A pH/ROS dual responsive smart microgel miRNA delivery system for repair of intervertebral disc degeneration

Abstract

The progression of intervertebral disc degeneration (IDD) is due to the progressive exacerbation of apoptosis and impaired extracellular matrix (ECM) synthesis, both of which are induced by progressive inflammation. Therefore, addressing the inflammatory microenvironment and correcting excessive apoptosis of nucleus pulposus cells (NPCs) are key to achieving intervertebral disc (IVD) regeneration. In this study, we designed a microenvironment-responsive smart microgel gene delivery system that for the first time combines phenylboronic acid-functionalized microgels with strontium sulfite nanoparticles to load miR-155 to enhance their anti-apoptosis capacity and promote ECM regenerative effects. In addition, strontium sulfite nanoparticles were able to respond to pH changes and dissolve at endosomal pH to release genetic materials. This highly biocompatible microgel drug system (MS-TSNPs@miR-155) was capable of continuously releasing miR-155, effectively modulating inflammation and attenuating apoptosis in NPCs. These minimally invasive and smart delivery capabilities promote the restoration of metabolic homeostasis within the medullary ECM, effectively delaying IDD progression.

---

1. Introduction

Intervertebral disc degeneration (IDD), a leading cause of global disability affecting over 600 million people worldwide, is characterized by a result of inflammation associated with the medulla interna.^1,2 Epidemiological findings indicate that intervertebral disc degeneration (IDD) is the leading cause of global disability affecting more than 600 million people worldwide, with annual health-related costs ranging from 560 to 630 billion dollars per year in developed countries.^3–5 The intervertebral disc is a highly hydrated fibrocartilaginous tissue with a central nucleus pulposus (NP) surrounded by annulus fibrosus (AF) and an outer layer of endplate cartilage that connects the upper and lower vertebrae.⁶ The pathogenesis of IDD involves increased inflammation, leading to lactate accumulation within nucleus pulposus cells (NPCs) and their microenvironment, ultimately resulting in extracellular matrix (ECM) degradation.^7–9 Critically, inflammation-induced reactive oxygen species (ROS) accumulation further exacerbates ECM degradation by upregulating matrix metalloproteinases (MMPs), while ECM breakdown products conversely amplify pro-inflammatory signaling, forming a self-sustaining vicious cycle.^10–12 Therefore, modulating the excessive inflammatory response and restoring ECM metabolic balance are critical for effectively managing IDD.

MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play an important role in regulating cellular functions (e.g. cell proliferation, differentiation, metabolism, autophagy, etc.).¹³ In recent years, dysregulation of miRNAs has been linked to cancer, cardiovascular disease, osteoarthritis and IDD.^14–17 Activation of the transforming growth factor β (TGFβ) pathway holds therapeutic promise for IDD.¹⁸ TGFβ receptor 2 (TGFβR2) is a transmembrane protein essential for TGFβ signaling and has been implicated in vascular endothelial cell proliferation. Notably, miR-155-5p—a key regulator of TGFβR2—is significantly downregulated in degenerated nucleus pulposus tissues.¹⁹ Critically, studies have established TGFβR2 as one of the miR-155-5p targets,²⁰ and miR-155-5p-mediated targeting of the PI3K/AKT pathway has been shown to inhibit apoptosis in nucleus pulposus cells while promoting autophagy and extracellular matrix (ECM) synthesis in nucleus pulposus cells.^21–24 Nevertheless, delivery of naked and unmodified miRNA into IDD encounters many limitations, such as susceptibility to degradation by plasma nuclease, inefficient translocation into the cytoplasm and lack of targeting ability, among other physiological barriers limiting its therapeutic efficacy.^25–27 Although viral vectors proved effective for gene transport, high immunogenicity, carcinogenicity, limited gene loading capacity and expensive production restricted their use, facilitating the development of many non-viral vectors.²⁸ Therefore, the design of efficient miRNA delivery vectors is necessary.

Nanoparticles have emerged as a novel inorganic gene delivery system in the nucleic acid delivery pathway.²⁹ Nanoparticles, defined as solid carriers with a size of 1–1000 nm, have received considerable attention due to their many advantages over many other carriers.³⁰ Nanoparticles offer significant advantages over conventional therapies, particularly through their ability for targeted, localised and controlled drug delivery.³¹ These properties are critical in addressing the complex pathophysiology of IDD, which involves chronic inflammation, oxidative stress and ECM degradation.³² Strontium (Sr) compounds are alkaline earth metals that have recently been found to be beneficial to patients with osteoporosis and bone fractures, and are commonly used as calcium substitutes for hydroxyapatite particles.³³ Strontium sulphite nanoparticles (SNPs) have been shown to be promising nanocarriers for the delivery of genetic materials to cells, capable of maintaining nucleic acid structures in different environments of tissues ranging from pH 7 to 7.5 due to their strong binding affinity for nucleic acids and their ability to respond efficiently to changes in pH, and capable of allowing the genetic material to escape from the particles at a rapid rate when exposed to acidic environments.³⁴ Therefore, SNPs are considered to be effective miRNA delivery vehicles. Nevertheless, SNPs are associated with major biological downside associated with high tissue sequestration, largely affecting intracellular gene transport and expression.³⁵

In recent years, with the continuous deepening of tissue engineering technology research, there are more and more biomaterials showing superior performance in promoting the regeneration of nucleus pulposus (NP) cells and restoring the physicochemical properties of intervertebral discs,³⁶ among which the GelMA hydrogel is one of the most commonly used materials. With its three-dimensional network structure, good biocompatibility, adjustable mechanical properties and bioactivity,³⁷ it has become a hotspot for biomedical application research, which can promote bone fusion, eliminate inflammatory response and promote tissue regeneration through hydrogel-loaded cells, growth factors and medications,³⁸ providing a new therapeutic pathway for the regeneration of intervertebral discs. However, bulk hydrogels for injection delivery applications require special methods, including in situ and shear thinning cross-linking, to avoid possible leaks before gel formation and delivery failures due to rapid gelation.³⁹ Hydrogel microspheres are attractive in minimally invasive biomedical applications and are injected with small needles because of their small size. Microfluidics exhibit excellent advantages over batch emerging, mechanical fragmentation and lithography approaches to form monodisperse hydrogel microspheres by emulsifying an aqueous hydrogel phase within a paraffin oil phase at the junction of microchannels in designed configurations.^40,41 The microfluidic hydrogel MS has good injectability, requires no extra procedures, and is very compatible with local gene therapies, such as percutaneous procedures and intervertebral disc injection.^12,42–45

Tea polyphenols (TP) are polyhydroxyphenolic compounds extracted from tea leaves, with a variety of physiological activities, belonging to the natural strong antioxidants.⁴⁶ Moreover, it has been shown that tea polyphenols self-assemble encapsulated nanoparticles by electrostatic, hydrogen bonding and covalent binding on the surface of the nanoparticles.⁴⁷ This type of assembly results in a denser nanoparticle structure, which further improves the slow-release properties of the nanoparticles.⁴⁸ Phenylboronic acids (PBAs) are a class of Lewis acids that bind to the o-diol molecule of TP to form a boronic ester bond, which is a reversible covalent bond.⁴⁹ Boronate bonds possess unique pH- and ROS-responsive binding properties, and their formation and dissociation are regulated by H⁺ and ROS, and they can be used in drug delivery systems.⁵⁰

In this study, we proposed to combine GelMA with SNPs loaded with miR-155-5p to construct a delivery system for miRNAs. In order to achieve this system, we designed PBA-functionalized GelMA microspheres and wrapped the SNPs with TP, and a boron ester bond was formed between TP and GelMA-PBA, which led to the construction of a pH/ROS dual-responsive-type microgel drug delivery system. This smart microgel gene delivery system (MS-TSNPs@miR-155) has the ability to effectively repair IDD through the following mechanisms:¹ The microspheres within the system have the ability to maintain the intrinsic morphology and physiological function of NP cells, which is beneficial to the restoration of the intervertebral disc structure.² The inflammatory microenvironment is characterised by excess ROS and acidic pH, which triggers the dissociation of boron ester bonds, leading to the reactive release of MS-TSNPs@miR-155.³ The special structure of the o-phenylphenol group in tea polyphenols directly scavenges ROS.⁴ The acidic environment in degenerated discs triggers miRNA release.⁵ Once endocytosed, miR-155 can attenuate apoptosis and promote ECM synthesis. This effective regulation of inflammation and normalization of NPC functions subsequently restores the balance between anabolic and catabolic processes in the ECM. The effect of this smart microgel drug system on IDD repair was significant both in vitro and in vivo. In this study, a novel approach for treating IDD was demonstrated.

2. Materials and methods

Gelatin (Gel), methacrylic anhydride (MA), tea polyphenol, SrCl₂, Na₂SO₃N-hydroxysuccinimide (NHS), and 1-ethyl-3-(3-dimethyla minopropyl) carbodiimide hydrochloride (EDC) were obtained from Macklin (Shanghai, China). miR-155 (rat miRNA-155 targeting the sequence UUAAUGCUAAUUGUGAUAGGGGU), negative control (NC) miRNA, and cy3-miR-155 were synthesized by Sangon Biotech (Shanghai, China). The cell culture media, trypsin, PBS, enzyme-free water, plates, and dishes were purchased from Corning (Shanghai, China). The antibodies were obtained from Abcam (Shanghai, China). A live/dead staining kit, phalloidin and DAPI were obtained from Solarbio (Beijing, China).

2.1. Synthesis and characterization of GelMA-PBA

The synthesis and characterisation of GelMA-PBA followed established methods as described in previous studies.⁵¹ Next, GelMA (300 mg) was dissolved into PBS solution (30 mL, pH = 6.8) containing 1.2-fold NHS and EDC. The mixture solution was reacted under N₂ atmosphere protection at 37 °C for 30 min. Next, 4-aminophenylboronic acid (PBA, 500 mg) was added into the above solution and reacted for 24 h under N₂ protection. The obtained solution was dialyzed (M_w: 1000) with distilled water for 3 days and dried under vacuum. The resulting product was denoted as GelMA-PBA. ¹H NMR spectra were obtained for molecular structure characterization.

2.2. Fabrication and characterization of the TSNPs@ miR-155

SNP synthesis and characterization followed established methods. The solution was prepared by mixing 5 μL of 1 M SrCl₂ into 10 μL of HEPES buffer solution (pH adjusted to 7.5) and then mixing this solution with 5 μL of 1 M Na ₂SO₃. The mixture was incubated at 37 °C for 30 min and subsequently added to 10% FBS-supplemented DMEM medium to obtain a final volume of 1 mL of pellet solution.³⁴ The characterization of the nanoparticles was conducted using Zetasizer spectroscopy and transmission electron microscopy (TEM). Electrophoresis was used to examine the ability of SNPs@miR-155 with different weight ratios to condense and protect RNA from RNase-induced degradation. The condensation ability of SNPs@miR-155 and TSNPs@miR-155 with different mass ratios was examined by electrophoresis. The cy3-miR-155 quenching assay was used to confirm the encapsulation of TSNPs, which was improved from a previous report.⁵² Turbidity changes in the amount of SrSO₃ in the measured particles were studied using a spectrophotometer at pH values 7.5, 6.5, 5.5, 4.5 and 3.5. The dissolution activity was studied in triplicate, expressed as mean ± SD.

2.3. Construction and characterization of the microgel drug system

GelMA-PBA microspheres (MS) were prepared through emulsification. The oil phase consisting of 1 mL of GelMA-PBA solution containing 5 mg LAP (10%, w/v) and 20 mL of paraffin wax and Span80 200 μL was connected to the microfluidic chip (TINKERBIO T-type A, 100 μm) via a micro syringe pump, and the aqueous and oil phases were passed through the microfluidic chip to form homogeneous microdroplets at a flow rate of 0.5 and 10 mL h⁻¹, respectively, which were then crosslinked under UV light for 60 s to solidify the microspheres. The microspheres were washed three times with PBS to remove the residual oil phase. To prepare the MS-TSNPs@miR-155, the MS were collected into 50 mL centrifuge tubes, suspended for 10 min to remove the paraffin oil as much as possible, and then washed with acetone and PBS three to five times to remove the paraffin oil and other additives. The MS were then freeze-dried to absorb TSNPs@miR-155 solutions, forming the MS-TSNPs@miR-155.

The morphology of the microspheres was examined using microscopy, while functionalization was confirmed by EDS mapping. In vitro degradation assays were performed by initially weighing the lyophilized microgels (M₀) and then placing them in PBS at 37 °C. The microgels were then lyophilized at specific time points and weighed (M_t). Degradation rate (%) = (M₀ − M_t)/M₀ × 100%. The antioxidant properties were measured by scavenging stable DPPH free radicals. The details are provided in the SI. Cy3-miR-155 was used to detect the release profile of miR-155. The MS-TSNPs@miR-155 (0.2 g) was completely submerged in PBS (pH 7.4, pH 6.5 and pH 6.5 + H₂O₂ (100 μM)) at 37 °C, and the supernatant was collected at different time points. The fluorescence was detected (550 nm for excitation and 570 nm for emission) with a Bio Synergy H1 microplate reader.

2.4. Biocompatibility evaluation of the microgel drug system

The cells were treated with complete medium containing MS, MS-TSNPs, or MS-TSNPs@miR-155. Normal complete medium was used as a control. After 24 and 48 h, the cells were incubated in complete medium supplemented with 10% CCK-8 reagent for 2 h. Subsequently, 100 μL of the medium was transferred to a 96-well plate, and the optical density (OD 450 nm) was measured using a microplate reader.

To investigate the potential cytotoxicity of the microgel drug system, we conducted a biocompatibility test on MS-TSNPs@miR-155. In an environment rich of ROS, MS-TSNPs@miR-155 was incubated with complete medium containing H₂O₂ (100 μM) for 48 h. The resulting extract was then utilized to culture NPCs, and the viability of the NPCs was assessed at both 24 and 48 h. To evaluate the viability of NPCs at the 48-h mark, live/dead staining was performed. Normal complete medium and extracts from MS incubated with normal complete medium served as the controls in this experiment.

2.5. Internalization of TSNPs@miR-155 by NPCs

NPCs were extracted from rats and cultured using the method described in a previous study,⁵³ and the details are provided in the SI. A total of 200 μL TSNPs@cy-3 miR-155 were incubated with NPCs in 6-well plates. Fluorescence was observed using confocal laser scanning microscopy (CLSM) at predetermined time points (1 h, 3 h, 6 h, 12 h) to determine the amount of miR-155.

2.6. In vitro MS-TSNPs@miR-155 treatment of degenerated NPCs

TBHP (50 μM, 24 h) was used to degenerate the NPCs’ inflammatory environment and establish a degenerated NPC model.⁵⁴ Cell viability was assessed using CCK-8 and live/dead staining techniques after 24 h of treatment with microgels and NPs. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was used to assess apoptosis. The anti-inflammatory effect of the microgel system was evaluated by measuring the expression of the anti-inflammatory factor IL-10 and the proinflammatory factor TNF-α through RT–qPCR and immunofluorescence methods.

The anti-apoptosis effect of the microgel system was evaluated. RT-qPCR and immunofluorescence were used to detect the expression of anti-apoptosis factor BCL-2 and pro-apoptotic factor BAX.

The impact of the microgel system on ECM synthesis and degradation was evaluated. The mRNA expression of COL-II, Aggrecan (ACAN), ADAMTS-4 and MMP-13 was assessed using RT–qPCR. Additionally, the protein expression levels of COL-II, ACAN, ADAMTS-4 and MMP-13 were evaluated through immunofluorescence.

2.7. Transcriptome sequencing (mRNA-seq) assay

To investigate the effect of miR-155-5p on NPC behaviour, NPCs were exposed to TSNPs@miR-155, TBHP stimulation or NC. NPs (nanoparticles constructed with negative control siRNAs) were incubated with TSNPs@miR-155 for 72 h (n = 3). Subsequently, mRNAs were collected and subjected to sequencing by SeqHealth (WuHan, China). The experimental details can be found in the SI.

2.8. In vivo evaluation of the IDD repair effect

The Sprague Dawley (SD) rats were subjected to a treatment regimen approved by the Ethics Committee of West China Hospital of Sichuan University (20250106004). The animals were housed in compliance with the guidelines set forth by the International Council for Laboratory Animal Science (ICLAS). Each rat was housed individually in cages and administered general anesthesia through isoflurane inhalation. IDD models were created through percutaneous needle puncture and aspiration following the methods outlined in prior research.^53,55 Subsequently, 20 μL of NC NPs (nanoparticles constructed with negative control miRNAs), MS-TSNPs, miR-155 or MS-TSNPs@miR-155 were injected into the discs. The disc height index (DHI) and degeneration grade were evaluated using X-ray and MRI scans at four and eight weeks post surgery. At each time point, the rats were sacrificed by an overdose of isoflurane inhalation. Histological characteristics of the disc, proteoglycan composition, and collagen levels were assessed using H&E and safranin-O/fast green staining. The histological grade was assessed according to Table S2. Immunofluorescence staining was used to visualize the levels of ECM synthesis markers (COL-II) and degradation factors (MMP-13). Additionally, immunofluorescence labeling was used to detect the presence of inflammatory cytokines (TNF-α, IL-10) and apoptosis-associated molecules (BCL-2, BAX). More details are provided in the SI.

2.9. Statistical analysis

The data are reported as the means ± standard deviations. Statistical analyses, including unpaired t-tests and one-way ANOVA with Tukey's multiple comparison test, were conducted using GraphPad Software (USA). p < 0.05 indicates statistical significance. Additionally, levels of significance are indicated as follows: * 0.01 ≤ p < 0.05, ** 0.001 ≤ p < 0.01, *** p < 0.001, and ns denotes not significant.

3. Results and discussion

3.1. Synthesis and characterization of GelMA-PBA

GelMA-PBA was synthesized in two steps (Fig. S1A). First, methacrylic acid was grafted onto gelatin by an acylation reaction to obtain GelMA, and then 4-aminophenylboronic acid was grafted onto GelMA by an amidation reaction to obtain GelMA-PBA. The successful synthesis of GelMA-PBA was confirmed by ¹H NMR analysis. Specifically, the presence of two different peaks at 7.7 ppm indicates the presence of the benzene ring in GelMA-PBA (Fig. 2A). The Fourier results show a peak at 1213 cm⁻¹ which may be related to the vibration of the B–O bond (Fig. 2B). The XPS results show the presence of absorption peaks of elemental boron in the sample (Fig. 2C). Under bright-field microscopy, the average particle size of GelMA-PBA microspheres before freeze-drying ranged from 80–140 μm (Fig. S2). According to scanning electron microscopy (SEM) analysis, the lyophilised microspheres are essentially smooth surface microspheres (Fig. 2D). EDS analysis confirmed the presence of “B” from PBA on the surface of the microspheres. All these results indicate the successful synthesis of GelMA-PBA microspheres.

Fig. 1 Illustration of the design of microgel and the mechanisms of IDD repair promotion.

Fig. 2 Comprehensive characterization of the functionalized microgel and nanoparticle delivery system. (A) The ¹H NMR spectra of GelMA-PBA and GelMA. (B) The FTIR spectra of GelMA-PBA. (C) The XPS of GelMA-PBA. (D) SEM images, and EDS maps of PBA-functionalized MS. (E) and (F) TEM images, (G) size and (H) ζ-potential of the NPs. (I) Quantitative analysis of agarose gel electrophoresis showed that TSNPs@miR-155 was retained. (J) Dissolution of the selected salt particles at acidic pH. (K) Bright-field images, (L) and (M) fluorescence images, and (N) NP cells adhered to the surface of hydrogel microspheres. (O) Representative CLSM images of Cy3-miR-155 transfection.

3.2. Fabrication and characterization of the TSNPs@miR-155

TSNPs@miR-155 were easily prepared by electrostatic adsorption of SrSO₃ with miR-155 in DMEM solution and a subsequent self-assembly process by tea polyphenols (Fig. S3A). The encapsulation process mildly increased the size of the NPs from 241.9 nm to 265.6 nm (Fig. 2E and F and Fig. S3B). Similar to previous studies,⁵⁶ the particle size (241.9 ± 3.051 nm) and ζ-potential (−11.7 ± 0.252 mV) of SrSO₃ indicate that SrSO₃ was successfully synthesized (Fig. 2G and H and Fig. S3C). Consistent with our expectations, miR-155 increased the ζ-potential of SrSO₃ from −11.7 ± 0.252 mV to −9.4 ± 1.48 mV, and the TP-coating significantly reduced the ζ-potential of miRNA-SNPs from −9.4 ± 1.48 mV to 15.5 ± 1.8 mV (Fig. 2H). It is possible that this reduction in charge is due to the dominance of one of the substances on the surface of the complex (e.g. encapsulation or adsorption), with a zeta potential close to the value of that substance.^57,58 The SNPs were able to completely condense miR-155 at a w/w ratio of 4, as indicated by an electrophoretic mobility shift assay (Fig. S4A), and the encapsulation efficiency was measured to be 93.4% (Table S1). The degradation of RNA in miR-155 SNPs is minimal when compared with naked RNA after incubation with RNase (Fig. 2I). The above results successfully indicated the successful synthesis of TSNPs@miR-155. Spectrophotometric readings showed effective solubilisation of SrSO₃ as absolute particle solubilisation occurred at a pH of 4.5 with an absorption intensity of 0.0 and did not change significantly with the degree of response to pH after self-assembly by TP (Fig. 2J). Response to changes in pH is essential to prevent inefficient escape of genetic materials, and partial or incomplete particle solubilisation may prevent effective transfection, leading to reduced transgene expression or inefficient silencing of endogenous genes.⁵⁹

3.3. Functional evaluation and biocompatibility of microgel drug systems

Reversible borate ester is formed between the phenolic hydroxyl group of tea polyphenol and the phenylborate group in MS. enabling dynamic loading of TSNPs.⁶⁰ Successful loading of cy3-miR-155 into MS was confirmed by CLSM (Fig. 2K–M). As demonstrated by CLSM (Fig. 2N), the microgel drug system exhibited effective support for myeloid cell adhesion and spatial organization. When cy3-miR-155 was encapsulated within TSNPs (TSNPs@cy3-miR-155) followed by incubation with NPCs different times, time-dependent endocytosis of TSNPs@cy3-miR-155 was observed in CLSM (Fig. 2O and Fig. S4B).

The cytocompatibility of the microgel drug system toward NPCs was confirmed using a CCK-8 assay and live/dead staining (Fig. 3A and B). The MS-TSNPs@miR-155 system exhibited significant antioxidant activity, permitting effective scavenging of ROS and attenuation of inflammatory responses. The initial CCK-8 assay demonstrated a significant increase in the survival of NPCs treated with miR-155 or MS-TSNPs@miR-155 compared to untreated NPCs (Fig. S5). This rescuing effect was further confirmed by live/dead staining, showing a substantial increase in the number of green fluorescent cells and a decrease in the number of red fluorescent cells in the MS-TSNPs@miR-155 group compared to the untreated group (Fig. 3C and D). The induction of cell apoptosis by inflammation can lead to a decrease in the synthesis of the ECM.⁶¹ Consequently, the antiapoptotic effect of the microgel drug system was further assessed. TUNEL staining revealed that TBHP could enhance apoptosis, while both MS-TSNPs@miR-155 and the MS-TSNPs demonstrated the ability to protect NPCs against TBHP-induced apoptosis (Fig. 3E). The excellent antioxidant capacity of the microgel was confirmed through 1,1-diphenyl-2-picrylhydrazyl (DPPH) scavenging (Fig. 3F), which was due to the remarkable antioxidant capacity of MS-TSNPs@miR-155.^62,63 This significant antioxidative capacity not only prevented damage from ROS but also has the potential to regulate the inflammatory microenvironment.⁶⁴ According to the literature, the extracellular pH during IDD can fall close to 6.5.⁶⁵ Therefore, we used pH 6.5 as the pathophysiological acid stimulation condition in vitro for the next experiment. Based on the sensitive pH-responsive properties of the SNPs, a pH-sensitive microgel was formed and manifested fast degradation in acidic environments compared with relatively slow degradation in PBS (Fig. 3G). This was consistent with the miR-155 release profile (Fig. 3H), which showed abrupt release in a pathophysiological acidic environment. Due to the pH- and ROS-responsive properties of boronate bonds, additional H₂O₂ accelerated the release rate of MS-TSNPs@miR-155.

Fig. 3 Biocompatibility, degradation, ROS scavenging, and smart drug release of the microgel. (A) Live/dead staining, (B) CCK-8 to evaluate the biocompatibility of the microgel drug system. (C) and (D) Live/dead staining at 48 h verified the viability of the NPCs. (E) Assessment of the antiapoptotic effects of microgel delivery systems by TUNEL staining. (F) The DPPH test showed that the microgel drug system exerted a strong antioxidative effect. (G) The in vitro degradation process of the microgel under different conditions suggested that the pathological acidic environment in IDD accelerates microgel collapse. (H) The release result of miR-155 indicated that the inflammatory environment (low-pH and high-ROS) promotes miR-155 release from microgels.

3.4. In vitro IVD regeneration assessment

RT-qPCR showed that miR-155 treatment resulted in decreased expression levels of BAX, and TNF-α, along with increased expression levels of IL-10 and BCL-2 (Fig. 4A). Immunofluorescence staining further confirmed these results (Fig. 4C and Fig. S6B). Notably, encapsulation of miR-155 in MS-TSNPs further enhanced these effects. Successful transfection of miR-155 significantly inhibited the apoptotic pathway, while decreasing the activation of the apoptotic pathway through reactive oxygen species scavenging and anti-inflammatory mechanisms.⁶⁶

Fig. 4 Assessment of the anti-inflammatory and anti-apoptosis properties of microgel delivery systems. (A) RT-qPCR analysis of IL-10, TNF-α, BCL-2, and BAX expression after microgel extract treatment. (B) RT-qPCR analysis of Col II, aggrecan, MMP-13, and ADAMTs-4 expression following microgel extract treatment. (C) Representative immunofluorescent staining for IL-10, TNF-α, BCL-2, BAX, COL-II, and MMP-13 (scale bars: 20 μm).

The microgel effectively restored the ECM anabolic/catabolic balance through the regulation of inflammation and normalization of apoptosis. RT–qPCR analysis revealed that treatment with MS-TSNPs@miR-155 resulted in the upregulation of ACAN and COL-II, and the levels were comparable to those in the control group. Conversely, the expression of MMP-13 and ADAMTS-4 was significantly lower in the MS-TSNPs@miR-155 or miR-155 treated group than in the untreated group (Fig. 4B). These findings were additionally confirmed using immunofluorescence (Fig. 4C and Fig. S6A and C). Taken together, these data demonstrated that MS-TSNPs@miR-155 effectively restored the equilibrium of anabolic and catabolic processes in the ECM of inflamed NPCs. Furthermore, the successful regulation of inflammation effectively reduced ECM degradation.⁶⁷

3.5. Possible pathways regulated by MS-TSNPs@miR-155

To elucidate the regulatory mechanisms of ECM remodeling in nucleus pulposus cells (NPCs), we performed transcriptomic analyses of NPCs treated with TBHP and TSNPs@miR-155. mRNA-seq data revealed distinct transcriptomic landscapes under both conditions. TBHP treatment resulted in 251 differentially expressed genes (DEGs), with 161 upregulated and 90 downregulated genes (Fig. S8A). In contrast, TSNPs@miR-155 treatment led to 374 DEGs (114 upregulated, 260 downregulated), confirming successful internalization and regulatory effects of miR-155 (Fig. 5A). The heatmaps indicated that the DEGs were primarily associated with various biological processes, including ECM synthesis and binding, cell growth and death, inflammation, signaling and cellular processes, genetic information processing, and environmental information processing (Fig. 5B–I and Fig. S8B–I).

Fig. 5 Possible mechanisms underlying the regulatory effect of MS-TSNPs@miR-155 on ECM metabolism. (A) A volcano plot was generated to illustrate the DEGs identified via mRNA-seq analysis, with 114 upregulated and 260 downregulated DEGs identified. (B)–(I) Heatmap visualizing the DEGs associated with various signaling and cellular processes, including “ECM”, “signaling and cellular process”, “genetic information processing”, “environment information processing”, “metabolism”, “inflammation”, “development and regeneration” and “cell growth and death”. (J) GO enrichment analysis revealed that the majority of the DEGs were involved in ECM metabolism, cell growth, inflammation, ECM binding, signaling processes and inflammatory processes. (K) The expression and crossover of every gene within the principal pathways of significance. (L) and (M) KEGG pathway analysis revealing the potential pathways implicated in the observed effects.

Changes in the expression of ECM metabolism, cellular development, and apoptosis-related gene expression suggest that TSNPs@miR-155 is capable of promoting ECM synthesis and modulating apoptotic activity. GO analyses were used to identify key biological processes impacted by TSNPs@miR-155, revealing that it significantly impacted ECM synthesis, inflammation, and cell growth (Fig. 5J and Fig. S8J).

The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses indicated that the pathways most strongly associated with genes differentially expressed in NPCs treated with microgel included ECM synthesis and degradation, glycosaminoglycan binding, and cell adhesion pathways (Fig. 5L and M). These pathways are linked to a range of pathological and physiological processes, including the control of proliferation and apoptosis through inhibition of the PI3K/Akt signaling pathway activation and the further regulation of ECM synthesis. Compared to the TBHP-treated group, the expression levels of IBSP, FGF7, and PGF—key genes involved in the PI3K/Akt signaling pathway—were significantly reduced (Fig. 5K). IBSP is also related to ECM–receptor interactions, highlighting its potential involvement in ECM regulation. This observation aligns with the findings of Gong et al., who demonstrated that suppression of the PI3K/Akt pathway could inhibit nucleus pulposus cell apoptosis, thereby maintaining the homeostasis of both intra- and peri-disc microenvironments and mitigating intervertebral disc degeneration.⁶⁸ Moreover, miR-155 has been reported to target TGFβR2, leading to suppression of the PI3K/Akt signaling pathway in IDD.^22,69 Our results further support that the microgel system can regulate apoptosis and ECM regeneration by modulating the PI3K/Akt pathway, primarily through miR-155-mediated targeting of TGFβR2. Changes in Cilp, Itga4, LAMC2, and other genes also provide support for ongoing ECM regenerative activity. And this, together with the fact that Cxcl6, CCL2, CCL11, MMP13, Cxcl3 and Cxcl2 are also related to the IL-17 signaling pathway, which plays an important role in IDD by mediating inflammation, thereby influencing matrix degradation, angiogenesis, and the autophagy and proliferation of nucleus pulposus cells, thus accelerating the progression of IDD.^70,71 Notably, expression levels of Cxcl6, CCL2, Cxcl3, and Cxcl2 were significantly elevated in the TBHP-treated group (Fig. S8K), highlighting these genes as potential critical targets regulated by miR-155 during IDD. Collectively, these results suggest that the microgel system can modulate the inflammatory response to influence ECM regeneration, and the microgel system thus exhibited expected anti-inflammatory activity together with the ability to restore the ECM homeostatic balance and the modulation of apoptotic cell death.

3.6. In vivo therapeutic effects of MS-TSNPs@miR-155 in a rat IDD model

Subsequently, the capacity of the smart microgel gene delivery system to modulate the metabolic equilibrium of the ECM and counteract the progression of IDD was evaluated in vivo (Fig. 6A). At 4 and 8 weeks of treatment, X-rays and MRI scanning were used to assess the disc height index (DHI) as a measure of disc degeneration. In the negative control group, DHI values revealed significant decreases in the height of the intervertebral space, while varying degrees of recovery were observed in the different treatment groups, with the greatest recovery at both 4 and 8 weeks having been observed in the MS-TSNPs@miR-155 group (Fig. 6B–D). These results demonstrated the irreplaceable role of mircrogels in the slow release and prolonged half-life of miRNAs. Meanwhile, compared with the untreated group, the MS group showed less change in DHI at weeks 4 and 8, which we believe may be due to the fact that the microgel provides some mechanical support to the degenerated disc, which helps to slow down the progression of IDD.⁷² MRI is the gold standard for the diagnosis of IDD, and its t2-weighted signal intensity reflects the water content in the intervertebral disc; MRI signal intensity was classified according to the modified Thomson classification method.⁷³ MRI results revealed a significant increase in signal intensity in the MS-TSNPs@miR-155 group at 4 and 8 weeks of treatment (Fig. 6E), and similar results were obtained based on grading (Fig. 6F). The gradually enhanced IDD recovery in the MS-TSNPs@miR-155 group reflected by the X-ray and MRI results firmly proved the key role of smart microgel gene delivery systems in improving the transfection efficiency and prolonging the half-life of miR-155, as well as alleviating the inflammatory storm in IDD.

Fig. 6 Therapeutic effects in a rat model of IDD. (A) Schematic of the in vivo therapy process. (B) X-ray and (E) MRI images of IVD demonstrate significant improvements in the disc height and water content following treatment with MS-TSNPs@miR-155. (C) and (D) Quantitative analysis of the disc height index (DHI) and (F) MRI-based grade further confirmed the reparative effect of MS-TSNPs@miR-155 on IDD. (G) Histological analysis using H&E and safranin-O/fast green staining at 4 and 8 weeks provides representative images of the different treatments. (H) Histological grades supporting the treatment efficacy (NC NPs: negative control miRNA nanoparticles; * 0.01 ≤ p < 0.05, ** 0.001 ≤ p < 0.01, ns: not significant, n = 3; t-tests and one-way ANOVA with Tukey's multiple comparison test).

Histological analyses performed at 4 and 8 weeks after treatment provided further confirmation of the ability of the prepared microgel delivery system to promote the restoration of ECM integrity. Through H&E staining of the morphological characteristics of the NPs, AC, and borders, atrophy of the NPs was evident in the NC group together with the blurring of the border and the gradual replacement of the normal contents with AF. As shown in Fig. 6G, in the treatment groups, NP recovery was observed, with the best recovery being evident in the MS-TSNPs@miR-155 group. Safranin-O/fast green staining was used to detect collagen (green) and proteoglycan (orange) levels in IVDs. These analyses revealed the near total absence of proteoglycans and their replacement by collagen in the NC group at the 4 and 8-week time points, while abundant proteoglycan levels were observed in the MS-TSNPs@miR-155 group. The synergistic benefits of MS-TSNPs@miR-155 treatment to the process of NP regeneration were further confirmed through histological scores after treatment (Fig. 6H).

To further understand the therapeutic benefit of IDD treatment and its relationship with ECM homeostasis restoration, anti-apoptosis and inflammation suppression, immunohistochemical staining for IL-10, TNF-α, BCL-2, BAX, COL-II and MMP-13 was performed on NP tissue samples from different treatment groups at 4 and 8-week time points.

The ability of the microgel drug system to regulate inflammation was further assessed by measuring pro- and anti-inflammatory factors. Immunofluorescence revealed that the MS-TSNPs@miR-155 effectively upregulated the expression of the anti-inflammatory cytokine IL-10 (Fig. 7A and Fig. S10A). Conversely, treatment with the MS-TSNPs@miR-155 significantly downregulated the expression of the proinflammatory cytokine TNF-α (Fig. 7B and Fig. S10B). BCL-2 is an anti-apoptosis protein that belongs to the BCL-2 family of proteins, and its main function is to maintain cell survival by inhibiting apoptosis (programmed death) in the mitochondrial pathway. BAX is a perforating protein belonging to the BCL-2 family, and apoptosis begins when the outer mitochondrial membrane is perforated or penetrated by BAX or BCL-2 homologous antagonist/killer (Buck) proteins.⁷⁴ Consistent with the expected results compared to the other groups, the MS-TSNPs@miR-155 group showed significantly higher levels of BCL-2 expression, while BAX was less expressed or even not expressed (Fig. 7C, D and Fig. S10C, D). COL-II is the most representative component of the ECM, and it was present at significantly higher levels in the MS-TSNPs@miR-155 group relative to the other groups, which exhibited less or even no COL-II expression (Fig. 7E and Fig. S10E). MMP-13 levels were also significantly reduced in the MS-TSNPs@miR-155-treated IDD model animals (Fig. 7F and Fig. S10F). These findings suggest that IDD-mediated inhibition of inflammation through this two-stage treatment approach was sufficient to effectively mitigate IDD-related inflammation while restoring ECM metabolic homeostasis, thereby providing a robust approach to slowing or reversing the progression of this debilitating condition.

Fig. 7 Immunofluorescence assessment of apoptosis factors, inflammatory factors and ECM metabolism in 8-week rat IDD models. Representative images depicting (A) anti-inflammatory factor production, (B) proinflammatory factor production, (C), (D) apoptosis factor production, (E) ECM synthesis, and (F) degradation in IDD models. (G) A heatmap illustrating the intensity of these factors.

4. Conclusion

In summary, this study successfully developed an injectable, pH/ROS-responsive microgel drug delivery system that inhibits NP inflammation and anti-apoptosis and promotes regeneration of the extracellular matrix and restoration of tissue function in an experimental model of IDD. We delivered miR-155 with TSNPs to create novel targeted gene delivery vectors with anti-inflammatory properties, termed TSNPs@miR-155. Delivered miR-155 efficiently corrected excessive apoptosis in NPC and promoted extracellular matrix synthesis. In addition, we loaded TSNPs@miR-155 onto PBA-functionalized GelMA microspheres, thereby creating a smart microgel delivery system with a microenvironmental response and sustained miRNA release (Fig. 1).

However, there are still several limitations in this study. First, while positive results were obtained in small animal models, the lack of large animal model validation is a limitation. Large animal models (e.g., pigs or sheep) are more physiologically similar to humans, and further testing in these models is needed to assess efficacy, safety, and biocompatibility. Second, although the system showed promise in in vitro and small animal studies, challenges in large-scale manufacturing remain. Issues such as production costs, process optimization, and ensuring batch consistency must be addressed before clinical application. Finally, long-term in vivo safety, especially regarding strontium ion accumulation, requires further investigation.

The microgel drug system showed efficacy in reducing inflammation and promoting the production of the extracellular matrix in the medulla. Thus, this biocompatible microgel drug system has the potential to promote the expression of anabolic markers and restore the metabolic balance of the nucleus pulposus ECM. TSNPs have significant gene protection capacity, strong cellular affinity and significant anti-inflammatory effects. The presence of an inflammatory microenvironment within the degenerating disc has the potential to induce the release of TSNPs@miR-155 from the microgel drug system. miR-155 release inhibits inflammation, regulates apoptosis of NPCs, and promotes extracellular matrix synthesis. Thus, the use of the MS-TSNPs@miR-155 system effectively slowed the progression of IDD and promoted regeneration. This microgel drug system was used to treat IDD restoring the characteristics of the medulla similar to those of a healthy medulla.

Author contributions

Qingquan Kong, Weiqiang Lan and Chuan Guo designed the project, Weiqiang Lan and Chuan Guo completed the animal experiment and cell experiments, Statistical analysis was done by Weiqiang Lan. Yu Wang, Dengbo Yao and Yuheng Liu reviewed related literature, Weifei Zhang drafted the manuscript, and everyone participated in the revision and agreed to the submission of the manuscript.

Conflicts of interest

There is no conflict to declare.

Data availability

Detailed experimental methods, raw data charts (such as microsphere characterization, nanoparticle characterization, miRNA encapsulation efficiency, and representative images of immunofluorescence), and RNA sequencing analysis results (volcano plots, heat maps, KEGG/GO pathway enrichment analysis) can be found in the SI. See DOI: https://doi.org/10.1039/d5tb01505g

Acknowledgements

This work was partially supported by the Sichuan Science and Technology Program (2024NSFSC1814), China Postdoctoral Science Foundation (GZC20231805), National Natural Science Foundation of China (82202747 and 82372447), Post-Doctor Research Project, West China Hospital, Sichuan University (2023HXBH077 and 2023HXBH082), and Science and Technology Major Project of Tibetan Autonomous Region of China (XZ202201ZD0001G and XZ202303ZY0007G).

References

1. M. Aleku, K. Nelson, A. Abio, M. Lowery Wilson and H. Lule, Lower Back Pain as an Occupational Hazard Among Ugandan Health Workers, Front. Public Health, 2021, 9, 761765.
2. W. Liu, Z. Ma, Y. Wang and J. Yang, Multiple nano-drug delivery systems for intervertebral disc degeneration: Current status and future perspectives, Bioact. Mater., 2023, 23, 274–299.
3. GBD 2019 Diseases and Injuries Collaborators, Global burden of 369 diseases and injuries in 204 countries and territories, 1990-2019: a systematic analysis for the Global Burden of Disease Study 2019, Lancet, 2020, 396(10258), 1204–1222.
4. B. O. Ren, P. Khambete, C. Rasendran, J. A. O'Donnell and N. U. Ahn, Quantifying the Economic Impact of Depression for Spine Patients in the United States, Clin. Spine Surg., 2022, 35(3), E374-e9.
5. R. J. Gatchel, The Continuing and Growing Epidemic of Chronic Low Back Pain, Healthcare, 2015, 3(3), 838–845.
6. B. Lv, W. Gan, Z. Cheng, J. Wu, Y. Chen and K. Zhao, et al., Current Insights Into the Maintenance of Structure and Function of Intervertebral Disc: A Review of the Regulatory Role of Growth and Differentiation Factor-5, Front. Pharmacol., 2022, 13, 842525.
7. H. Swahn, J. Mertens, M. Olmer, K. Myers, T. S. Mondala and P. Natarajan, et al., Shared and Compartment-Specific Processes in Nucleus Pulposus and Annulus Fibrosus During Intervertebral Disc Degeneration, Adv. Sci., 2024, 11(17), e2309032.
8. X. Hu, Z. Wang, H. Zhang, P. Cui, Y. Li and X. Chen, et al., Single-cell sequencing: New insights for intervertebral disc degeneration, Biomed. Pharmacother., 2023, 165, 115224.
9. T. Ma, J. Wu, S. Chen, J. Bian, G. Gao and L. Nong, pH-Responsive Modified HAMA Microspheres Regulate the Inflammatory Microenvironment of Intervertebral Discs, ACS Appl. Mater. Interfaces, 2024, 16(46), 63295–63305.
10. L. Sorokin, The impact of the extracellular matrix on inflammation, Nat. Rev. Immunol., 2010, 10(10), 712–723.
11. L. Kang, H. Zhang, C. Jia, R. Zhang and C. Shen, Epigenetic modifications of inflammation in intervertebral disc degeneration, Ageing Res. Rev., 2023, 87, 101902.
12. C. Guo, Y. Liu, Z. Zhao, Y. Wu, Q. Kong and Y. Wang, Regulating inflammation and apoptosis: A smart microgel gene delivery system for repairing degenerative nucleus pulposus, J. Controlled Release, 2024, 365, 1004–1018.
13. J. Krol, I. Loedige and W. Filipowicz, The widespread regulation of microRNA biogenesis, function and decay, Nat. Rev. Genet., 2010, 11(9), 597–610.
14. G. A. Calin and C. M. Croce, MicroRNA signatures in human cancers, Nat. Rev. Cancer, 2006, 6(11), 857–866.
15. J. R. You, Z. J. Wen, J. W. Tian, X. B. Lv, R. Li and S. P. Li, et al., Crosstalk between ubiquitin ligases and ncRNAs drives cardiovascular disease progression, Front. Immunol., 2024, 15, 1335519.
16. J. Zacharjasz, A. M. Mleczko, P. Bąkowski, T. Piontek and K. Bąkowska-Żywicka, Small Noncoding RNAs in Knee Osteoarthritis: The Role of MicroRNAs and tRNA-Derived Fragments, Int. J. Mol. Sci., 2021, 22, 11.
17. T. Lan, H. Shiyu, Z. Shen, B. Yan and J. Chen, New insights into the interplay between miRNAs and autophagy in the aging of intervertebral discs, Ageing Res. Rev., 2021, 65, 101227.
18. S. Chen, S. Liu, K. Ma, L. Zhao, H. Lin and Z. Shao, TGF-β signaling in intervertebral disc health and disease, Osteoarthr. Cartil., 2019, 27(8), 1109–1117.
19. H. Q. Wang, X. D. Yu, Z. H. Liu, X. Cheng, D. Samartzis and L. T. Jia, et al., Deregulated miR-155 promotes Fas-mediated apoptosis in human intervertebral disc degeneration by targeting FADD and caspase-3, J. Pathol., 2011, 225(2), 232–242.
20. L. Xie, Z. Chen, M. Liu, W. Huang, F. Zou and X. Ma, et al., MSC-Derived Exosomes Protect Vertebral Endplate Chondrocytes against Apoptosis and Calcification via the miR-31-5p/ATF6 Axis, Mol. Ther.–Nucleic Acids, 2020, 22, 601–614.
21. L. Xie, Z. Chen, M. Liu, W. Huang, F. Zou and X. Ma, et al., MSC-Derived Exosomes Protect Vertebral Endplate Chondrocytes against Apoptosis and Calcification via the miR-31-5p/ATF6 Axis, Mol. Ther.–Nucleic Acids, 2020, 22, 601–614.
22. D. Chen, X. Jiang and H. Zou, hASCs-derived exosomal miR-155-5p targeting TGF0R2 promotes autophagy and reduces pyroptosis to alleviate intervertebral disc degeneration, J. Orthop. Translat., 2023, 39, 163–176.
23. J. Zhu, X. Zhang, W. Gao, H. Hu, X. Wang and D. Hao, lncRNA/circRNA-miRNA-mRNA ceRNA network in lumbar intervertebral disc degeneration, Mol. Med. Rep., 2019, 20(4), 3160–3174.
24. S. Ghafouri-Fard, T. Azimi, B. M. Hussen, A. Abak, M. Taheri and N. A. Dilmaghani, Non-coding RNA Activated by DNA Damage: Review of Its Roles in the Carcinogenesis, Front. Cell Dev. Biol., 2021, 9, 714787.
25. J. L. Rouge, T. L. Sita, L. Hao, F. M. Kouri, W. E. Briley and A. H. Stegh, et al., Ribozyme-Spherical Nucleic Acids, J. Am. Chem. Soc., 2015, 137(33), 10528–10531.
26. C. Diener, A. Keller and E. Meese, Emerging concepts of miRNA therapeutics: from cells to clinic. Trends in genetics, Trends Genet., 2022, 38(6), 613–626.
27. H. H. Genedy, P. Humbert, B. Laoulaou, B. Le Moal, M. Fusellier and C. Passirani, et al., MicroRNA-targeting nanomedicines for the treatment of intervertebral disc degeneration, Adv. Drug Delivery Rev., 2024, 207, 115214.
28. M. Ramamoorth and A. Narvekar, Non viral vectors in gene therapy- an overview, J. Clin. Diagn. Res., 2015, 9(1), Ge01–Ge06.
29. Y. S. Choi, M. Y. Lee, A. E. David and Y. S. Park, Nanoparticles for gene delivery: therapeutic and toxic effects, Mol. Cell. Toxicol., 2014, 10(1), 1–8.
30. M. J. Mitchell, M. M. Billingsley, R. M. Haley, M. E. Wechsler, N. A. Peppas and R. Langer, Engineering precision nanoparticles for drug delivery, Nat. Rev. Drug Discovery, 2021, 20(2), 101–124.
31. Y. Ding, F. Li, Y. Wang, W. Pan, X. Fu and S. Tan, Nanomedicine Approaches for Intervertebral Disc Regeneration: From Bench to Bedside, Pharmaceutics, 2025, 17, 3.
32. S. Shi, X. Ou, C. Liu, R. Li, Q. Zheng and L. Hu, Nanotechnology-Enhanced Pharmacotherapy for Intervertebral Disc Degeneration Treatment, Int. J. Nanomed., 2024, 19, 14043–14058.
33. K. Lundstrom, Viral Vectors in Gene Therapy, Diseases, 2018, 6, 2.
34. A. Bakhtiar and E. H. Chowdhury, PH-responsive strontium nanoparticles for targeted gene therapy against mammary carcinoma cells, Asian J. Pharm. Sci., 2021, 16(2), 236–52..
35. A. Bakhtiar, Q. X. Liew, K. Y. Ng and E. H. Chowdhury, Active targeting via ligand-anchored pH-responsive strontium nanoparticles for efficient nucleic acid delivery into breast cancer cells, J. Pharm. Invest., 2022, 52(2), 243–257.
36. Z. Li, Y. Zhang, Y. Zhao, X. Gao, Z. Zhu and Y. Mao, et al., Graded-Three-Dimensional Cell-Encapsulating Hydrogel as a Potential Biologic Scaffold for Disc Tissue Engineering, Tissue Eng. Regener. Med., 2022, 19(5), 1001–1012.
37. D. Su, X. Bai and X. He, Research progress on hydrogel materials and their antifouling properties, Eur. Polym. J., 2022, 181, 111665.
38. Z. Zhu, Q. Yu, H. Li, F. Han, Q. Guo and H. Sun, et al., Vanillin-based functionalization strategy to construct multifunctional microspheres for treating inflammation and regenerating intervertebral disc, Bioact. Mater., 2023, 28, 167–182.
39. J. Yang, Y. Zhu, F. Wang, L. Deng, X. Xu and W. Cui, Microfluidic liposomes-anchored microgels as extended delivery platform for treatment of osteoarthritis, Chem. Eng. J., 2020, 400.
40. B. G. De Geest, J. P. Urbanski, T. Thorsen, J. Demeester and S. C. De Smedt, Synthesis of monodisperse biodegradable microgels in microfluidic devices, Langmuir, 2005, 21(23), 10275–10279.
41. A. C. Daly, L. Riley, T. Segura and J. A. Burdick, Hydrogel microparticles for biomedical applications, Nat. Rev. Mater., 2020, 5(1), 20–43.
42. Z. Dong, X. Meng, W. Yang, J. Zhang, P. Sun and H. Zhang, et al., Progress of gelatin-based microspheres (GMSs) as delivery vehicles of drug and cell, Mater. Sci. Eng., C, 2021, 122, 111949.
43. Q. He, J. Zhang, Y. Liao, E. V. Alakpa, V. Bunpetch and J. Zhang, et al., Current advances in microsphere based cell culture and tissue engineering, Biotechnol. Adv., 2020, 39, 107459.
44. Z. Chen, Z. Lv, Z. Zhang, D. A. Weitz, H. Zhang and Y. Zhang, et al., Advanced microfluidic devices for fabricating multi-structural hydrogel microsphere, Exploration, 2021, 1(3), 20210036.
45. E. Jalalvandi and A. Shavandi, Shear thinning/self-healing hydrogel based on natural polymers with secondary photocrosslinking for biomedical applications, J. Mech. Behav. Biomed. Mater., 2019, 90, 191–201.
46. Z. Yin, T. Zheng, C. T. Ho, Q. Huang, Q. Wu and M. Zhang, Improving the stability and bioavailability of tea polyphenols by encapsulations:a review, Food Sci. Hum. Health, 2022, 11, 537–556.
47. X. Hu, J. He, L. Qiao, C. Wang, Y. Wang and R. Yu, et al., Multifunctional Dual Network Hydrogel Loaded with Novel Tea Polyphenol Magnesium Nanoparticles Accelerates Wound Repair of MRSA Infected Diabetes, Adv. Funct. Mater., 2024, 34, 22.
48. Y. Ye, Q. Zheng, Z. Wang, S. Wang, Z. Lu and Q. Chu, et al., Metal-phenolic nanoparticles enhance low temperature photothermal therapy for bacterial biofilm in superficial infections, J. Nanobiotechnol., 2024, 22(1), 713.
49. Y. Guan and Y. Zhang, Boronic acid-containing hydrogels: synthesis and their applications, Chem. Soc. Rev., 2013, 42(20), 8106–8121.
50. A. Stubelius, S. Lee and A. Almutairi, The Chemistry of Boronic Acids in Nanomaterials for Drug Delivery, Acc. Chem. Res., 2019, 52(11), 3108–3119.
51. B. Tao, M. Chen, C. Lin, L. Lu, Z. Yuan and J. Liu, et al., Zn-incorporation with graphene oxide on Ti substrates surface to improve osteogenic activity and inhibit bacterial adhesion, J. Biomed. Mater. Res., Part A, 2019, 107(10), 2310–2326.
52. L. L. Wang, Y. Liu, J. J. Chung, T. Wang, A. C. Gaffey and M. Lu, et al., Local and sustained miRNA delivery from an injectable hydrogel promotes cardiomyocyte proliferation and functional regeneration after ischemic injury, Nat. Biomed. Eng., 2017, 1, 983–992.
53. Y. Wang, M. Deng, Y. Wu, C. Hu, B. Zhang and C. Guo, et al., Sustained gene delivery from inflammation-responsive anti-inflammatory hydrogels promotes extracellular matrix metabolism balance in degenerative nucleus pulposus, Composites, Part B, 2022, May 1, 236.
54. G. Zheng, Z. Pan, Y. Zhan, Q. Tang, F. Zheng and Y. Zhou, et al., TFEB protects nucleus pulposus cells against apoptosis and senescence via restoring autophagic flux, Osteoarthr. Cartil., 2019, 27(2), 347–357.
55. Y. Wang, Y. Wu, B. Zhang, C. Zheng, C. Hu and C. Guo, et al., Repair of degenerative nucleus pulposus by polyphenol nanosphere-encapsulated hydrogel gene delivery system, Biomaterials, 2023, 298, 122132.
56. M. E. Karim, J. Shetty, R. A. Islam, A. Kaiser, A. Bakhtiar and E. H. Chowdhury, Strontium Sulfite: A New pH-Responsive Inorganic Nanocarrier to Deliver Therapeutic siRNAs to Cancer Cells, Pharmaceutics, 2019, 11, 2.
57. S. Shrestha, T. Tieu, M. Wojnilowicz, N. H. Voelcker, J. S. Forsythe and J. E. Frith, Delivery of miRNAs Using Porous Silicon Nanoparticles Incorporated into 3D Hydrogels Enhances MSC Osteogenesis by Modulation of Fatty Acid Signaling and Silicon Degradation, Adv. Healthcare Mater., 2024, 13(20), e2400171.
58. K. Zhang, R. Shen, Y. Zhang, X. Tian and W. Wang, Modulating in vitro gastrointestinal digestion of nanocellulose-stabilized pickering emulsions by altering particle surface charge, Food Chem., 2024, 434, 137521.
59. S. Hossain, S. Tada, T. Akaike and E. H. Chowdhury, Influences of electrolytes and glucose on formulation of carbonate apatite nanocrystals for efficient gene delivery to mammalian cells, Anal. Biochem., 2010, 397(2), 156–161.
60. M. Taleb, Y. Ding, B. Wang, N. Yang, X. Han and C. Du, et al., Dopamine Delivery via pH-Sensitive Nanoparticles for Tumor Blood Vessel Normalization and an Improved Effect of Cancer Chemotherapeutic Drugs, Adv. Healthcare Mater., 2019, 8(18), e1900283.
61. K. Wang, T. Chen, X. Ying, Z. Zhang, Z. Shao and J. Lin, et al., Ligustilide alleviated IL-1β induced apoptosis and extracellular matrix degradation of nucleus pulposus cells and attenuates intervertebral disc degeneration in vivo, Int. Immunopharmacol., 2019, 69, 398–407.
62. Y. Chen, R. Luo, J. Li, S. Wang, J. Ding and K. Zhao, et al., Intrinsic Radical Species Scavenging Activities of Tea Polyphenols Nanoparticles Block Pyroptosis in Endotoxin-Induced Sepsis, ACS Nano, 2022, 16(2), 2429–2441.
63. Z. Yi, G. Chen, X. Chen, X. Ma, X. Cui and Z. Sun, et al., Preparation of Strong Antioxidative, Therapeutic Nanoparticles Based on Amino Acid-Induced Ultrafast Assembly of Tea Polyphenols, ACS Appl. Mater. Interfaces, 2020, 12(30), 33550–33563.
64. Y. He, Z. Li, T. Xu, D. Luo, Q. Chi and Y. Zhang, et al., Polystyrene nanoplastics deteriorate LPS-modulated duodenal permeability and inflammation in mice via ROS drived-NF-κB/NLRP3 pathway, Chemosphere, 2022, 307(Pt 1), 135662.
65. E. S. Silagi, Z. R. Schoepflin, E. L. Seifert, C. Merceron, E. Schipani and I. M. Shapiro, et al., Bicarbonate Recycling by HIF-1-Dependent Carbonic Anhydrase Isoforms 9 and 12 Is Critical in Maintaining Intracellular pH and Viability of Nucleus Pulposus Cells, J. Bone Miner. Res., 2018, 33(2), 338–355.
66. Y. Li, C. Shang, Z. Liu, J. Han, W. Li and P. Xiao, et al., Apoptin mediates mitophagy and endogenous apoptosis by regulating the level of ROS in hepatocellular carcinoma, Cell Commun. Signaling, 2022, 20(1), 134.
67. J. He, M. Qin, Y. Chen, Z. Hu, L. Ye and T. Hui, EZH2 Promotes Extracellular Matrix Degradation via Nuclear Factor-κB (NF-κB) and p38 Signaling Pathways in Pulpitis, Inflammation, 2021, 44(5), 1927–1936.
68. Y. Gong, J. Qiu, T. Jiang, Z. Li, W. Zhang and X. Zheng, et al., Maltol ameliorates intervertebral disc degeneration through inhibiting PI3K/AKT/NF-κB pathway and regulating NLRP3 inflammasome-mediated pyroptosis, Inflammopharmacology, 2023, 31(1), 369–384.
69. X. Luo, J. Dong, X. He, L. Shen, C. Long and F. Liu, et al., MiR-155-5p exerts tumor-suppressing functions in Wilms tumor by targeting IGF2 via the PI3K signaling pathway, Biomed. Pharmacother., 2020, 125, 109880.
70. J. H. Tan, Z. P. Li, L. L. Liu, H. Liu and J. B. Xue, IL-17 in intervertebral disc degeneration: Mechanistic insights and therapeutic implications, Cell Biol. Int., 2022, 46(4), 535–547.
71. S. Majumder and M. J. McGeachy, IL-17 in the Pathogenesis of Disease: Good Intentions Gone Awry, Annu. Rev. Immunol., 2021, 39, 537–556.
72. V. G. Muir, M. Fainor, B. S. Orozco, R. L. Hilliard, M. Boyes and H. E. Smith, et al., Injectable Radiopaque Hyaluronic Acid Granular Hydrogels for Intervertebral Disc Repair, Adv. Healthcare Mater., 2024, 13(25), e2303326.
73. K. Masuda, Y. Aota, C. Muehleman, Y. Imai, M. Okuma and E. J. Thonar, et al., A novel rabbit model of mild, reproducible disc degeneration by an anulus needle puncture: correlation between the degree of disc injury and radiological and histological appearances of disc degeneration, Spine, 2005, 30(1), 5–14.
74. F. Lv, F. Qi, Z. Zhang, M. Wen, J. Kale and A. Piai, et al., An amphipathic Bax core dimer forms part of the apoptotic pore wall in the mitochondrial membrane, EMBO J., 2021, 40(14), e106438.

---

Footnote

† W. L. and C. G. contributed equally to this work.

---