Open Access Article
This Open Access Article is licensed under a Creative Commons Attribution 3.0 Unported Licence
An in vitro screening method for probiotics with antidepressant-like effect using the enterochromaffin cell model
Peijun Tianab,
Huiyue Zhuab,
Renying Zouab,
Qinming Kongab,
Mengshu Xuab,
Jianxin Zhaoabcd,
Hao Zhangabdef,
Wei Chenabeg and
Gang Wang*abcd
aState Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu, China. E-mail: wanggang@jiangnan.edu.cn; Tel: (+86)510-85912155
bSchool of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu, China
cInternational Joint Research Center for Probiotics & Gut Health, Jiangnan University, Wuxi, Jiangsu, China
d(Yangzhou) Institute of Food Biotechnology, Jiangnan University, Yangzhou, Jiangsu, China
eNational Engineering Center of Functional Food, Jiangnan University, Wuxi, Jiangsu, China
fWuxi Translational Medicine Research Center and Jiangsu Translational Medicine Research Institute Wuxi Branch, Wuxi, P. R. China
gBeijing Innovation Centre of Food Nutrition and Human Health, Beijing Technology and Business University (BTBU), Beijing, China
First published on 16th February 2026
Abstract
Correction for ‘An in vitro screening method for probiotics with antidepressant-like effect using the enterochromaffin cell model’ by Peijin Tian et al., Food Funct., 2021, 12, 646–655, https://doi.org/10.1039/D0FO02307H.
The authors regret that there was an error in one of the primer pairs reported in the article. The correct primers should be: TCCTTGACAGTAGCAGTATG, GTAACACGAAGACGAGAGT.
Consequently the sentence on page 647 beginning “The following primer pairs…” should be correctly given as “The following primer pairs were used: Tph1 (F-5′- TCCTTGACAGTAGCAGTATG -3′, R-3′- GTAACACGAAGACGAGAGT -5′)…”.
The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers.
| This journal is © The Royal Society of Chemistry 2026 |