specific microbes in joint H₂/O₂ were Methyloversatilis, Dechloromonas, Sediminibacterium, Pseudomonas, Acinetobacter, Curvibacter, Comamonas, and Acidovorax, one or more of them potentially transforming CHCs using H₂ and O₂ as energy sources. The relative abundance of the tceA, phe and soxB genes synchronously increased, indicating the coexistence of aerobic and anaerobic transformation of CHCs. Further studies are needed to clarify the mechanism of the CHCs transformation by these specific microbes.

Author contributions

Cui Li: conceptualization, methodology, validation, formal analysis, software, writing – original draft; Rong Chen, Weiwei Ouyang, Chen Xue, Minghui Liu: writing – review & editing; Hui Liu: supervision, project administration, funding acquisition, conceptualization, writing – review & editing.

Conflicts of interest

There are no conflicts to declare.

Acknowledgements

This work was supported by the National Key Research & Development Program of China (Grant No. 2018YFC1802504) and the National Natural Science Foundation of China (32061133002 and 41521001).

References

1. J. Jesus, D. Frascari, T. Pozdniakova and A. S. Danko, J. Hazard. Mater., 2016, 309, 37–52.
2. D. Frascari, G. Zanaroli and A. S. Danko, J. Hazard. Mater., 2015, 283, 382–399.
3. M. Zeppilli, E. Dell'Armi, L. Cristiani, M. P. Papini and M. Majone, Water, 2019, 11, 2579.
4. Z. Xiao, W. Jiang, D. Chen and Y. Xu, Ecotoxicol. Environ. Saf., 2020, 202, 110925.
5. J. Zimmermann, L. J. S. Halloran and D. Hunkeler, Chemosphere, 2020, 244, 125476.
6. A. Trueba-Santiso, D. Fernández-Verdejo, I. Marco-Rius, J. M. Soder-Walz, O. Casabella, T. Vicent and E. Marco-Urrea, Chemosphere, 2020, 240, 124877.
7. M. F. Azizian and L. Semprini, J. Contam. Hydrol., 2016, 190, 58–68.
8. S. Gaza, K. R. Schmidt, P. Weigold, M. Heidinger and A. Tiehm, Water Res., 2019, 151, 343–348.
9. C.-H. Chang, H.-Y. Yang, J.-M. Hung, C.-J. Lu and M.-H. Liu, Int. Biodeterior. Biodegrad., 2017, 117, 150–157.
10. I. Dolinova, M. Strojsova, M. Cernik, J. Nemecek, J. Machackova and A. Sevcu, Environ. Sci. Pollut. Res., 2017, 24, 13262–13283.
11. L. L. Wen, J. X. Chen, J. Y. Fang, A. Li and H. P. Zhao, Front. Microbiol., 2017, 8, 1439.
12. T. E. Mattes, A. K. Alexander and N. V. Coleman, FEMS Microbiol. Rev., 2010, 34, 445–475.
13. N. B. Varzaghani, S. Shokrollahzadeh and A. Farazmand, Korean J. Chem. Eng., 2019, 36, 1305–1312.
14. N. B. Le and N. V. Coleman, Biodegradation, 2011, 22, 1095–1108.
15. F. Aulenta, J. M. Gossett, M. P. Papini, S. Rossetti and M. Majone, Biotechnol. Bioeng., 2005, 91, 743–753.
16. M. F. Azizian, I. P. Marshall, S. Behrens, A. M. Spormann and L. Semprini, J. Contam. Hydrol., 2010, 113, 77–92.
17. F. Aulenta, M. Potalivo, M. Majone, M. P. Papini and V. Tandoi, Biodegradation, 2006, 17, 193–206.
18. I. S. Lee, J. H. Bae and P. L. McCarty, J. Contam. Hydrol., 2007, 94, 76–85.
19. X. Wang, J. Xin, M. Yuan and F. Zhao, Water Res., 2020, 183, 116060.
20. M. N. Goltz, R. K. Gandhi, S. M. Gorelick, G. D. Hopkins, L. H. Smith, B. H. Timmins and P. L. McCarty, Environ. Sci. Technol., 2005, 39, 8963–8970.
21. H. Li, S. Y. Zhang, X. L. Wang, J. Yang, J. D. Gu, R. L. Zhu, P. Wang, K. F. Lin and Y. D. Liu, Environ. Technol., 2015, 36, 667–674.
22. S. Ko, M. Crimi, B. K. Marvin, V. Holmes and S. G. Huling, J. Environ. Manage., 2012, 108, 42–48.
23. J. Ma, H. Liu, C. Zhang, K. Ding, R. Chen and S. Liu, Sci. Total Environ., 2020, 720, 137587.
24. S. Atashgahi, Y. Lu and H. Smidt, Overview of known organohalide-respiring bacteria—phylogenetic diversity and environmental distribution, Springer-Verlag Berlin Heidelberg, 2016.
25. C. H. Chang, H. Y. Yang, S. K. Chen, J. M. Hung, C. J. Lu and M. H. Liu, Int. Biodeterior. Biodegrad., 2018, 132, 251–258.
26. S. T. Lohner, D. Becker, K. M. Mangold and A. Tiehm, Environ. Sci. Technol., 2011, 45, 6491–6497.
27. S. T. Lohner and A. Tiehm, Environ. Sci. Technol., 2009, 43, 7098–7104.
28. S. H. Yuan, Y. Liu, P. Zhang, M. Tong and H. Liu, Sci. China: Technol. Sci., 2021, 64, 251–260.
29. L. Hermon, J. Hellal, J. Denonfoux, S. Vuilleumier, G. Imfeld, C. Urien, S. Ferreira and C. Joulian, Front. Microbiol., 2019, 10, 89.
30. X. Luo, S. Han, X. Fu, X. Li, L. Wang, S. Peng, W. Chen and Q. Huang, Appl. Soil Ecol., 2019, 135, 174–181.
31. J. M. Fung, R. M. Morris, L. Adrian and S. H. Zinder, Appl. Environ. Microbiol., 2007, 73, 4439–4445.
32. H. Li, Q. Zhang, X. L. Wang, X. Y. Ma, K. F. Lin, Y. D. Liu, J. D. Gu, S. G. Lu, L. Shi, Q. Lu and T. T. Shen, Bioresour. Technol., 2012, 124, 129–136.
33. M. Tourna, P. Maclean, L. Condron, M. O'Callaghan and S. A. Wakelin, FEMS Microbiol. Ecol., 2014, 88, 538–549.
34. A. B. Cundy, L. Hopkinson and R. L. Whitby, Sci. Total Environ., 2008, 400, 42–51.
35. M. Tong, S. Yuan, S. Ma, M. Jin, D. Liu, D. Cheng, X. Liu, Y. Gan and Y. Wang, Environ. Sci. Technol., 2015, 50, 214–221.
36. G. W. Luther, Aquat. Geochem., 2009, 16, 395–420.
37. A. Teel, Water Res., 2001, 35, 977–984.
38. X. Wang and M. L. Brusseau, Environ. Toxicol. Chem., 1998, 17, 1689–1694.
39. R. J. Watts and A. L. Teel, J. Environ. Eng., 2005, 131, 612–622.
40. H. Che and W. Lee, Chemosphere, 2011, 82, 1103–1108.
41. B. A. Smith, A. L. Teel and R. J. Watts, Environ. Sci. Technol., 2004, 38, 5465–5469.
42. K. E. Vickstrom, M. F. Azizian and L. Semprini, Chemosphere, 2017, 182, 65–75.
43. J. A. Field and R. Sierra-Alvarez, Rev. Environ. Sci. Bio/Technol., 2004, 3, 185–254.
44. B. Jung and B. Batchelor, J. Hazard. Mater., 2008, 152, 62–70.
45. N. Liu, L. Ding, H. Li, P. Zhang, J. Zheng and C.-H. Weng, Bioresour. Technol., 2018, 261, 133–141.
46. S. H. Liang, J. K. Liu, K. H. Lee, Y. C. Kuo and C. M. Kao, J. Hazard. Mater., 2011, 198, 323–330.
47. L. Yee, A. Hosoyama, S. Ohji, K. Tsuchikane, J. Shimodaira, A. Yamazoe, N. Fujita, C. Suzuki-Minakuchi and H. Nojiri, Genome Announc., 2014, 2, e01048-14.
48. F. Maphosa, S. H. Lieten, I. Dinkla, A. J. Stams, H. Smidt and D. E. Fennell, Front. Microbiol., 2012, 3, 351.
49. P. Pant and S. Pant, J. Environ. Sci., 2010, 22, 116–126.
50. H. D. Duc, Appl. Biol. Chem., 2016, 59, 703–709.
51. K. Kobayashi, K. Katayama-Hirayama and S. Tobita, J. Gen. Appl. Microbiol., 1997, 43, 105–108.
52. A. Olaniran, W. Stafford, D. Cowan, D. Pillay and B. Pillay, J. Microbiol. Biotechnol., 2007, 17, 560–570.
53. F. P. Wilson, X. K. Liu, T. E. Mattes and A. M. Cupples, Environ. Sci. Pollut. Res., 2016, 23, 19062–19070.
54. R. Eugene, F. D. Edward, L. Stephen, S. Erko and T. Fabiano, The Prokaryotes Alphaproteobacteria and Betaproteobacteria, Springer-Verlag Berlin Heidelberg, 4th edn, 2014.
55. Y. S. Lai, A. Ontiveros-Valencia, T. Coskun, C. Zhou and B. E. Rittmann, Biotechnol. Bioeng., 2019, 116, 1439–1448.
56. D. Ma, Z. Hao, R. Sun, M. Bartlam and Y. Wang, Genome Announc., 2016, 4, e01510–01515.
57. Y. M. Chen, T. F. Lin, C. Huang, J. C. Lin and F. M. Hsieh, J. Hazard. Mater., 2007, 148, 660–670.
58. E. Ehsani, C. Dumolin, J. B. A. Arends, F. M. Kerckhof, X. Hu, P. Vandamme and N. Boon, Appl. Microbiol. Biotechnol., 2019, 103, 8241–8253.
59. J. Dou, Y. Huang, H. Ren, Z. Li, Q. Cao, X. Liu and D. Li, Appl. Biochem. Biotechnol., 2019, 187, 338–351.
60. T. G. Volova, E. G. Kiselev, E. I. Shishatskaya, N. O. Zhila, A. N. Boyandin, D. A. Syrvacheva, O. N. Vinogradova, G. S. Kalacheva, A. D. Vasiliev and I. V. Peterson, Bioresour. Technol., 2013, 146, 215–222.
61. S. Atashgahi, F. Maphosa, E. Dogan, H. Smidt, D. Springael and W. Dejonghe, FEMS Microbiol. Ecol., 2013, 84, 133–142.
62. S. Atashgahi, Y. Lu, J. Ramiro-Garcia, P. Peng, F. Maphosa, D. Sipkema, W. Dejonghe, H. Smidt and D. Springael, Environ. Sci. Technol., 2017, 51, 1626–1634.
63. B. K. Amos, K. M. Ritalahti, C. Cruz-Garcia, E. Padilla-Crespo and F. E. Loffler, Environ. Sci. Technol., 2008, 42, 5718–5726.
64. S. Ma, M. Tong, S. Yuan and H. Liu, ACS Earth Space Chem., 2019, 3, 738–747.
65. R. Chen, H. Liu, P. Zhang, L. Zhao, K. Ding and S. Yuan, Sci. Total Environ., 2019, 694, 133660.

---

Footnote

† Electronic supplementary information (ESI) available. See https://doi.org/10.1039/d2ra04185e

---