Gold nanoparticle aptasensor synergizing colorimetric and Tyndall effect signals for ultrasensitive ATP detection

Abstract

Conventional ATP detection methods (e.g., fluorescence and electrochemistry) face significant sensitivity constraints, while colorimetric approaches—despite offering visual simplicity—remain inadequate for clinical applications due to limited detection capabilities. To address this dual challenge, we developed a dual-mode nanosensor leveraging gold nanoparticles (AuNPs), which synergistically integrates colorimetric signals (aggregation-induced red-to-blue shift) and Tyndall effect scattering for ultra-sensitive ATP quantification. The core mechanism exploits aptamer-mediated recognition: ATP binding triggers the release of cDNA from dsDNA complexes, enabling cDNA adsorption onto AuNPs to inhibit salt-induced aggregation. The proposed sensor demonstrates three major improvements: 125-fold sensitivity enhancement versus conventional colorimetry, record-low detection limits of 0.17 µM (colorimetric) and 1.28 nM (Tyndall effect), and a broad linear detection range (0.25–750 µM, R² > 0.91) with 5 min visual readout. Validation in complex yogurt matrices demonstrated exceptional robustness, yielding 96.1–110.2% recovery and precision (RSD < 10%). This cost-effective, minimal-equipment platform (requiring only a laser pointer for Tyndall readout) shows potential to bridge point-of-care screening with laboratory-grade quantification, highlighting its promising applicability for clinical diagnostics and environmental monitoring.

---

1. Introduction

Adenosine triphosphate (ATP), as a fundamental intracellular energy currency, serves as a key mediator of extracellular signalling in fields including food safety and environmental analysis.^1–3 Moreover, quantitative monitoring of ATP levels provides critical insights into disease mechanisms such as ischemia, cardiovascular disorders, malignancies, and metabolic dysregulation (e.g., hypoglycemia),⁴ necessitating rapid, economical, and highly sensitive detection methods.

Various approaches for ATP detection have been developed over the past few decades, primarily based on fluorescence,^5–7 electrochemistry,^8–10 chemiluminescence^11–13 or colorimetry.^14–16 Among these, colorimetric methods serve as standard analytical tools owing to their low cost, operational simplicity, and visual signal readability. However, their limited sensitivity remains a critical constraint. The Tyndall effect—a visible light scattering phenomenon in colloidal solutions first described by John Tyndall in the 19th century¹⁷—exhibits significant potential for analytical applications. Gold nanoparticle (AuNP) colloids leverage this phenomenon for detecting diverse targets including Hg²⁺,¹⁸ ascorbic acid,¹⁹ cocaine,²⁰ and others.

We developed a dual-mode ATP detection strategy leveraging colorimetric and Tyndall signal readouts of gold nanoparticles (AuNPs), synergistically combining visual simplicity with ultrahigh sensitivity. This approach achieved a 125-fold sensitivity enhancement compared to single-mode colorimetry, validated by robust ATP quantification in yogurt samples (recovery: 96.1–110.2%; RSD < 10%), demonstrating significant potential for real-sample applications.

2. Experimental

2.1 Reagents and materials

The ATP aptamer and its complementary DNA strand (cDNA) were synthesized by Sangon Biotechnology Co., Ltd (Shanghai, China) and stored at −20 °C. The sequences of oligonucleotides are listed in Table 1. The Apt and cDNA stock solutions (10 µM) were prepared by using 1× TE buffer, and the same 1× TE buffer was used to prepare the diluted solution with the desired concentration. Adenosine triphosphate (ATP) was obtained from Macklin (Shanghai, China). Uridine triphosphate (UTP) was purchased from BBI Life Sciences Corporation (Shanghai, China). Sodium chloride was purchased from Sichuan Xilong Science Co., Ltd (Sichuan, China). HAuCl₄ (0.01%) and sodium citrate were purchased from Aladdin Co., Ltd (Shanghai, China). All the chemicals were of analytical grade and were used without any further purification.

Table 1 Sequence information of the oligonucleotides used in this study^a

Name	Sequence (5′–3′)
a The 5′ (underlined) and 3′ (dotted) terminal bases of the Apt are complementary to the underlined sequence and the dotted sequence of the cDNA, respectively.
ATP aptamer	ACCTGGGGGAGTATTGCGGAGGAAGGT
cDNA	ACCTTCCTTTTTTTTCCCAGGT

---

2.2 Material characterization

UV-vis absorption spectra were acquired using a Lambda 365 spectrophotometer (PerkinElmer, USA). Transmission electron microscopy (TEM) characterization employed a JEM-1400F microscope (JEOL Ltd, Japan) at 200 kV accelerating voltage. Centrifugation was performed with an H2050R refrigerated centrifuge (Xiangyi Centrifuge Instrument Co., China). DNA denaturation utilized a thermal cycler (Eastwin Scientific Equipment Inc., China). Gold nanoparticle solutions were temperature-controlled and continuously stirred using a magnetic heating agitator (Gongyi Yuhua Instrument Co., China) with integrated thermal regulation.

Synthesis of negatively charged gold nanoparticles (AuNPs). The negatively charged AuNPs were prepared by reducing chloroauric acid with citrate according to a reported protocol.²¹ All glassware and magnetic stirrer bars used in this experiment were cleaned with freshly prepared aqua regia, rinsed thoroughly in distilled water and oven-dried fully before use. Briefly, the HAuCl₄ solution (100 mL, 0.01%) in a round-bottomed flask was heated with a silicone oil bath that had been preheated to 130 °C. When the HAuCl₄ solution started boiling, after 5 min, a sodium citrate solution (2.5 mL, 1%) was added quickly under continuous stirring. After 3 min, the solution turned red and remained stable. Stirring was continued for another 15 min, and then the round-bottomed flask was transferred to a magnetic stirrer and slowly cooled to room temperature. The obtained AuNP solution was stored at 4 °C before use. TEM images showed that the average size of the prepared AuNPs was about 16 nm (Fig. 2a).

Fig. 1 Illustration of the colorimetric determination for the ATP based on the aptamer.

Fig. 2 TEM images of the prepared solution mixture (a) without ATP and (b) with ATP; (c) UV-vis spectra and optical images of the corresponding (a) and (b) solution; (d) responses of the assay to the blank, UTP, GTP, CTP, ADP, AMP, TTP and ATP.

Colorimetric detection of ATP.
Hybridization of dsDNA. Apt (40 µL, 10 µM) and cDNA (40 µL, 10 µM) were mixed in the binding buffer (0.4 M NaCl). The obtained mixture was heated at 95 °C for 2 min and then slowly cooled to room temperature, and kept at R.T. for 1 h.
Preparation of the AuNP–aptamer complex. ATP (10 µL) at different concentrations, diluted in TE buffer, was added to 25 εL of the dsDNA mixture, and then incubated at room temperature for 5 min to allow the aptamer to bind to ATP and the double strand to open. Thereafter, 100 µL AuNPs were added to the above-prepared solution to mix the released single strand with ATP well. Finally, the UV-vis absorption spectrum of the solution mixture was recorded with a 1 cm path length cuvette. The concentration of ATP was quantitatively determined by detecting the absorbance ratio change in the system at A₇₂₅/A₅₂₅.

Preparation of yogurt samples. Yogurt samples were purchased from a local supermarket and stored at 4 °C. For analysis, 100 µL of yogurt was first diluted to a final volume of 1 mL and centrifuged. The supernatant was then discarded. The pellet was resuspended in boiling saline buffer, heated at 100 °C for 10 minutes, and immediately sonicated for 10 minutes while still hot. Following another centrifugation step, the resulting supernatant was diluted 100-fold. Finally, the prepared sample was spiked with different concentrations of ATP and detected according to the method described in ‘colorimetric detection of ATP’.

3. Results and discussion

A simple and highly sensitive colorimetric method for the detection of ATP, based on the specific recognition between ATP and its aptamer, was fabricated utilizing the adsorption of ssDNA onto AuNPs via their electrostatic properties. As shown in Fig. 1, the base sequences at two ends of the aptamer and cDNA were completely complementary, which led to the formation of a rigid duplex with a convex ring structure under hybridization conditions. The presence of this convex ring structure could weaken the interaction between the aptamer and its complementary strand, which is more conducive to the specific recognition of ATP by the aptamer.

The detection mechanism is based on the distinct interactions of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) with gold nanoparticles (AuNPs). Single-stranded DNA can spontaneously adsorb onto the surface of citrate-capped AuNPs through the exposed nucleobases, forming a protective layer that stabilizes the nanoparticles against salt-induced aggregation. In contrast, the rigid double-helix structure of dsDNA shields its nucleobases, preventing effective adsorption and thus leaving the AuNPs unprotected.

As illustrated in Fig. 1, in the absence of ATP, the aptamer (Apt) and its complementary DNA (cDNA) form a stable duplex (dsDNA). When this dsDNA is introduced to the AuNP solution, it cannot adsorb onto the AuNPs. Therefore, upon the addition of NaCl, the electrostatic repulsion between AuNPs is screened, leading to their aggregation and a consequent color change from red to blue. Interestingly, when ATP is present, it is specifically recognized and bound by its aptamer. This binding triggers a conformational change in the aptamer, leading to the dissociation of the dsDNA complex and the release of the cDNA strand. The released cDNA, now in its single-stranded form, readily adsorbs onto the AuNPs, effectively stabilizing them and preventing aggregation even in the presence of salt. This aggregation or dispersion state is accompanied by distinct color changes and variations in the Tyndall effect signal.

Transmission electron microscopy (TEM) was employed to visually confirm the mechanism of ATP detection. The TEM images and corresponding photographs provide direct evidence of the aggregation state of AuNPs under different conditions. As shown in Fig. 2a, in the absence of ATP, the AuNPs are heavily aggregated, which aligns with the expected outcome when dsDNA is present and unable to provide stabilization. This aggregated state corresponds to a blue-colored solution and a strong Tyndall effect. Conversely, in the presence of ATP (Fig. 2b), the AuNPs remain well-dispersed and spherical, confirming that the released cDNA (as ssDNA) has successfully adsorbed onto and stabilized the nanoparticles. This dispersed state results in a red-colored solution and a significantly weakened Tyndall effect. The UV-vis absorption spectra (Fig. 2c) further corroborate these findings, showing a characteristic redshift in the surface plasmon resonance peak for the aggregated state (with a high A₇₂₅/A₅₂₅ ratio) and a spectrum typical of dispersed AuNPs (with a low A₇₂₅/A₅₂₅ ratio) when stabilized by cDNA.

UV-vis absorption spectra were measured for further quantitative and qualitative analysis (Fig. 2c). The interaction between the aptamer and cDNA not only affected the color of AuNP solution, but also led to a red shift of its characteristic absorption peak from 525 nm to about 725 nm (Fig. 2c). These phenomena were consistent with the design principle of the method proposed in this paper, indicating that this aptamer-based colorimetric method had great potential for the detection of ATP.

To thoroughly evaluate the specificity of the presented strategy, the signal response of ATP was compared against a panel of potential interferents, including its structural analogs uridine triphosphate (UTP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), as well as other biologically relevant nucleotides such as adenosine diphosphate (ADP), adenosine monophosphate (AMP), and thymidine triphosphate (TTP). This testing is essential to claim high specificity for ATP in complex sample matrices. The comparison was carefully conducted by monitoring the corresponding absorbance ratio of A₇₂₅/A₅₂₅. As shown in Fig. 2d, the absorbance ratio of the AuNP solution in the presence of ATP was significantly lower than that observed with all the tested interferents and the blank solution. The UV-vis spectra of AuNP solutions in the presence of UTP, GTP, CTP, ADP, AMP, and TTP were almost identical to those of the blank state (without ATP), indicating an aggregated state of AuNPs (blue color and absorption at 725 nm). This result confirms that the dsDNA complex remains stable and the cDNA is not released in the presence of these non-target molecules. In contrast, only the specific binding of ATP to its aptamer triggers the release of cDNA, which subsequently stabilizes the AuNPs, resulting in a red color and a lower A₇₂₅/A₅₂₅ ratio. These data provide strong and direct evidence that the aptamer-based colorimetric method possesses high selectivity for ATP.

3.1 Optimization of experimental conditions

The influences of concentration of NaCl solution, the reaction time of AuNPs with cDNA, and the binding time of ATP with the aptamer on this were carefully investigated as shown in Fig. 3.

Fig. 3 (a) Effect of the concentration of NaCl on the UV absorption ratio with and without ATP (0.05, 0.10, 0.30, 0.50, 0.70, and 1.00 M), (b) at different reaction times (1, 3, 10, 15, 20, and 30 min) between cDNA and AuNPs, and (c) at different reaction time (1, 3, 5, 15, 25, and 30 min) between the aptamer and ATP.

For NaCl solution (Fig. 3a), the release of ssDNA from dsDNA was positively correlated with the concentration of NaCl solution, which affected the distribution of AuNPs in the mixture, and in turn caused the detection results influenced by the ATP. The AuNP mixture without ATP was used as the blank contrast sample. Different concentrations of NaCl (0.05 M, 0.10 M, 0.30 M, 0.50 M, 0.70 M and 1.00 M) were investigated; |ΔA| could be used as the criteria:

ΔA = A(A₇₂₅/A₅₂₅) − A₀(A₇₂₅/A₅₂₅)

|ΔA| represents the adsorption difference between blank and experimental groups, A(A₇₂₅/A₅₂₅) was the absorption ratio in the presence of ATP (experimental group), and A₀(A₇₂₅/A₅₂₅) was the absorption ratio of the blank. The absorbance ratio (A₇₂₅/A₅₂₅) is inversely proportional to the ATP concentration. Therefore, a smaller ratio corresponds to a higher concentration of ATP.

The sample solution was blue (right) and the blank solution (left) was pink red at low concentration (0.05 M and 0.10 M). With the concentration of NaCl gradually increased from 0.05 to 1.00 M, the color of the blank solution turned from pink red to light blue, which was almost the same as that of the experiment solution, and the adsorption difference |ΔA| reached the highest value, which made it hard to distinguish whether there is ATP or not. However, when the concentration of NaCl was 0.10 M, the adsorption difference between the blank and experimental group reached the best value in these tests. Therefore, a suitable concentration of NaCl (0.10 M) was selected as the best condition for all the experiments.

Due to the induction of salt, the AuNPs will become more and more unstable over time. Therefore, the incubation time of the complementary strand cDNA and AuNPs was optimized with 0.10 M NaCl solution (Fig. 3b). As can be seen from Fig. 3b, the ratio of A₇₂₅/A₅₂₅ was the smallest when the reaction time was 1 min. The ratio of A₇₂₅/A₅₂₅ increased gradually with the extension of the reaction time. That indicated that the longer the reaction time, the easier the aggregation of AuNPs.

The influence of the reaction time between the aptamer and ATP on the experimental results was also investigated (Fig. 3c). The reaction time between the aptamer and ATP affected the amount of cDNA released and then influenced the distribution of AuNPs in solution. The ratio of A₇₂₅/A₅₂₅ corresponded to the aggregation degree of AuNPs during the reaction time. The higher the value of A₇₂₅/A₅₂₅, the easier the aggregation of AuNPs. When the reaction time was 5 min, the ratio of A₇₂₅/A₅₂₅ had the minimum value (Fig. 3c). Thus, 5 min was selected as the optimum reaction time.

3.2 Analytical performance of this method

To further verify the validity of this proposed method, the response of ATP with different concentrations was investigated under the optimized experimental conditions (Fig. 4a and c). As the concentration of ATP increased, the color of AuNPs changed from light blue to pink red (Fig. 4a). Meanwhile, the corresponding UV-vis absorption spectra gradually showed a blue shift, and the absorption intensity at about 525 nm increased whereas that at about 725 nm reduced with the concentration of ATP increasing (Fig. 4c). The absorbance ratio of A₇₂₅/A₅₂₅ was linearly proportional to the concentration of ATP in the range of 2–20 µM (R² = 0.9556) and 50–300 µM (R² = 0.9961) (Fig. 4d), and the corresponding limit of detection (LOD) was calculated to be 0.17 µM.

Fig. 4 Analytical performance of the dual-mode aptasensor for ATP detection. (a) Digital photographs, (b) Tyndall effect images, and (c) UV-vis absorption spectra of the AuNP solutions in the presence of increasing ATP concentrations (0–750 µM). (d) Colorimetric calibration curve plotting the absorbance ratio (A₇₂₅/A₅₂₅) against ATP concentration. (e) Tyndall effect calibration curve plotting the grayscale difference (DG) against the logarithm of ATP concentration (log C_ATP).

To further improve the detection sensitivity of ATP, the red laser beam generated by a laser pointer was used to irradiate the solution and observe its Tyndall effect signals (Fig. 4b and e). It could be indicated that the gray value of the signal (ΔG) increased with the concentration of ATP (Fig. 4e). This showed a good linear relationship between ΔG and log C_ATP in the concentration range of 0.25–10 µM, 10–75 µM and 30–750 µM, with a correlation coefficient R² of 0.9531, 0.9681 and 0.9180, respectively. The limit of detection (LOD) was 1.28 nM. The formula of LOD = 3δ_b/k was used to calculate the LOD value (δ_b and k represent the standard deviation of the blank and the slope of the corresponding calibration curve,^22,23 and the value is 0.0147 and 34.4419 respectively).

To verify the practicability of this method, ATP in the yogurt samples was detected by using the standard addition method.^24,25 The results (Table 2) indicated that the method had good practicality with the recovery rate reaching 96.1–110.2% and RSDs less than 10%. These results demonstrate that the method's precision and accuracy meet the practical requirements for biological sample analysis.

Table 2 Recovery experiments of ATP in yogurt samples using the proposed method (Tyndall mode, n = 5)

Sample	Spiked (nM)	Found (nM)	Recovery (%)	RSD (%)
1	0	0.21	—	6.5
	5	5.02	96.1	4.1
	10	11.23	110.2	3.2
	50	49.21	98.0	3.8

---

4. Conclusions

In summary, a colorimetry/Tyndall dual-mode assay was developed based on ATP-regulated AuNP aggregation for the detection of ATP in aqueous solution which combined the advantages of both methods. This dual-mode assay achieved about 125-fold improvement in sensitivity compared with the single colorimetry method. Furthermore, it demonstrated strong performance in detecting ATP in yogurt samples, indicating its significant potential for application to other real-world samples.

Conflicts of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

All data are contained within the manuscript.

Acknowledgements

We are thankful for financial support from the Guangxi Key Laboratory of Electrochemical and Magnetochemical Functional Materials, the Guangxi Key Laboratory of Environmental Pollution Control Theory and Technology, and the Guangxi Colleges and Universities Key Laboratory of Food Safety and Detection.

References

1. A. V. Gourine, E. Llaudet, N. Dale and K. M. Spyer, Nature, 2005, 436, 108.
2. A. D. Garg, D. V. Krysko, T. Verfaillie, A. Kaczmarek, G. B. Ferreira, T. Marysael, N. Rubio, M. Firczuk, C. Mathieu, A. J. M. Roebroek, W. Annaert, J. Golab, P. de Witte, P. Vandenabeele and P. Agostinis, EMBO J., 2012, 31, 1062.
3. M. M. Gottesman, T. Fojo and S. E. Bates, Nat. Rev. Cancer, 2002, 2, 48.
4. J. Stagg and M. J. Smyth, Oncogene, 2010, 29, 5346.
5. H.-Z. He, V. P.-Y. Ma, K.-H. Leung, D. S.-H. Chan, H. Yang, Z. Cheng, C.-H. Leung and D.-L. Ma, Analyst, 2012, 137, 1538.
6. X. Geng, Y. Q. Sun, Y. F. Guo, Y. M. Zhao, K. Zhang, L. H. Xiao, L. B. Qu and Z. H. Li, Anal. Chem., 2020, 92, 7940.
7. C. Lin, Y. Chen, Z. Cai, Z. Zhu, Y. Jiang, C. J. Yang and X. Chen, Biosens. Bioelectron., 2015, 63, 562.
8. Y. Wang, X. He, K. Wang and X. Ni, Biosens. Bioelectron., 2010, 25, 2101.
9. W. Li, Z. Nie, X. Xu, Q. Shen, C. Deng, J. Chen and S. Yao, Talanta, 2009, 78, 954.
10. X. Zuo, S. Song, J. Zhang, D. Pan, L. Wang and C. Fan, J. Am. Chem. Soc., 2007, 129, 1042.
11. L. Z. Hu, Z. Bian, H. J. Li, S. Han, Y. L. Yuan, L. X. Gao and G. B. Xu, Anal. Chem., 2009, 81, 9807.
12. Z. Liu, W. Zhang, L. Hu, H. Li, S. Zhu and G. Xu, Chem.–Eur. J., 2010, 16, 13356.
13. H. Huang, Y. Tan, J. Shi, G. Liang and J.-J. Zhu, Nanoscale, 2010, 2, 606.
14. Z. C. Yu, H. X. Gong, M. J. Li and D. P. Tang, Biosens. Bioelectron., 2022, 218, 114751.
15. R. R. Ren, G. N. Cai, Z. Z. Yu, Y. Y. Zeng and D. P. Tang, Anal. Chem., 2018, 90, 11099.
16. F. Sancenon, A. B. Descalzo, R. Martinez-Manez, M. A. Miranda and J. Soto, Angew. Chem., Int. Ed., 2001, 40, 2640.
17. D. B. Rootman, J. L. Lin and R. Goldberg, Ophthalmic Plastic & Reconstructive Surgery, 2014, 30, 524.
18. Z. Deng, W. Jin, Q. Yin, J. Huang, Z. Huang, H. Fu, Y. Yuan, J. Zou, J. Nie and Y. Zhang, Chem. Commun., 2021, 57, 2613.
19. Q. Gao, J. Wan, X. Chen, X. Mo, Y. Sun, J. Zou, J. Nie and Y. Zhang, RSC Adv., 2021, 11, 39306.
20. W. Xiao, Z. Deng, J. Huang, Z. Huang, M. Zhuang, Y. Yuan, J. Nie and Y. Zhang, Anal. Chem., 2019, 91, 15114.
21. K. C. Grabar, R. G. Freeman, M. B. Hommer and M. J. Natan, Anal. Chem., 1995, 67, 735.
22. Y. S. Wang, S. Tian, S. Y. Chen, M. J. Li and D. P. Tang, Anal. Chem., 2025, 97, 7526.
23. S. Tian, Z. C. Yu, Y. S. Wang, S. Y. Chen, M. J. Li and D. P. Tang, Anal. Chem., 2025, 97, 9518.
24. Y. Gao, J. Tang, Q. Zhou, Z. C. Yu, D. Wu and D. P. Tang, Anal. Chem., 2024, 96, 5014.
25. Z. C. Yu, C. C. Qiu, L. T. Huang, Y. Gao and D. P. Tang, Anal. Chem., 2023, 95, 4212.

---

Footnote

† These authors contributed equally to this work.

---