Hydrolyzed tilapia fish collagen modulates the biological behavior of macrophages under inflammatory conditions

Abstract

Implantation of a biomaterial causes an early and local inflammatory reaction, and regulation of the biological behavior of macrophages under inflammatory conditions caused by biomaterials is imperative for the full realization of their function after being implanted. In recent years, hydrolyzed fish collagen has attracted extensive attention resulting from its biological activity. However, to date, no studies have investigated the anti-inflammatory activity of hydrolyzed fish collagen. The aim of this study is to evaluate the effect of hydrolyzed tilapia fish collagen (HFC) on lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages at the gene and protein level and to elucidate its potential mechanism. The results show that glycine rich in HFC can activate the glycine receptor (GlyR) of macrophages, leading to decreased calcium concentration in macrophages, this decrease inhibits the activation of NF-κB, and then the inhibition of NF-κB further attenuates the inflammatory cytokine gene expression and protein secretion. The current study reveals for the first time that by regulating the biological behavior of the macrophages under an inflammatory state, HFC exhibits specific anti-inflammatory effects. More importantly, the presence of GlyR in RAW264.7 cells is verified for the first time. These findings provide a scientific basis for the future application of HFC in anti-inflammatory biomaterials.

---

1. Introduction

Inflammation is a major problem faced by clinically implanted biomaterials. Excessive inflammation can negatively affect the function of the biomaterial and even lead to implant failure. Macrophages play an important role in inflammation and determine the degree of inflammation. Therefore, regulating the biological behavior of macrophages in an inflammatory state has important significance. Mammalian collagen has been shown to regulate the release of inflammatory cytokines in activated macrophages.¹ However, animal-derived collagen carries the potential risk of transmitting infectious diseases to humans,^2,3 has some immunogenicity,⁴ and is expensive to extract. Currently, hydrolyzed fish collagen is drawing increased attention due to its biological activity and safety. In 2010, Ohara et al. found that oral administration of collagen hydrolysates derived from fish scales can promote the synthesis of proteoglycans in guinea pig tibial epiphysis, and therefore it has a demonstrated therapeutic potential for the treatment of osteoarthritis.⁵ In addition, it has been documented that hippocampus-derived peptides can inhibit TPA-induced COX-2 and iNOS in human chondrocytes (SW-1353) and osteoblasts (MG-63).⁶ However, it is still unclear whether the hydrolyzed fish collagen could modulate the biological behavior of the macrophage during the inflammatory process.

It is well known that surgically implanted biomaterials could cause a local inflammatory response at an early stage. Macrophages under inflammatory circumstances will release substantial amounts of NO, TNF-α and other inflammatory factors, which could interfere with wound healing and negatively influence the implant–host interaction. Recent reports have found that the oral administration of collagen could reduce the production of NO and TNF-α in rat synoviocytes and that treatment with collagen hydrolysates could reduce the NO production in the blood of diabetic patients with chronic inflammation.^7,8 The precise mechanisms have not been clearly demonstrated. However, it is reasonable to infer that the anti-inflammatory activity of collagen hydrolysates is likely related to its amino acid composition. Our previous study found that hydrolyzed tilapia fish collagen (HFC) is rich in amino acids, and we have demonstrated that HFC as a novel potential biomaterial exhibited excellent biological activity, which can promote osteogenic and endothelial differentiation of bone marrow mesenchymal stem cells.⁹ However, to date, no studies have investigated the anti-inflammatory activity of HFC. The aim of this study was to evaluate the effect of HFC on lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages and its potential mechanism.

In the current study, the molecular weight and amino acid composition of HFC were measured. The impacts of HFC on the secretion of NO and TNF-α in RAW264.7 cells were investigated using the lipopolysaccharide (LPS)-stimulated mouse macrophage (RAW264.7 cells) model of inflammation. In addition, the inhibitory effect on the inflammation-related genes iNOS (inducible nitric oxide synthase), TNF-α, COX-2 and IL-1β was studied. To further explain this anti-inflammatory phenomenon, the existence of glycine receptors in the macrophages was verified using laser scanning confocal microscope and western blot analysis. The intracellular calcium concentration changes in RAW264.7 cells were analyzed using flow cytometry. Moreover, the protein expression levels of NF-κB and iNOS were measured to determine whether HFC inhibits inflammation via NF-κB pathways. In summary, we attempted to reveal the regulatory mechanisms and molecular pathways of the anti-inflammatory effects of HFC at the gene and protein levels and to provide a scientific basis for HFC as a biological material with anti-inflammatory activity.

2. Experimental

2.1 Reagents

Dulbecco's modified Eagle's medium (DMEM), lipopolysaccharide (LPS), fluo-3/AM, strychnine and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Griess reagent was purchased from the Beyotime Institute of Biotechnology (Nanjing, China). TNF-α ELISA kit was purchased from Excell (Shanghai, China). Antibodies against GlyR α1α2, iNOS, β-actin and HRP-conjugated rabbit/goat/mouse IgG antibody were obtained from Abcam (Abcam, Cambridge, UK). Antibodies against GlyR β, P65 and lamin-B were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

2.2 Preparation of HFC

The HFC used in this study was supplied by the Shanghai Fisheries Research Institute (Shanghai, China). This HFC was extracted from tilapia scales. The preparation method of the hydrolyzed tilapia fish collagen was in compliance with the relevant laws and institutional guidelines, and all experimental protocols were approved by the Animal Care and Experiment Committee of Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine. Briefly, after cleaning, the fish scales were treated with a 30% HCl solution for 3 hours and then washed with distilled water. After being preheated to 60 °C for 3 hours in deionized water, the material was enzymatically hydrolyzed by 0.1–0.3% complex protease at 60 °C for 6 hours. After being filtered and dried, the HFC powder used in the following investigations was obtained. A stock solution of the HFC was prepared by dissolving the hydrolyzed tilapia fish collagen in DMEM, and then 2, 0.2, 0.02 and 0.002 mg mL⁻¹ HFC were prepared by diluting the stock solution with DMEM.

2.3 Characterization of HFC

2.3.1 Molecular weight distribution of HFC. The molecular weight distribution of HFC was analyzed by AXIMA Performance MALDI-TOF/TOFMS (Shimadzu Biotech, Manchester, UK). The matrix used for the experiments was α-cyano-4-hydroxycinnamic acid (CHCA) obtained from Sigma-Aldrich (USA). HFC samples (1 mg mL⁻¹) were dissolved in water, 1 μL samples were mixed with 1 μL matrix solution, the mixture was hand-spotted onto the MALDI sample plate and air-dried at room temperature and then analyzed.

2.3.2 Amino acid composition of HFC. A 2 mg aliquot of HFC sample were placed in a hydrolyzing tube containing 4 mL of 6 M HCl. The tube was filled with nitrogen gas for 6 min. After gas evacuation, the tube was sealed, and the HFC was hydrolyzed for 24 h at 110 °C. The hydrolysate was analyzed with a Hitachi L-8900 High Speed Amino Acid Analyzer (Tokyo, Japan). Amino acids were determined by measurement of absorbance at 570 nm except for proline and hydroxyproline, for which absorbance at 440 nm was measured. The amino acid content was expressed by the number of residues/1000 residues.

2.4 Cell culture and measurement of cell viability

The murine macrophage cell line RAW264.7 was obtained from the Cell Bank of the Chinese Academic of Sciences (Shanghai, China) and was cultured in DMEM medium supplemented with 10% fetal bovine serum (Invitrogen, California, USA), penicillin (100 IU mL⁻¹) and streptomycin (100 μg mL⁻¹) in a humidified incubator containing 5% CO₂ at 37 °C. The cell viability was assessed using an MTT assay. Briefly, RAW264.7 cells (1 × 10⁴ per well) were seeded into 96-well plates overnight. The cells were pretreated with indicated concentrations of HFC (2 mg mL⁻¹, 0.2 mg mL⁻¹, 0.02 mg mL⁻¹ and 0.002 mg mL⁻¹) for 2 hours prior to stimulation with or without LPS (1 μg mL⁻¹) for 24 hours. Next, MTT solution (20 μL, 5 mg mL⁻¹) was added to each well. After 4 hours of incubation, the supernatant was removed and dimethyl sulfoxide (DMSO, Sigma, 150 μL) was used to dissolve the formazan crystals. The optical density at 570 nm and 630 nm was measured using a microplate reader (Labsystems Dragon Wellscan MK3, Finland). The optical density was used to evaluate the cell viability, and the values are expressed relative to the untreated control group.

2.5 Nitric oxide (NO) determination

Cells were seeded in 24-well plates at a density of 1 × 10⁵ cells per well, incubated overnight, and pretreated with or without the indicated concentrations of HFC for 2 hours, followed by treatment with or without LPS (1 μg mL⁻¹) for an additional 24 hours. In the strychnine group, strychnine (1 μM) was added 3 minutes before 0.02 mg mL⁻¹ HFC. NO production was determined by measuring the accumulation of nitrite in the culture supernatants using a commercially available kit based on the Griess reaction (Beyotime, Nanjing, China). Briefly, culture medium (100 μL) was mixed with Griess reagent (100 μL, 1% sulfanilamide and 0.1% naphthylethylene diamine dihydrochloride in 2.5% phosphoric acid), the mixture was incubated at room temperature for 10 minutes, and the absorbance at 540 nm was measured using a microplate reader. Fresh culture medium was used as a blank. The NO concentration was calculated using a standard curve prepared with sodium nitrite.

2.6 Measurement of TNF-α production in RAW264.7 cell

RAW264.7 cells were plated at a density of 1 × 10⁵ cells per well in a 24-well plate, then they were treated in the same way as in NO determination section. Cell-free supernatants were collected, and the concentrations of TNF-α in the culture media were measured using an enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer's instructions.

2.7 Quantitative real-time polymerase chain reaction (qRT-PCR)

RAW264.7 cells were seeded at a density of 5 × 10⁵ cells per well in a 6-well plate, after being treated in the same way as in NO determination section, the total RNA from the cells was extracted by Trizol reagent (Invitrogen, USA) according to the manufacturer's protocol. The concentration and integrity of RNA were determined by measuring the absorbance at 260 and 280 nm and then calculating the 260/280 nm ratio. Total RNA (1 μg) was reverse-transcribed to cDNA using the PrimeScript 1st Strand cDNA Synthesis kit (TaKaRa, Japan) in a total volume of 10 μL. Real-time PCR was performed in a Bio-Rad sequence detection system (My iQ2, USA) with a real-time PCR kit (SYBR Premix EX Taq, TaKaRa). The primer sequences are shown in Table 1. For PCR, SYBR Green (10 μL) was added to the primers and cDNA (1 μL) in a total volume of 20 μL. GAPDH was utilized as a housekeeping gene as indicated. All of the samples were analyzed in triplicate. The qRT-PCR data were analyzed using the comparative threshold cycle (ΔΔC_t) method and normalized to the GAPDH values.

Table 1 Primers Used for qRT-PCR

Target gene	Forward primer sequence (5′–3′)	Reverse primer sequence (5′–3′)
iNOS	CAAGCTGAACTTGAGCGAGGA	TTTACTCAGTGCCAGAAGCTGGA
TNF-α	TTGACCTCAGCGCTGAGTTG	CCTGTAGCCCACGTCGTAGC
COX-2	CTGGAACATGGACTCACTCAGTTTG	AGGCCTTTGCCACTGCTTGTA
IL-1β	GAAGCTGTGGCAGCTACCTATGTCT	CTCTGCTTGTGAGGTGCTGATGTAC
GAPDH	AGGTGAAGGTCGGAGTCAACG	CCTGGAAGATGGTGATGGGAT

---

2.8 Measurement of intracellular calcium by flow cytometry

The intracellular calcium concentration was monitored by the calcium sensitive dye fluo-3/AM as reported previously.¹⁰ Briefly, RAW264.7 cells were plated at a density of 1 × 10⁵ cells per well in a 24-well plate, and then the cells were treated in the same way as in NO determination section. At the end of the incubation period, the cells were washed three times with PBS, removed from the plates using 0.25% trypsin and placed into test tubes. The cells were washed with PBS three times before the fluorescent labeling was performed by a 40 minutes incubation period with PBS-diluted fluo-3/AM (5 μmol L⁻¹ final concentration). The incubation was performed in standard conditions (37 °C, 5% humidified CO₂), in a dark room, and with 3 brief vibrations every 10 minutes. After labeling, the cells were centrifuged for 5 minutes at 1000 rpm, washed, re-suspended in PBS (300 μL), and immediately analyzed using flow cytometry at an excitation wavelength of 488 nm and an emission wavelength of 525 nm for fluo-3/AM. The mean fluorescence intensity of fluo-3/AM was used as a measure of the intracellular calcium concentration, and the data were analyzed using WinMDI2.8 software.

2.9 Immunocytochemistry

RAW264.7 cells were grown on glass coverslips. After washing with phosphate-buffered saline solution (PBS) three times, the cells were fixed with 4% paraformaldehyde for 20 minutes at room temperature. After further washing, the cells were blocked with 1% BSA for 30 minutes at room temperature. Then, the cells were incubated with the primary antibodies, anti-GLYα1α2 subunit antibody (diluted 1 : 500) or anti-GLYβ subunit antibody (diluted 1 : 100) at 4 °C overnight. The cells were then washed with PBS followed by incubation with the secondary antibody, FITC-conjugated goat anti-rabbit IgG, for 1 h at 37 °C. Slides were washed with PBS three times and double stained with DAPI (50 μg mL⁻¹) at room temperature for another 1 minute. The labeled RAW264.7 cells were examined using a confocal laser scanning microscope (Nikon A1R, Japan).

2.10 Electrophoretic mobility shift assay (EMSA)

The activation of NF-κB was assessed by gel mobility shift assays using nuclear extracts. In our current study, RAW264.7 cells were plated at a density of 5 × 10⁵ cells per well in a 6-well plate, then the cells were treated in the same way as in NO determination section. At the end of the incubation period, the cells were harvested and the nuclear extracts were prepared as described by the instructions for Nuclear and Cytoplasmic Extraction Reagents (Pierce, Rockford, USA). The protein concentration of the extracts was determined using the BCA protein assay. An amount of 10 μg of nuclear protein was incubated in binding buffer containing 50 ng μL⁻¹ poly(dI·dC), 2.5% glycerol, 0.05% NP-40, MgCl₂(5 mM) and biotin end-labeled oligonucleotides (20 fmol) at room temperature for 20 minutes. The labeled oligonucleotides of NF-κB had the following sequences: 5′-AGT TGA GGG GAC TTT CCC AGG C-3′ and 5′-GCC TGG GAA AGT CCC CTC AAC T-3′. The binding specificity was examined by competition with unlabeled oligonucleotide. For competition experiments, a 1000-fold excess of cold oligonucleotide was used. For the supershift assay, the nuclear protein of RAW264.7 cells exposed to LPS alone was incubated with anti-P65 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for 30 minutes at room temperature before the addition of oligonucleotides. Protein–DNA complexes were separated from free DNA probes by electrophoresis through 4% native polyacrylamide gels. The gels were dried, and then the protein–DNA complexes were visualized using the ECL chemiluminescence system.

2.11 Western blot analysis

Western blots were performed to investigate the glycine receptor of RAW264.7 cells and the effect of HFC on the protein levels of NF-κB and iNOS. For the glycine receptor of RAW264.7 cells, the total cellular protein of untreated RAW264.7 cells was extracted. To study the effect of HFC on the protein levels of NF-κB and iNOS, the cells (1 × 10⁶ mL⁻¹) were seeded in tissue plates and then they were treated in the same way as in NO determination section. After the incubation period, the nuclear and cytoplasmic proteins were prepared according to the protocol of the Nuclear and Cytoplasmic Extraction Reagents (Pierce, Rockford, USA). The protein concentrations of these extracts were determined by performing a bicinchoninic acid (BCA) protein assay (Pierce, Rockford, USA). Equal amounts of the lysate proteins (40 μg) were mixed in loading buffer and boiled for 5 minutes. The proteins were separated on 12% SDS-polyacrylamide gels and electrophoretically transferred to nitrocellulose (NC) membranes (Amersham Biosciences, US). After blocking with 5% nonfat milk in Tris-buffered saline (TBS) containing 0.05% Tween-20 (TBST) for 1 h at room temperature, the membrane was incubated with anti-glycine receptor α1α2 (1 : 1000, rabbit polyclonal antibody, Abcam), β (1 : 200, mouse monoclonal antibody, Santa Cruz Biotechnology), P65 (1 : 1000, rabbit polyclonal antibody, Santa Cruz), iNOS (1 : 1000, rabbit polyclonal antibody, Abcam), lamin-B (1 : 1000, goat polyclonal antibody, Santa Cruz Biotechnology), and β-actin (1 : 1000, mouse monoclonal antibody, Abcam) at 4 °C overnight. The membrane was washed with TBST and incubated with a horseradish peroxidase-conjugated anti-rabbit/goat/mouse IgG secondary antibody at 37 °C for 1 hour. The antibody-bound proteins were detected using the ECL chemiluminescence reagent (Millipore, USA). The relative amounts of various proteins were analyzed. The results were quantified by Quantity One Software, and data were normalized to β-actin.

2.12 Data analysis

At least 3 biological replicates were performed in all of the experiments. The data are expressed as the mean ± standard deviation. For all of the experiments, P-values less than 0.05 were considered to be statistically significant. Statistically significant differences (P < 0.05) among the various groups were evaluated using one-way ANOVA. All of the statistical analyses were performed using SPSS 11.0 software.

3. Results and discussion

After implantation of biomaterials, excessive inflammation can have an adverse effect on the stability and longevity of the biomaterials. The current approach to inhibit inflammation mainly relies on the clinical application of steroidal and non-steroidal anti-inflammatory drugs. Typically, however, this approach produces various side effects. This problem can be effectively solved if the biomaterial itself or its added ingredients possess a certain anti-inflammatory effect. For the first time, we found that HFC has prominent anti-inflammatory effects on the LPS-stimulated macrophages, and we also revealed that glycine receptors (GlyR) on the RAW264.7 cells play a key role in the process of anti-inflammation.

The molecular weight of HFC ranged from 700 to 1300 Da (Fig. 1), it has been reported that small molecular weight peptides may expose more active sites to allow for the regulation of the growth of cells. The amino acid composition of HFC is shown in Table 2, glycine (Gly) was the most abundant amino acid and was present in HFC at a rate of 333/1000 residues, and proline (Pro) and hydroxyproline (Hyp) residues were present at rates of 117/1000 and 119/1000, respectively.

Fig. 1 The molecular weight distribution of hydrolyzed tilapia fish collagen.

Table 2 The amino acid composition of hydrolyzed tilapia fish collagen

Amino acid	Hydrolyzed fish collagen residues/1000
Gly	333
Ala	128
Hyp	119
Pro	117
Glu	67
Arg	51
Asp	40
Ser	32
Lys	26
Thr	23
Leu	22
Val	17
Phe	12
Ile	10
His	3
Total	1000

---

The RAW264.7 murine macrophage cell line was chosen for this study because it has been demonstrated that macrophages are the first cell type found on newly implanted biomaterials and that macrophages play a pivotal role in the process of inflammatory response or foreign body reaction.^11,12 The activated macrophages release inflammatory mediators and affect the function of other types of inflammatory cells in the inflammatory environment.^13,14 In the present study, the cytotoxic effects of HFC were evaluated using an MTT assay. As shown in Fig. 2, HFC did not affect the viability of RAW264.7 macrophages at a concentration of 2 mg mL⁻¹ to 0.002 mg mL⁻¹ in the presence or absence of LPS. Therefore, a concentration of 2 mg mL⁻¹ to 0.002 mg mL⁻¹ of HFC was used in the following experiments. To assess the effects of HFC on LPS-induced NO and TNF-α production in macrophages, the levels of NO and TNF-α, the two key mediators of inflammation, were measured after exposure to LPS (1 μg mL⁻¹) for 24 h. As revealed in Fig. 3, NO and TNF-α production was remarkably induced in LPS-stimulated RAW264.7 macrophages compared with un-stimulated control group. NO has been established as an important inflammatory factor, under normal conditions, the NO levels were low. However when inflammation occurred, the synthesis and release of NO increased in the macrophages. TNF-α is primarily produced by activated macrophages. It is a potent chemoattractant for neutrophils, helpingneutrophils migrate, and it stimulates adhesion molecules and chemokines.^15,16 In this study, after pretreatment with the indicated concentrations of HFC, we surprisingly found that excessive secretion of NO (Fig. 3A) and TNF-α (Fig. 3B) was significantly blocked. In particular, 0.02 mg mL⁻¹ HFC reversed the LPS-induced cytokine production with a maximum inhibitory effect. The preliminary results indicated that HFC has an anti-inflammatory effect.

Fig. 2 Effects of HFC on cell viability in RAW264.7 cells was assayed by MTT. Values are mean ± standard deviation. Control group is treated without HFC.

Fig. 3 Effects of HFC on LPS-induced NO (A) and TNF-α (B) production in RAW264.7 cells. Values are mean ± standard deviation.* P < 0.05 compared with control group. # P < 0.05 compared with LPS alone group. Control group is treated with only cell culture medium without LPS or HFC treatment.

Based on the above findings, we investigated whether HFC was able to regulate cytokine production at the transcription level. The mRNA levels of iNOS and TNF-α were significantly up-regulated in response to LPS, and HFC markedly inhibited the expression of these genes (Fig. 4A and B). iNOS is the rate-limiting enzyme of the synthesis of NO, and changes in the iNOS gene level will directly regulate NO production. Our results exhibited that iNOS and TNF-α mRNA expression levels correlated well with their corresponding cytokine production (NO and TNF-α) as shown in Fig. 3, suggesting that HFC prevented the production of NO and TNF-α by suppressing their gene expression in LPS-stimulated cells. In addition, the effect of HFC on the expression of COX-2 and IL-1β genes was also studied. COX-2, an important indicator that reflects the severity of the inflammation, is unexpressed under normal conditions in most cells. However elevated levels are found during inflammation.^17,18 IL-1β is an early major pro-inflammatory cytokine that is mainly synthesized by macrophages. It mediates both acute and chronic inflammation by triggering a cascade of inflammatory mediators and influences the degree and progression of inflammation.^19,20 The qRT-PCR analysis revealed that LPS treatment triggered a substantial increase in the expression of COX-2 and IL-1β compared with that in the untreated group, however pretreatment of the cells with HFC reduced the expression of these genes compared with that in the LPS alone group (Fig. 4C and D). Similar to the results observed for cytokine production, LPS-induced inflammatory gene expression was maximally down-regulated at the dose of 0.02 mg mL⁻¹ HFC, however, the exact mechanisms need further elucidation. Altogether, these data suggested that HFC could not only reduce the expression of iNOS and TNF-α, but could also significantly inhibit the expression of COX-2 and IL-1β, which provides supporting evidence that HFC could modulate the behavior of macrophages under an inflammatory state at the transcriptional level.

Fig. 4 Effects of HFC on LPS-induced iNOS (A), TNF-α (B), COX-2 (C) and IL-1β (D) mRNA expression in RAW264.7 cells. Values are mean ± standard deviation. * P < 0.05 compared with control group. # P < 0.05 compared with LPS alone group. Control group is treated with only cell culture medium without LPS or HFC treatment.

Next, we attempted to explore the anti-inflammatory mechanism of HFC. As shown in Table 2, HFC is rich in amino acids, with glycine accounting for nearly 1/3 (33.3%). In 2010, Hasegawa et al. found that exogenous glycine exhibited anti-inflammatory effects in THP-1 cells,²¹ and it has been shown that the GlyR could mediate the anti-inflammatory activity of glycine.^22,23 Glycine receptors are pentameric proteins belonging to the cysteine loop family of ligand-gated ion channels,^24,25 activation of the glycine receptor triggers the influx of chloride ions that hyperpolarize the cell membrane, which prevents increase in intracellular calcium concentration via voltage dependent channels and the subsequent production of inflammatory cytokines.^26,27 In light of the above mentioned facts, we hypothesized that the anti-inflammatory effects of HFC were related to its glycine. Although several earlier results have demonstrated the existence of glycine receptors in a wide variety of cells,^28–31 there has been no direct visual evidence for the existence of GlyR in RAW264.7 cells to date. In the present study, to detect the presence of GlyR in RAW264.7 cells, immunocytochemistry and western blot analysis were performed, as depicted in Fig. 5A and B, by reacting with the specific antibodies, the glycine receptor α1α2 and β subunit-immunoreactive spots were visually observed on the cells, which was verified by the protein expression of α1α2 and β subunits in western blot analysis. These findings illustrated the presence of a glycine receptor in RAW264.7 cells, which provided the structural basis for exploring more functions of RAW264.7 cells.

Fig. 5 The expression of glycine receptor α1α2 (A) and β (B) subunit were detected by immunofluorescence assay and western blot analysis, respectively. The nucleus was stained with DAPI, and the glycine receptor subunits were stained with a specific antibody against the subunit with the secondary conjugated to FITC. Western blot analysis was performed as described in the Experimental section. “overlay” represent the merged images of α1α2/β and nuclei. Scale bar represents 20 μm. DIC: differential interference contrast.

A rise in intracellular calcium has been proposed as an essential trigger for an inflammatory reaction,^32–34 and it has been previously reported that the glycine could inhibit the elevation of intracellular calcium by activating the glycine receptor.^35,36 To study whether the glycine in HFC could activate the glycine receptor to influence the intracellular calcium concentration and subsequently mediate the anti-inflammatory activity of HFC, flow cytometry was used to explore the change of the intracellular calcium ion concentration. Based on the results of cytokine production and mRNA levels, 0.02 mg mL⁻¹ HFC was selected for the following experiments. HFC alone had no measurable effect on intracellular calcium concentrations (Fig. 6B and I), when stimulated with LPS, the intracellular calcium concentration in cells significantly increased (Fig. 6E–I), which was markedly inhibited by HFC (Fig. 6F and I). The results were consistent with the preceding findings that HFC inhibited the increased inflammatory cytokines, which suggested that HFC played an anti-inflammatory role by inhibiting the intracellular calcium concentration. To verify that this effect is mediated by glycine receptors, strychnine was used, which is a alkaloid from the Indian tree Strychnos nux vomica and is a well-known specific antagonist of the glycine receptor, strychnine has been widely used to research the interaction of glycine and glycine receptor, it is also used to verify the existence of glycine receptor. Wang et al. found that glycine inhibit the elevation of cytosolic calcium concentrations through actions on glycine receptor, while strychnine reversed the inhibitory effect of glycine.³⁵ Similar findings were also made in other literatures, Spittler et al. found that the inhibitory effects of glycine on TNF-a and IL-1β were neutralized by strychnine in human monocytes.³⁷ In the present study, strychnine alone had no effect on intracellular calcium concentration levels in the absence of LPS compared with control (Fig. 6C and I), and the increased intracellular calcium concentration due to LPS was not affected by strychnine alone either (Fig. 6G and I), while the inhibitory action of glycine on the LPS-evoked increase in intracellular calcium concentration was reversed by strychnine (Fig. 6H and I). The effects of strychnine on intracellular calcium concentration of macrophages providing further evidence for the existence of the glycine receptor, and these results confirmed our hypothesis that the glycine contained in HFC reduced the intracellular calcium concentration by activating the GlyR on the macrophages.

Fig. 6 Effect of HFC on LPS-induced increases of intracellular calcium concentration in RAW264.7 cells. The results were expressed as the original fluorescent graphs (A–H) and mean fluorescent density (I). (A) Control; (B) HFC alone; (C) strychnine alone; (D) HFC and strychnine; (E) LPS alone; (F) LPS and HFC; (G) LPS and strychnine; (H) LPS and HFC and strychnine. Data are presented as mean ± standard deviation of three independent experiments. * P < 0.05 compared with control group. # P < 0.05 compared with LPS alone group. Control group is treated with only culture medium without LPS and HFC treatment.

Numerous studies have shown that cytosolic calcium ions are involved in the activation of NF-κB.^38–40 NF-κB is an essential transcriptional factor that regulates the expression of genes responsible for inflammation. In unstimulated cells, NF-κB is inactive and located in the cytoplasm. During the process of inflammation, NF-κB translocates to the nucleus, where it binds to κB-binding sites in the promoter regions of target genes and regulates the expression of various inflammation-related genes.⁴¹ In this study, EMSA was performed to determine whether HFC regulates the LPS-induced specific DNA-binding activity of NF-κB by influencing the calcium concentration. The results exhibited that the induction of specific NF-κB binding activity by LPS was considerably inhibited in the presence of HFC. However, strychnine eliminated this inhibition (Fig. 7). This result suggested that HFC suppressed the activation of NF-κB by inhibiting the calcium concentration.

Fig. 7 Effect of HFC on LPS-induced NF-κB–DNA binding activity in RAW264.7 macrophages. The arrow indicates the position of NF-κB–DNA binding. The detection of band supershift and specificity of NF-κB activation were measured with P65 antibodies, unlabeled oligo-, mutated NF-κB oligonucleotides. Control group is treated with only cell culture medium without LPS or HFC treatment. S: strychnine HFC: 0.02 mg mL⁻¹ hydrolyzed tilapia fish collagen.

To determine whether HFC attenuated the NF-κB binding activity by inhibiting the nucleus translocation of NF-κB, the protein expression levels of P65, a major component of NF-κB, were analyzed using western blotting. As shown in Fig. 8A, B and D, the expression of P65 was decreased in the cytoplasm and increased in nucleus after treated with LPS alone. However, treatment with HFC inhibited the P65 levels in the nucleus compared with the LPS-treated group (Fig. 8A and D). These results indicated that HFC results in the reduction of NF-κB activity in LPS-stimulated cells by suppressing the nuclear translocation. Since it is well known that the expression of iNOS is controlled by NF-κB,⁴² we further investigated the effect of HFC on iNOS expression. The results showed that HFC can significantly reduce LPS-stimulated iNOS expression (Fig. 8A and C), furthermore, decreased iNOS synthesis caused the inhibition of NO and TNF-α in macrophages at the gene and protein level (Fig. 9A–D). By contrast, strychnine reversed the effects of HFC (Fig. 8 and 9). Moreover, as shown in Fig. 9, in accordance with the intracellular calcium concentration results, HFC or strychnine alone had no effect on the inflammatory cytokine gene expression (iNOS and TNF-α gene) and the cytokine secretion (NO and TNF-α) in the absence of LPS compared with control, strychnine per se did not alter the LPS-induced response in RAW264.7 cells either, which is consistent with other researchers'findings.⁴³

Fig. 8 Effects of HFC on LPS-induced NF-κB translocation and on the profile of iNOS proteins. (A) Representative images of western blot analysis for cytoplasm P65, iNOS, and nuclear P65 protein (B–D) densitometric analysis of cytoplasm P65, iNOS, and nuclear P65 protein expression, respectively. Data are presented as mean ± standard deviation of three independent experiments. * P < 0.05 compared with control group. # P < 0.05 compared with LPS alone group. Control group is treated with only culture medium without LPS and HFC treatment. Cyto P65: cytoplasm P65.

Fig. 9 Effects of strychnine on HFC inhibition of increases in iNOS, TNF-α at the gene and protein levels. Values are mean ± standard deviation. * P < 0.05 compared with control group. # P < 0.05 compared with LPS alone group. Control group is treated with only cell culture medium without LPS and HFC treatment.

These results have clearly demonstrated that GlyR and NF-κB are responsible for mediating the anti-inflammatory action of HFC. Previous research has shown that the activation of GlyR by glycine leads to the reduction of intracellular calcium concentration in Kupffer cells,⁴⁴ in another study, glycine diminish the IL-6 and TNF-α gene expression, and the authors argue that glycine action is exerted through the glycine receptors.⁴⁵ Our results are supported by these studies, and the hypothesis that GlyR involved in the anti-inflammatory process of HFC has been corroborated. In addition, Fig. 3 and 4 showed that 0.002 mg mL⁻¹ HFC did not inhibit the secretion of inflammatory cytokines and the inflammatory gene expression, it might be because the concentration of HFC is too low, therefore the concentration of glycine is too low to activate the glycine receptor effectively, which leads to fail of inhibiting the production of inflammatory cytokines.

4. Conclusions

In summary, the study described for the first time that HFC exhibited an anti-inflammatory effect by modulating the biological behavior of macrophages. This effect was related to the glycine contained in HFC, which activated the GlyR in macrophages, resulting in the reduction of the calcium concentration, this concentration decrease caused the suppression of the NF-κB activity, which leading to the down regulation of the inflammation-related genes and further the inhibition of their protein production (Fig. 10). It has been first found that GlyR existed in RAW264.7 macrophages, which played a key role in the anti-inflammatory function of HFC. These results suggest the new potential for the future biomedical application of HFC.

Fig. 10 Mechanism involved in the anti-inflammatory activity of HFC. The glycine contained in HFC activated the GlyR in macrophage, resulting in the reduction of calcium concentration in macrophages, this concentration decrease suppressed the NF-κB activity, which causing the inhibition of the inflammation-related genes expression, and further the inhibition of the protein secretion of these inflammatory mediators, eventually revealed remarkable anti-inflammatory activities.

Acknowledgements

The authors are grateful to Qisheng Gu at the Institute of Shanghai Qisheng Biomaterial Technology for technical advice and Nanping Wang at the Shanghai Fisheries Research Institute for providing the hydrolyzed tilapia fish collagen. This work was supported by grants from the National Natural Science Foundation of China (31470917).

References

1. J. Kajahn, S. Franz, E. Rueckert, I. Forstreuter, V. Hintze, S. Moeller and J. C. Simon, Biomatter., 2012, 2, 226–236.
2. F. I. Broekema, W. van Oeveren, M. H. Selten, R. J. Meijer, J. T. de Wolf and R. R. Bos, Clin. Oral Investig., 2013, 17, 1273–1278.
3. N. Nagai, K. Mori, Y. Satoh, N. Takahashi, S. Yunoki, K. Tajima and M. Munekata, J. Biomed. Mater. Res., Part A, 2007, 82, 395–402.
4. A. K. Lynn, I. V. Yannas and W. Bonfield, Antigenicity and immunogenicity of collagen, J. Biomed. Mater. Res., Part B, 2004, 71, 343–354.
5. H. Ohara, H. Iida, K. Ito, Y. Takeuchi and Y. Nomura, Biosci., Biotechnol., Biochem., 2010, 74, 2096–2099.
6. B. Ryu, Z. J. Qian and S. K. Kim, Peptides, 2010, 31, 79–87.
7. C. H. Ding, Q. Li, Z. Y. Xiong, A. W. Zhou, G. Jones and S. Y. Xu, Clin. Exp. Immunol., 2003, 132, 416–423.
8. C. F. Zhu, G. Z. Li, H. B. Peng, F. Zhang, Y. Chen and Y. Li, Appl. Physiol., Nutr., Metab., 2010, 35, 797–804.
9. C. Liu and J. Sun, Biomacromolecules, 2014, 15, 436–443.
10. Y. Xu, G. Li, B. Du, P. Zhang, L. Xiao, P. Sirois and K. Li, Regul. Pept., 2011, 172, 58–61.
11. A. K. McNally and J. M. Anderson, Adv. Exp. Med. Biol., 2011, 713, 97–111.
12. E. Saino, M. L. Focarete, C. Gualandi, E. Emanuele, A. I. Cornaglia, M. Imbriani and L. Visai, Biomacromolecules, 2011, 12, 1900–1911.
13. S. Chen, J. A. Jones, Y. Xu, H. Y. Low, J. M. Anderson and K. W. Leong, Biomaterials, 2010, 31, 3479–3491.
14. F. O. Martinez, L. Helming and S. Gordon, Annu. Rev. Immunol., 2009, 27, 451–483.
15. J. R. Bradley, J. Pathol., 2008, 214, 149–160.
16. C. Sclavons, C. Burtea, S. Boutry, S. Laurent, E. L. Vander and R. N. Muller, Int. J. Pept., 2013, 2013, 348409.
17. D. Wang and R. N. Dubois, Oncogene, 2010, 29, 781–788.
18. M. Amaravani, N. K. Prasad and V. Ramakrishna, SpringerPlus, 2012, 1, 58.
19. C. A. Dinarello, Eur. J. Immunol., 2010, 40, 599–606.
20. J. M. Anderson and A. K. McNally, Semin. Immunopathol., 2011, 33, 221–233.
21. S. Hasegawa, T. Ichiyama, I. Sonaka, A. Ohsaki, R. Hirano, Y. Haneda, R. Fukano, M. Hara and S. Furukawa, Inflammation Res., 2011, 60, 1013–1019.
22. M. D. Wheeler, K. Ikejema, N. Enomoto, R. F. Stacklewitz, V. Seabra, Z. Zhong, M. Yin, P. Schemmer, M. L. Rose, I. Rusyn, B. Bradford and R. G. Thurman, Cell. Mol. Life Sci., 1999, 56, 843–856.
23. M. Wheeler, R. F. Stachlewitz, S. Yamashina, K. Ikejima, A. L. Morrow and R. G. Thurman, FASEB J., 2000, 14, 476–484.
24. J. Y. Zhang and Y. X. Wang, Fitoterapia, 2015, 100C, 35–43.
25. H. Betz and B. Laube, J. Neurochem., 2006 Jun, 97(6), 1600–1610.
26. M. D. Wheeler and R. G. Thurman, Am. J. Physiol., 1999, 277, L952–L959.
27. M. Froh, R. G. Thurman and M. D. Wheeler, Am. J. Physiol.: Gastrointest. Liver Physiol., 2002, 283, G856–G863.
28. W. Qu, K. Ikejima, Z. Zhong, M. P. Waalkes and R. G. Thurman, Am. J. Physiol.: Gastrointest. Liver Physiol., 2002, 283, G1249–G1256.
29. S. Meizel and J. H. Son, Mol. Reprod. Dev., 2005, 72, 250–258.
30. G. Yadid, M. B. Youdim and O. Zinder, Eur. J. Pharmacol., 1990, 175, 365–366.
31. S. Yamashina, A. Konno, M. D. Wheeler, I. Rusyn, E. V. Rusyn, A. D. Cox and R. G. Thurman, Nutr. Cancer, 2001, 40, 197–204.
32. E. Q. Scherer, D. Lidington, E. Oestreicher, W. Arnold, U. Pohl and S. S. Bolz, Cardiovasc. Res., 2006, 70, 79–87.
33. Y. Ye, X. Huang, Y. Zhang, X. Lai, X. Wu, X. Zeng, X. Tang and Y. Zeng, Int. Immunopharmacol., 2012, 12, 384–393.
34. C. J. Lo and E. J. Lo, J. Surg. Res., 2013, 181, 287–292.
35. H. D. Wang, X. X. Lü, D. X. Lu, R. B. Qi, Y. P. Wang, Y. M. Fu and L. W. Wang, Acta Pharmacol. Sin., 2009, 30, 1107–1114.
36. I. Pérez-Torres, B. Ibarra, E. Soria-Castro, R. Torrico-Lavayen, N. Pavón, E. Diaz-Diaz, P. L. Flores, O. Infante and G. Baños, Can. J. Physiol. Pharmacol., 2011, 89, 899–910.
37. A. Spittler, C. M. Reissner, R. Oehler, A. Gornikiewicz, T. Gruenberger, N. Manhart, T. Brodowicz, M. Mittlboeck, G. Boltz-Nitulescu and E. Roth, FASEB J., 1999, 13, 563–571.
38. A. Lilienbaum and A. Israël, Mol. Cell. Biol., 2003, 23, 2680–2698.
39. J. A. Valdés, J. Hidalgo, J. L. Galaz, N. Puentes, M. Silva, E. Jaimovich and M. A. Carrasco, Am. J. Physiol.: Cell Physiol., 2007, 292, C1960–C1970.
40. R. Miura, K. Nakamura, D. Miura, A. Miura, M. Kajiya, K. Hisamatsu, S. Nagase, H. Morita, K. F. Kusano, H. Matsubara, T. Ohe and H. Ito, Biol. Pharm. Bull., 2010, 33, 1148–1151.
41. S. Ghosh and M. S. Hayden, Nat. Rev. Immunol., 2008, 8, 837–848.
42. M. Lappas, M. Permezel, H. M. Georgiou and G. E. Rice, Biol. Reprod., 2002, 67, 668–673.
43. V. Seabra, R. F. Stachlewitz and R. G. Thurman, J. Leukocyte Biol., 1998, 64, 615–621.
44. K. Ikejima, W. Qu, R. F. Stachlewitz and R. G. Thurman, Am. J. Physiol., 1997, 272, G1581–G1586.
45. R. Garcia-Macedo, F. Sanchez-Muñoz, J. C. Almanza-Perez, G. Duran-Reyes, F. Alarcon-Aguilar and M. Cruz, Eur. J. Pharmacol., 2008, 587, 317–321.

---