Open Access Article
Peijun Tianab,
Renying Zouab,
Linhong Songcd,
Xu Zhangcd,
Bin Jiangcd,
Gang Wang*abef,
Yuan-kun Leeg,
Jianxin Zhaoabf,
Hao Zhangabfhi and
Wei Chenabhj
aState Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, P. R. China
bSchool of Food Science and Technology, Jiangnan University, Wuxi 214122, P. R. China. E-mail: wanggang@jiangnan.edu.cn; Fax: +(86)510-85912155; Tel: +(86)510 -85912155
cState Key Laboratory of Magnetic Resonance and Atomic and Molecular Physics, Wuhan National Laboratory for Optoelectronics, National Center for Magnetic Resonance in Wuhan, Key Laboratory of Magnetic Resonance in Biological Systems, Wuhan Institute of Physics and Mathematics, Chinese Academy of Sciences, Wuhan, China
dUniversity of Chinese Academy of Sciences, Beijing, China
eInternational Joint Research Laboratory for Probiotics, Jiangnan University, Wuxi 214122, P. R. China
f(Yangzhou) Institute of Food Biotechnology, Jiangnan University, Yangzhou 225004, P. R. China
gDepartment of Microbiology & Immunology, National University of Singapore, Singapore 117597, Singapore
hNational Engineering Research Center for Functional Food, Jiangnan University, Wuxi 214122, P. R. China
iWuxi Translational Medicine Research Center and Jiangsu Translational Medicine Research Institute Wuxi Branch, Wuxi 214122, P. R. China
jBeijing Innovation Centre of Food Nutrition and Human Health, Beijing Technology and Business University (BTBU), Beijing 100048, P. R. China
First published on 17th February 2026
Correction for ‘Ingestion of Bifidobacterium longum subspecies infantis strain CCFM687 regulated emotional behavior and the central BDNF pathway in chronic stress-induced depressive mice through reshaping the gut microbiota’ by Peijin Tian et al., Food Funct., 2019, 10, 7588–7598, https://doi.org/10.1039/C9FO01630A.
The corrected version of Table 1 is shown below.
| Name | GenBank accession | Primer sequence |
|---|---|---|
| Tph1 | NM_001100634.4 | F-5′- TCCTTGACAGTAGCAGTATG -3′ |
| R-3′- GTAACACGAAGACGAGAGT -5 | ||
| Gapdh | NM_008084 | F-5′-AGGTCGGTGTGAACGGATTTG-3′ |
| R-5′-TGTAGACCATGTAGTTGAGGTCA-3′ | ||
| Htr1a | NM_008308 | F-5′-GACAGGCGGCAACGATACT-3′ |
| R-5′-CCAAGGAGCCGATGAGATAGTT-3′ | ||
| Creb1 | NM_009952 | F-5′-AGCAGCTCATGCAACATCATC-3′ |
| R-5′-AGTCCTTACAGGAAGACTGAACT-3′ |
The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers.
| This journal is © The Royal Society of Chemistry 2026 |