Investigating the neuroprotective effects of polyunsaturated fatty acids in egg yolk phospholipids upon oxidative damage in HT22 cells

Abstract

Egg yolk phospholipids are primarily composed of various fatty acids, lysophosphatidylcholine and lysophosphatidylethanolamine. Existing studies have revealed the neuroprotective activity of egg yolk phospholipids. However, it is not clear which digestion products of phospholipids exert neuroprotective activity. The objective of this study was to investigate the neuroprotective effects of different structural components in egg yolk phospholipids based on a DMNQ-induced oxidative damage in HT22 cells. The findings demonstrated that pre-treatment with diverse egg yolk phospholipid components, particularly the polyunsaturated fatty acids, markedly elevated the cell viability and superoxide dismutase activity, diminished the ROS generation, reduced the malondialdehyde levels and elevated the mitochondrial membrane potential. Furthermore, RNA-Seq analysis demonstrated that unsaturated fatty acids exert its neuroprotective effects by upregulating the genes involved in cell proliferation (Jag2 and Ypel3), nervous system development (Ntf5), DNA damage repair (H2ax), and other related processes. These findings provide a theoretical basis for future studies on the characteristic structure of egg yolk phospholipids with profound neuroprotective effects.

---

1. Introduction

Neurodegenerative diseases, such as Alzheimer's disease, significantly affect the quality of life of patients in addition to exerting adverse effects on their cognitive abilities and motor function.¹ With the accelerated aging of the world's population, epidemiological data on these diseases indicate a concerning trend and have become a significant public health challenge.² The aetiology of neurodegenerative diseases is complex and varied, with oxidative damage to nerve cells being identified as a key factor in the development of these conditions.^3,4 Oxidative damage occurs when the production of the reactive oxygen species (ROS) and other free radicals exceeds the capacity of the cell's antioxidant defence mechanisms.^5,6 In neuronal cells, the overproduction of ROS has been demonstrated to directly damage key cellular components, including lipids, proteins and DNA.⁷ This damage can further result in the loss of mitochondrial membrane potential, blockage of ATP synthesis, and cell death through activation of the mitochondrial apoptotic pathway.⁸ Furthermore, it has been demonstrated that oxidative damage can disrupt neurotransmitter homeostasis and synaptic plasticity by altering the kinetics of vesicle release from presynaptic membranes and oxidizing postsynaptic receptors such as NMDA receptors.⁹ These processes adversely affect the nervous system, ultimately influencing the onset and progression of neurodegenerative diseases.¹⁰ Thus, it can be reasonably deduced that therapeutic approaches that can clear oxidative damages may be promising for the prevention and treatment of neurodegenerative diseases.

Phospholipids are major components of cell membranes, and the fatty acids in the structure have important effects on membrane fluidity, membrane protein function and cell signalling.¹¹ Dietary egg yolk phospholipids are thought to have neuroprotective activities.¹² In a previous study, Chen et al. demonstrated that pre-treatment with egg yolk phosphatidylcholines (PCs) effectively attenuated scopolamine-induced oxidative stress and associated neurotoxicity in PC12 cells.¹³ The neuroprotective activity of egg yolk PCs was achieved by down-regulating acetylcholinesterase (AChE) activity, monoamine oxidase (MAO) activity, and malondialdehyde (MDA) levels.¹³ The findings of Tan et al. also reported that PC has the capacity to ameliorate functional brain impairments, including neuronal damage and synaptic dysfunction.¹⁴ Furthermore, Kim et al. demonstrated that PC therapy mitigated the neuronal damage and microglia activation induced by docetaxel in the sciatic and spinal regions.¹⁵ However, egg yolk phospholipids are a complex mixture of phospholipids, whose structure consists of a variety of different phospholipid molecules.¹⁶ Following digestion and absorption, they are metabolised into smaller molecules, including lysophosphatidylcholine, lysophosphatidylethanolamine and a range of free fatty acids.^17,18 It is still unclear which of these small molecules is responsible for the neuroprotective function.

In order to simulate oxidative stress in neurodegenerative lesions, dimethylnaphthoquinone (DMNQ) was selected as the inducer on account of its capacity to generate controlled ROS and its high degree of congruence with the pathology of neurodegenerative diseases. DMNQ produces sustained intracellular superoxide anions (O₂⁻) by interacting with the mitochondrial electron transport chain, thereby mimicking chronic oxidative stress observed in neurodegeneration.¹⁹ Consequently, we constructed an in vitro neurodegenerative model based on the DMNQ-induced oxidative damage in HT22 cells¹⁹ to elucidate the potential neuroprotective effects of distinct small molecular lipids resulting from the digestion and absorption of egg yolk phospholipids in counteracting oxidative damage. This work is aimed at elucidating the functional differences of specific egg yolk phospholipid molecules in cellular defense mechanisms by comparing different small-molecule lipids, with a focus on providing new strategies for the prevention and treatment of neurodegenerative diseases.

2. Materials and methods

2.1. Materials

L-α-Phosphatidylcholine (purity ≥ 99%) was obtained from Sigma Aldrich (St Louis, Missouri, USA). L-α-Phosphatidylethanolamine (purity ≥ 99%), palmitic acid, stearic acid, oleic acid, linoleic acid, linolenic acid, arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid were purchased from Aladdin (Shanghai, China). The murine hippocampal neuronal cell line HT22 (product number iCell-m020) were bought from iCell Bioscience, Inc. (Shanghai) Biotechnology Co., Ltd. DMNQ (purity ≥ 99%) was provided by MedChemExpress (Shanghai, China). Dulbecco's modified Eagle's medium (DMEM) was acquired from Gibco Life Technologies. Fetal bovine serum was obtained from Zhengbo Biotechnology (Beijing, China). A penicillin mixture, dimethyl sulfoxide, trypsin (0.25%), DAPI staining solution and Catalase (CAT) activity assay kit were bought from Solarbio Technology Co., Ltd (Beijing, China). A Cell Counting Kit-8 assay kit was obtained from Beyotime Biotechnology (Shanghai, China). The JC-1 assay kit was purchased from Aidisheng (Jiangsu, China). The reactive oxygen species (ROS) assay kit, superoxide dismutase (SOD) assay kit, and malondialdehyde (MDA) assay kit were acquired from Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). CoraLite®594 was provided by Thermo Fisher (Shanghai, China).

2.2. Cells culture

The murine hippocampal neuronal cell line HT22 was maintained in DMEM medium, supplemented with 10% (v/v) fetal bovine serum, 100 U mL⁻¹ penicillin, and 100 μg mL⁻¹ streptomycin in a humidified incubator of 5% CO₂ at 37 °C.

2.3. Cytotoxicity assay in HT22 cells

To determine the appropriate experimental concentrations of the phospholipid molecules and fatty acid standards for subsequent studies, the effects on the HT22 cell viability were evaluated using the CCK-8 assay. HT22 cells were divided into an untreated control group and treatment groups receiving phospholipid molecules or fatty acid standards. After reaching the logarithmic growth phase, cells were treated with 100 μL of test compounds per well. The final concentrations of lysophosphatidylcholine and lysophosphatidyl ethanolamine were adjusted to 1 and 2 mg L⁻¹, respectively, while each fatty acid standard was tested at concentrations of 1 and 10 mg L⁻¹. Following 24 hour incubation, absorbance at 450 nm was measured according to the standard CCK-8 protocol. Each experimental condition was performed in triplicate, with cell viability expressed as a percentage relative to the control group.

2.4. DMNQ induced oxidative damage in HT22 cells

HT22 cells in the logarithmic growth phase were collected for inoculation into 96-well culture plates. Following this, cells were treated with DMNQ at varying concentrations (0.5, 1, 2, 4, 10 μM) of 24 h when cell growth reached 80% to 90%. DMNQ was dissolved in DMSO to prepare working solutions at different concentrations, which were added to 96-well culture plates to expose the cells to DMNQ-induced oxidative stress. No DMNQ was added to the control group. The effect of DMNQ on HT22 cell viability was evaluated using the Cell Counting Kit-8 (CCK-8) assay to identify the optimal concentration of DMNQ for modelling oxidative damage.

2.5. Cell viability assay

The HT22 cells were randomly divided into three groups: a control group, a DMNQ model group, and a drug administration group. The HT22 cells were cultured in 96-well cell culture plates until they reached the logarithmic growth phase. The HT22 cells were pretreated with phospholipids (1 mg l⁻¹ and 2 mg l⁻¹) and fatty acids (1 mg l⁻¹ and 10 mg l⁻¹) of different structural composition for 5 h. Thereafter, the cells were treated with 1 μM DMNQ for a period of 24 h. Following the completion of the drug treatment, the CCK-8 solution (100 μL) was carefully added to each well and incubated for 1 h. The absorbance of each group was measured at 450 nm with an enzyme-labeled instrument. Three replicate wells were established for each sample, and the cell viability was calculated.

2.6. ROS measurement

Once the cell growth had reached 80–90%, the cells were seeded in confocal Petri dishes for a period of 24 h. HT22 cells were pretreated with different fatty acid solutions for 5 h at a concentration of 1 mg L⁻¹ before co-incubation with 1 μM DMNQ for another 24 h. After treatments, 10 μM DCFH-DA was added and incubated for 30 min.²⁰ The total fluorescence intensity was measured at an excitation wavelength of 488 nm and an emission wavelength of 519 nm using a laser confocal microscope. Three replicate wells were established for each sample, and the ROS levels were expressed as a ratio relative to the control.

2.7. Measurement of SOD, MDA and CAT

The logarithmic growth phase cells were inoculated into 6-well plates at a density of 1.0 × 10⁵ cells per ml. HT22 cells should be treated with the specified pharmacological agent in accordance with the procedures outlined in section 2.5. Then, the control group (no treatment), model group (1 μM DMNQ) and sample group (final concentration of the 1 mg L⁻¹ fatty acid standard solution) were incubated in a 5% CO₂ incubator at 37 °C for 24 h. The cellular levels of SOD, MDA, and CAT were measured in accordance with the instructions provided with the kit.

2.8. Mitochondrial membrane potential assessment (MMP, ΔΨ_mt)

The magnitude of the cellular mitochondrial membrane potential can be employed as a means of characterizing the extent of oxidative damage incurred by the cell. The fluorescent probe JC-1 was used to measure the mitochondrial membrane potential of HT22.²¹ HT22 cells were seeded in confocal dishes at a density of 1 × 10⁵ cells per well for 24 h. The drug is then administered according to the instructions outlined in section 2.5. The mitochondrial membrane potential (ΔΨ_mt) was determined in the control group, the DMNQ model group, and the administered groups in accordance with the instructions provided in the kit. Finally, fluorescence was quantified using a laser confocal microscope under guidance. The degree of mitochondrial depolarization is determined by the ratio of red/green fluorescence intensity.

2.9. RNA sequencing analysis

Cells from the control, model, C16:0 and C22:6 groups were collected in TRIzol reagent. Majorbio Bio-pharm Technology Co., Ltd (Shanghai, China) was commissioned to operate the subsequent RNA extraction and RNA-Seq sequencing. Following the successful completion of quality control, mRNA with polyA was enriched by magnetic beads with oligo (dT). The fragmented mRNA was then used as a template to synthesize double-stranded cDNA, which was ligated with an adaptor and finally sequenced on the Illumina platform.²² The reads were processed in Cell Ranger (v7.1.0) using the default parameters and the STAR algorithm, and then compared to the mouse genome (version GRCm38).²³ The single-cell RNA sequencing data were then subjected to quality control and downstream analysis using Seurat (v4.1.1).²⁴ The matrix was filtered using three criteria: the number of transcripts detected, the number of genes, and the percentage of reads mapping to mitochondrial genes.²⁵ This was done in order to exclude low-quality cells. Mitochondrial gene expression was calculated using the PercentageFeatureSet function within the Seurat package. The standardised data were processed for subsets of variable genes and integration across different samples using the FindIntegrationAnchors and IntegrateData functions.²⁶ Principal component analysis (PCA) was conducted, followed by data visualization for cluster analysis using t-distributed stochastic neighbor embedding (t-SNE).²⁷

2.10. Differential expression analysis and functional enrichment analysis

All differentially expressed genes (DEGs) between the groups were investigated using the DESeq2 software. The condition was set at a multiplicity of difference of FC > 1.5 and a significance level of P < 0.05. The mRNAs of the 20 samples were then screened for DEGs. Volcano plots of differential expression levels were employed to illustrate the number of DEGs between the two groups.

2.11. Differential expression gene analysis and functional enrichment analysis

The cells were subjected to total RNA extraction using the TRIzol reagent. The quantity of RNA was verified with a NanoDrop 1000. Total RNA was subsequently used to perform reverse transcription to obtain cDNA using a kit. Quantitative RT-PCR was conducted using the PowerUP SYBR Green Master Mix. The expression level of the target genes was quantified by utilizing GAPDH as an internal reference gene. The primer sequences used here are shown in Table 1. PCR conditions were as follows: 95 °C for 3 min, 95 °C for 15 s, 63 °C for 30 s and 40 cycles. The relative mRNA expression was determined using the 2^−ΔΔCt method.²⁸

Table 1 Primer sequence

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
Jag2	TGCCTCCAGACATCAACGATTGC	TGCCTCCTCCAGCCACATTCC
Ypel3	GAGAGCAGCCAAGTGTGACAGAG	GGAGCAGAGGGAGCCCAGTG
Ntf5	GGTGGAGGTGCTGCTGTTGAC	GGGAGATGCTGGGAGGGATATGG
H2ax	GCGGTGGGCTTGAAGGTTAGTC	AAGGTCCAGGCGAGGGCTAAG
GAPDH	AAGAAGGTGGTGAAGCAGGC	TCCACCACCCAGTTGCTGTA

---

2.12. Cytoskeleton staining

The HT22 cells were grouped at the end of the 24 hour cell adhesion culture (control, model, C22:6 group) and administered. The cytoskeleton was stained with CoraLite®594-conjugated Phalloidin antibody, while the nucleus was stained with DAPI. Subsequently, the treated HT22 cells were observed under a confocal laser scanning microscope and photographed. The number and synaptic length of cells were then quantified using the ImageJ software.

2.13. Statistical analysis

Experimental data were analyzed using GraphPad Prism 9 and expressed as the mean ± SEM. Comparisons between the groups were made using the one-way analysis of variance (ANOVA). Cell counts and measurements of the synaptic length were quantitatively performed using Image J.

3. Results

3.1. Effects of different digestion products of egg yolk phospholipids on the DMNQ-induced HT22 cell viability

In order to ascertain the requisite concentration of DMNQ to simulate oxidative damage, a CCK-8 assay kit was employed to evaluate the impact of varying concentrations of DMNQ on the HT22 cell viability. As shown in Fig. 1A, the survival of HT22 cells exhibited a decline in a graded manner with the increase of the DMNQ treatment concentration. At a DMNQ concentration of 1 μM, the survival rate of HT22 cells was observed to decrease to 55.08% ± 3.50% of that of the control group, indicating the presence of moderate damage. Consequently, 1 μM DMNQ was identified as the optimal concentration for the establishment of an HT22 cell oxidative damage model.

Fig. 1 Effects of egg yolk phospholipids and fatty acid on DMNQ-induced cytotoxicity in HT22 cells. (A) Effect of different concentrations of DMNQ on the viability of HT22 cells. (B and C) Effects of the different lysophospholipids (B) and fatty acid (C) on the cell viability of HT22 cells. (D–E) Effects of lysophospholipid (D) and fatty acids (E) on the cell viability of HT22 cells. (Data are expressed as mean ± SEM (n ≥ 3). Statistical significance was determined using one-way ANOVA with post-hoc Tukey test: #P < 0.05, ##P < 0.01, ###P < 0.001, ####P < 0.0001 vs. control group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 vs. the DMNQ group.)

To determine the appropriate administration concentrations of the phospholipid molecules and fatty acids for subsequent experiments, the effects of different concentrations of phospholipid and fatty acid standards on the HT22 cell viability were evaluated using a CCK-8 assay kit. As shown in Fig. 1B and C, after a 24 hour treatment with varying concentrations of phospholipid and fatty acid standards, no significant reduction in the HT22 cell viability was observed in the following ranges compared to the blank control group: lysophospholipid standards: 0–2 μg mL⁻¹ (Fig. 1B), fatty acid standards: 0–10 μg mL⁻¹ (Fig. 1C). Based on these results, lysophospholipid concentrations of 1 mg L⁻¹ and 2 mg L⁻¹, along with fatty acid concentrations of 1 mg L⁻¹ and 10 mg L⁻¹, were selected for further experimental investigations.

Cell viabilities of DMNQ-induced damaged HT22 cells treated with different phospholipid molecules and fatty acids were measured by the CCK-8 assay. As we can see in Fig. 1D–E, the HT22 cell viability exhibited a notable enhancement upon being pre-treated by lysophosphatidyl choline and fatty acid, when compared to the DMNQ group. Among them, the increase in HT22 cell activity was more significant in the fatty acid group. Among the different fatty acid groups, unsaturated fatty acids exhibited stronger protective effects from DMNQ-induced apoptosis than saturated fatty acids. Furthermore, the protective effect was observed to increase in conjunction with an increase in unsaturation. It can be supposed that the principal agent responsible for the neuroprotective effect of egg yolk phospholipids may be the unsaturated fatty acids in the structure.

3.2. Effects of different types of fatty acids on DMNQ-induced ROS levels in HT22 cells

The unsaturated fatty acids were further subdivided into three groups for the subsequent experiments: n-3 (C22:6), n-6 (C18:2) and n-9 (C18:1) unsaturated fatty acids, and the saturated fatty acid C16:0 was selected as the negative control. Reactive oxygen species (ROS) play a pivotal role in cell signalling and the maintenance of physiological homeostasis within the body.²⁹ The impact of these fatty acids on the generation of ROS in HT22 cells induced by DMNQ were measured using laser confocal microscopy (Fig. 2A and B). The intracellular ROS levels were significantly higher in the DMNQ group than in the control group (P < 0.001), which were significantly reduced when HT22 cells were pre-treated with C18:1, C18:2, and C22:6 for a period of 5 h (P < 0.01). The ROS fluorescence intensity of the HT22 cells following a 5 h pretreatment with the saturated C16:0 also decreased non-significantly (P > 0.05). Furthermore, the decreases in the ROS level were found to be more pronounced with the increase in the degree of unsaturation of the fatty acids, with DHA (C22:6) demonstrating the most pronounced reduction in ROS levels.

Fig. 2 Effects of egg yolk phospholipid-derived unsaturated fatty acids on the DMNQ-induced oxidative stress parameters in HT22 cells. (A) Flow cytometry plots depicting the intracellular ROS levels. (B) Quantitative analysis of the ROS fluorescence intensity. (C–E) Effects of different fatty acids on Malondialdehyde (MDA) content, superoxide dismutase (SOD) activity and Catalase (CAT) activity in HT22 cells induced by DMNQ. (Data are expressed as mean ± SEM (n ≥ 3). Statistical significance was determined using one-way ANOVA with post-hoc Tukey test: #P < 0.05, ##P < 0.01, ###P < 0.001, ####P < 0.0001 vs. control group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 vs. DMNQ group.)

3.3. Effects of different unsaturated fatty acids on DMNQ-induced oxidative damages in HT22 cells

The oxidation product MDA and antioxidant enzymes, including SOD and CAT, are frequently employed as biomarkers to assess the extent of peroxidative damage to cells or tissues. As shown in Fig. 2C–E, compared with the blank group, the MDA level in the DMNQ group increased significantly (P < 0.0001), and the activities of SOD and CAT decreased significantly (P < 0.001). Levels of MDA were reduced significantly in cells pre-treated by all fatty acids (P < 0.01). However, only the unsaturated fatty acids had a significant protective effect on the DMNQ-induced decrease in SOD activity (P < 0.05). The pre-treatment of fatty acids did not significantly increase the CAT activity (P > 0.05). The findings indicated that the unsaturated fatty acids demonstrated a greater capacity to mitigate oxidative damage in HT22 cells relative to saturated fatty acids.

3.4. Effects of different unsaturated fatty acids on DMNQ-induced oxidative damages in HT22 cells

Oxidative damages in HT22 cells would reduce the MMP, and subsequently affect the functionality of the mitochondria. Alterations in the mitochondrial membrane potential induced by DMNQ in HT-22 cells either pre-treated or not with unsaturated fatty acids were measured using JC-1 staining. As shown in Fig. 3A and B, there was a notable elevation in the degree of MMP depolarization of HT-22 cells induced by DMNQ compared with the blank control group (P < 0.0001). In contrast, fatty acid pretreatment was observed to attenuate the degree of DMNQ-induced MMP depolarization in HT22 cells including both the saturated C16:0 (P < 0.05) and unsaturated fatty acids (P < 0.0001). Furthermore, as the unsaturation degree increased, MMP trended to that of the controls, and MMP in the DHA (C22:6) group was found to be the most similar to that of the control group. This indicates that unsaturated fatty acids, particularly DHA, may offer a superior capacity to mitigate the mitochondrial oxidative damage.

Fig. 3 Effect of different fatty acids on the mitochondrial membrane potential in the DMNQ-induced HT-22 cell model. (A) Representative micrographs show JC-1 staining in the cultured HT22 cells of the control, DMNQ, C16:0, C18:1, C18:2, and C22:6 groups. Scale bar = 50 μm. (B) Quantitative analysis of the JC-1 red/green fluorescence intensity ratios. (Data are expressed as mean ± SEM (n ≥ 3). Statistical significance was determined using one-way ANOVA with post-hoc Tukey test: #P < 0.05, ##P < 0.01, ###P < 0.001, ####P < 0.0001 vs. control group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 vs. the DMNQ group.)

3.5. Effects of different unsaturated fatty acids on DMNQ-induced oxidative damages in HT22 cells

To further elucidate the mechanism by which fatty acids alleviate the DMNQ-induced oxidative damage, RNA sequencing was conducted on the following groups: blank (untreated), model (DMNQ-treated), saturated fatty acid (C16:0), and unsaturated fatty acid (C22:6) pre-treated. In the context of established sequencing libraries, it was observed that a significant proportion of the 20 samples (91.963%) exhibited base quality above Q30, indicating favourable sequencing outcomes. As shown in Fig. 4A, the control and DMNQ groups demonstrated a notable differential expression of 2592 genes, and the DEGs between DMNQ + C16:0- and DMNQ + C22:6-treated cells were 7 and 471, respectively, in comparison with the DMNQ group (Fig. 4B and C).

Fig. 4 Volcano plots and GO enrichment analysis. (A) Volcano plots of differentially expressed genes (DEGs) between the control HT-22 cells and DMNQ-damaged HT-22 cells. (B–C) Volcano plots of DEGs between C16:0 and C22:6 pre-treated and untreated DMNQ-damaged HT22 cells in different treatment groups (E and F) GO enrichment analysis of DEGs between the model group and control group and the C22:6 group and model group.

Gene Ontology (GO) enrichment analysis suggested that the DEGs between the model and control groups were predominantly concentrated on the regulation of TOR signaling, glutathione metabolic processes, regulation of apoptotic signaling pathways, response to oxidative stress and regulation of protein ubiquitination (Fig. 4D), whereas DEGs between the C22:6 group and the model group were predominantly associated with positive regulation of neurogenesis, positive regulation of developmental processes and regulation of cellular development, positive regulation of neurological development, and negative regulation of cellular biosynthesis processes and cellular differentiation (Fig. 4E).

A clustered heat map was constructed based on the results of the GO enrichment analysis, which visualized the genes involved in the pathways of interest (Fig. 5A), and we identified four genes (Jag2, Ypel3, Ntf5, H2ax) with significant differences and high enrichment. The expression of Jag2, Ypel3, Ntf5 and H2ax were measured using RT-PCR (Fig. 5B–E), which suggested significant increases in Jag2, Ntf5 and H2ax by C22:6 compared with the DMNQ group (P < 0.05). The C16:0 treatment could only upregulate the expression of H2AX (P < 0.05).

Fig. 5 Effects of C16:0 and C22:6 on the expression of Jag2, YPEL3, NTF5, and H2AX induced by DMNQ in HT22 cells. (A) Hierarchical clustering heatmap of significantly dysregulated genes (FDR < 0.05) in C22:6-treated versus DMNQ-treated groups. (B–E) RT-PCR validation of the candidate gene expression: (B) Jag2 mRNA levels; (C) YPEL3 mRNA levels; (D) NTF5 mRNA levels; and (E) H2AX mRNA levels. (Data are expressed as mean ± SEM (n ≥ 3). Statistical comparisons were performed using two-way ANOVA with Šidák's multiple comparisons test. Significance thresholds: #P < 0.05, ##P < 0.01, ###P < 0.001, ####P < 0.0001 vs. the control group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 vs. DMNQ group.)

3.6. Effect of DHA pretreatment on the DMNQ-induced morphology of HT22 cells

To investigate the protective effect of DHA against oxidative damage to neurodevelopment in HT22 cells, we stained the cytoskeleton using the ghost pen cyclic peptide. In Fig. 6A, there was a marked decline in cell counts in the model group when compared to the normal group, with Fig. 6B showing a reduction of nearly 50% (P < 0.01). Meanwhile, the synapse length was reduced to approximately 0.03 mm, representing approximately 30% of the normal group (P < 0.0001). The DMNQ-induced notable reduction in the number of cells and the mean length of synapses in HT22 cells can be improved with C22:6 pre-treatments. The mean cell number was observed to be 42 and the mean value of the synapse length was approximately 0.06 mm, which was approximately twice that of the control group. These results indicate that DHA effectively ameliorated DMNQ-induced apoptosis and neuronal synapse length shortening in HT22 cells.

Fig. 6 Effect of DHA on the number and synaptic length in HT22 cells with oxidative damage. The number of cells and synapse length were quantified using five randomly selected images from the field of view. (A) Representative image of the cytoskeleton by ghost pen cyclic peptide staining. (B) Cell Counts. (C) Synaptic Length. (Data are expressed as mean ± SEM (n ≥ 3). Statistical significance was determined using one-way ANOVA with post-hoc Tukey test: #P < 0.05, ##P < 0.01, ###P < 0.001, ####P < 0.0001 vs. control group; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 vs. the DMNQ group.)

4. Discussion

Mounting evidence highlights the neuroprotective potential of DHA-phospholipids. Several in vivo studies have demonstrated their efficacy in mitigating neurodegenerative pathologies. For example, Zhou et al.³⁰ revealed that both DHA-phosphatidylcholine (PC) and DHA-phosphatidylserine (PS) ameliorated cognitive deficits in an Alzheimer's disease model by enhancing mitochondrial function and suppressing neuroinflammation. Our recent findings³¹ further indicated that highly unsaturated egg yolk PC exhibited superior anti-AD effects compared to its less unsaturated counterparts. However, the mechanisms by which DHA-phospholipids exert their neuroprotective effects remain to be elucidated. The researchers conducted a series of in vitro studies using neuronal models. Che et al.³² demonstrated in a PC12 cell model that EPA/DHA-PS inhibited oxidative stress-mediated mitochondrial apoptosis by modulating the SOD and Bcl-2/Bax pathways. Wang et al.³³ confirmed that DHA-PS and EPA-PS directly restored the neural network integrity in primary hippocampal neurons by reducing the Tau hyperphosphorylation. It is noteworthy that dietary DHA-phospholipids undergo extensive hydrolysis upon entry into the intestine, resulting in the generation of lysophospholipids and free fatty acids. These compounds are subsequently absorbed into the system. Consequently, intact DHA-PS molecules are unlikely to reach neuronal targets in vivo. The present study endeavored to circumvent these limitations by concentrating on the neuroprotective effects of various components of digested dietary phospholipids (e.g., DHA, EPA, and lysophospholipids) on DMNQ-induced oxidative damage in HT22 cells.

It was found that fatty acids exhibited a more pronounced activity than lysophospholipids. Furthermore, unsaturated fatty acids demonstrated a markedly greater capacity to attenuate the DMNQ-induced decline in cell viability, as well as the function, in comparison to saturated fatty acids. Prior research has demonstrated that intervention with unsaturated fatty acids, particularly n-3 fatty acids, exerts neuroprotective benefits.^34,35 The mechanism of unsaturated fatty acids was related to their action as free radical scavengers and to increasing the activity of antioxidant enzymes,^36–38 which subsequently reduced oxidative stress, inhibited inflammatory responses, enhanced synaptic plasticity, promoted neurogenesis, and improved neuronal membrane fluidity in neurodegeneration.³⁹ On the other hand, an excess of saturated fatty acids may have a detrimental impact on the nervous system, potentially resulting in damage.^29,40

Excess ROS could result in oxidative damages,^41,42 which could be cleaved by antioxidant enzymes, including SOD and CAT.^43–45 As for a lipid-abundant tissue, malondialdehyde (MDA) is frequently used to indicate the oxidative stress in the brain.⁴⁶ According to the results of C16:0, C18:1, C18:2 and C22:6 pre-treated cells, unsaturated fatty acids have a more pronounced ability to reduce ROS (Fig. 2A and B) and MDA levels (Fig. 2C) and enhance the activity of SOD (Fig. 2D). Mitochondria play a significant role in the process of cellular oxidative damage. As a source of energy for cells and a principal source of ROS production in vivo, mitochondria are vulnerable to oxidative stress.⁴⁷ An excess of ROS impairs the respiratory chain complex, resulting in the disruption of electron transfer and a reduction in membrane potential. In turn, this impairs neuronal energy metabolism and contributes to cell death.⁴⁸ MMP serves as a crucial indicator of mitochondrial functionality,^5,49 and it has been demonstrated that antioxidants can prevent the loss of MMP.^50–52 Our study suggested that unsaturated fatty acids, particularly the polyunsaturated n-3 unsaturated fatty acids, could prevent DMNQ-induced MMP abnormalities and maintain normal physiological cellular functions (Fig. 3A and B). These results underscore the neuroprotective function of fatty acids, particularly n-3 polyunsaturated fatty acids, in safeguarding mitochondrial integrity and sustaining cellular equilibrium.

To gain further insight into the molecular mechanisms by which fatty acids protected oxidative damage in HT22 cells, we conducted RNA-Seq analyses on control, model (DMNQ-treated cells) and cells pre-treated with saturated fatty acids (C16:0) and unsaturated fatty acids (C22:6). The number of DEGs induced by C22:6 was larger than that induced by C16:0, indicating a much stronger effect of C22:6. Furthermore, the GO enrichment analysis demonstrated that DEGs induced by C22:6 were mainly involved in neurogenesis, cell differentiation and neuronal development (Fig. 4F). Among these, four genes (Jag2, Ypel3, Ntf5, H2ax) were selected for further confirmation by RT-PCR.

Jag2 is one of the ligands of the Notch signalling pathway.⁵³ The Notch signalling pathway is a highly conserved cellular communication system that plays a crucial role in a number of biological processes, including cell differentiation, proliferation, apoptosis, tissue development and regeneration.⁵⁴ Aberrant activation or inhibition of the Notch signalling pathway has been implicated in the development of a variety of diseases, including cerebrovascular disease and Alzheimer's disease.^55–58 The Ypel3 gene encodes a protein called Yippee-like 3 (Ypel3), which was reported to play a significant role in regulating the cell cycle, promoting cell proliferation and contributing to the development of tumors.^59–61Ntf5, or neurotrophic factor 5, encodes a protein that is also known as a pro-brain-derived neurotrophic factor (BDNF). BDNF was demonstrated to promote neuronal survival, development and synaptic connectivity, and to be involved in the regulation of learning, memory and cognitive functions of the nervous system.^62–64H2ax plays a significant role in maintaining genomic stability and regulating the cellular response to DNA damage. It has been extensively investigated as a marker of DNA damage and repair processes, as evidenced by numerous studies.^65–68 The RT-qPCR experiments confirmed the findings of the RNA-Seq analysis. Consequently, it can be postulated that the mechanism of DHA-mediated protection from DMNQ-induced oxidative damage in HT22 cells may involve the Notch signalling pathway, cell proliferation and differentiation, neuronal development and DNA damage repair.

The assessment of neural development, damage and function within the nervous system is conducted through the measurement of two key parameters: the number of neurons and the length of neuronal synapses. Fluctuations in the number of neurons may serve as an indicator of the severity of damage and progression of neurodegenerative diseases.^69,70 Synapse length has been demonstrated to reflect the developmental and functional state of neurons, and plays an essential role in determining the efficacy and pattern of neuronal signalling. A reduction in the number of neurons can be used as an indicator of the extent of damage and progression of neurodegenerative diseases, as well as the length of synapse.^71,72 Synapses with a longer length may be regarded as exhibiting a more mature state of synaptic connections and stronger synaptic transmission, whereas synapses with a shorter length may be indicative of an immature or impaired state.⁷³ According to the number of neurons and DMNQ-induced damage, there is a decrease in the number of neurons and shortening or disappearance of synapses (Fig. 6).

However, immortalized cell lines such as HT22 may possess limitations in their capacity to fully reproduce the complexity of primary neurons. Hence, it is crucial for future studies to replicate these findings in primary neuron cultures or in vivo models to ascertain the translatability of these observations.

5. Conclusions

The present study evaluated the neuroprotective effects of different digestion products of egg yolk phospholipids in a DMNQ-induced HT22 cell model, and found that the fatty acid in the structure of egg yolk phospholipids plays a central beneficial role in the brain. We also compared the unsaturated degree of fatty acids, and found that polyunsaturated fatty acids exhibited a much stronger neuroprotective activity. Unsaturated fatty acids such as DHA not only clear ROS by upregulating SOD, but also protect oxidative damages in neuro proliferation and differentiation. Undeniably, this study provides guidance for the optimization of the egg yolk phospholipid structure during industrial production to obtain egg products with higher nutritional value in brain health.

Author contributions

Jingyu Li: Writing – original draft, methodology, investigation. Bing Fang: Writing – review & editing, supervision, funding acquisition, conceptualization. Yao Wu: Writing – original draft, methodology, investigation. Yuhang Sun: Writing – review & editing, methodology, investigation. Yue Liu: Writing – review & editing, methodology, investigation. Haina Gao: Writing – review & editing. Ming Zhang: Writing – review & editing, supervision, funding acquisition, conceptualization.

Data availability

All the data generated or analysed during this study are included in this article.

Conflicts of interest

There are no conflicts to declare.

Acknowledgements

The work was supported by the National Key Research and Development Program of China (2022YFD2101003).

References

1. R. Shi, D. Gao, R. Stoika, K. Liu, A. Sik and M. Jin, Potential implications of polyphenolic compounds in neurodegenerative diseases, Crit. Rev. Food Sci. Nutr., 2024, 64, 5491–5514.
2. Y. Wang, M. N. Lv and W. J. Zhao, Research on ferroptosis as a therapeutic target for the treatment of neurodegenerative diseases, Ageing Res. Rev., 2023, 91, 102035.
3. D. M. Wilson 3rd, M. R. Cookson, L. Van Den Bosch, H. Zetterberg, D. M. Holtzman and I. Dewachter, Hallmarks of neurodegenerative diseases, Cell, 2023, 186, 693–714.
4. D. Bairamian, S. Sha, N. Rolhion, H. Sokol, G. Dorothée, C. A. Lemere and S. Krantic, Microbiota in neuroinflammation and synaptic dysfunction: a focus on alzheimer's disease, Mol. Neurodegener., 2022, 17, 19.
5. H. Wang, W. Luo, H. Chen, Z. Cai and G. Xu, Mitochondrial dynamics and mitochondrial autophagy: molecular structure, orchestrating mechanism and related disorders, Mitochondrion, 2024, 75, 101847.
6. A. Ionescu-Tucker and C. W. Cotman, Emerging roles of oxidative stress in brain aging and alzheimer's disease, Neurobiol. Aging, 2021, 107, 86–95.
7. C. Wilson, E. Muñoz-Palma and C. González-Billault, From birth to death: A role for reactive oxygen species in neuronal development, Semin. Cell Dev. Biol., 2018, 80, 43–49.
8. G. Cenini, A. Lloret and R. Cascella, Oxidative Stress in Neurodegenerative Diseases: From a Mitochondrial Point of View, Oxid. Med. Cell. Longevity, 2019, 2019, 2105607.
9. D. J. Weingarten, A. Shrestha, K. Juda-Nelson, S. A. Kissiwaa, E. Spruston and S. L. Jackman, Fast resupply of synaptic vesicles requires synaptotagmin-3, Nature, 2022, 611, 320–325.
10. T. S. Leyane, S. W. Jere and N. N. Houreld, Oxidative stress in ageing and chronic degenerative pathologies: molecular mechanisms involved in counteracting oxidative stress and chronic inflammation, Int. J. Mol. Sci., 2022, 23, 9266760.
11. S. Y. Morita and Y. Ikeda, Regulation of membrane phospholipid biosynthesis in mammalian cells, Biochem. Pharmacol., 2022, 206, 115296.
12. F. Zhao, R. Li, Y. Liu and H. Chen, Perspectives on lecithin from egg yolk: extraction, physicochemical properties, modification, and applications, Front. Nutr., 2022, 9, 1082671.
13. J. Chen, S. Lin, N. Sun, Z. Bao, J. Shen and X. Lu, Egg yolk phosphatidylcholine: extraction, purification and its potential neuroprotective effect on PC12 cells, J. Funct. Foods, 2019, 56, 372–383.
14. W. Tan, Q. Zhang, Z. Dong, Y. Yan, Y. Fu, X. Liu, B. Zhao and X. Duan, Phosphatidylcholine ameliorates lps-induced systemic inflammation and cognitive impairments via mediating the gut-brain axis balance, J. Agric. Food Chem., 2020, 68, 14884–14895.
15. S. T. Kim, E. J. Kyung, J. S. Suh, H. S. Lee, J. H. Lee, S. I. Chae, E. S. Park, Y. H. Chung, J. Bae, T. J. Lee, W. M. Lee, U. D. Sohn and J. H. Jeong, Phosphatidylcholine attenuated docetaxel-induced peripheral neurotoxicity in rats, Drug Chem. Toxicol., 2018, 41, 476–485.
16. E. Abeyrathne, K. C. Nam, X. Huang and D. U. Ahn, Egg yolk lipids: separation, characterization, and utilization, Food Sci. Biotechnol., 2022, 31, 1243–1256.
17. P. Castro-Gómez, A. Garcia-Serrano, F. Visioli and J. Fontecha, Relevance of dietary glycerophospholipids and sphingolipids to human health, Prostaglandins, Leukotrienes Essent. Fatty Acids, 2015, 101, 41–51.
18. K. Murota, Digestion and absorption of dietary glycerophospholipids in the small intestine: their significance as carrier molecules of choline and n-3 polyunsaturated fatty acids, Biocatal. Agric. Biotechnol., 2020, 26, 101633.
19. K. Y. Kim, S. K. Hwang, S. Y. Park, M. J. Kim, D. Y. Jun and Y. H. Kim, l-Serine protects mouse hippocampal neuronal HT22 cells against oxidative stress-mediated mitochondrial damage and apoptotic cell death, Free Radical Biol. Med., 2019, 141, 447–460.
20. Y. Tao, J. Lu, L. Li, L. Lu, B. Fu, J. Zhang, S. Zhang, R. Ma, J. Ma, J. Sun, S. Fu, S. Liu and Z. Wang, Raltitrexed induces apoptosis through activating ROS-mediated ER stress by impeding HSPA8 expression in prostate cancer cells, Biochim. Biophys. Acta, Mol. Cell Res., 2024, 1871, 119684.
21. S. Zhao, Q. Bao, G. Ma, Y. Yao, L. Xie and J. Xiong, Benzo[b]fluoranthene (B[b]F) affects apoptosis, oxidative stress, mitochondrial membrane potential and expressions of blood-brain barrier markers in microvascular endothelial cells, Toxicol. In Vitro, 2023, 86, 105522.
22. D. Zhang, D. Xiao, T. Yin, S. Zhao, O. Zhur, X. Xiao, H. He and L. Chen, The extraction of effective components and an antioxidant activity study of Tulipa edulis, Food Sci. Hum. Wellness, 2024, 13, 276–286.
23. D. T. Le, J. N. Durham, K. N. Smith, H. Wang, B. R. Bartlett, L. K. Aulakh, S. Lu, H. Kemberling, C. Wilt, B. S. Luber, F. Wong, N. S. Azad, A. A. Rucki, D. Laheru, R. Donehower, A. Zaheer, G. A. Fisher, T. S. Crocenzi, J. J. Lee, T. F. Greten, A. G. Duffy, K. K. Ciombor, A. D. Eyring, B. H. Lam, A. Joe, S. P. Kang, M. Holdhoff, L. Danilova, L. Cope, C. Meyer, S. Zhou, R. M. Goldberg, D. K. Armstrong, K. M. Bever, A. N. Fader, J. Taube, F. Housseau, D. Spetzler, N. Xiao, D. M. Pardoll, N. Papadopoulos, K. W. Kinzler, J. R. Eshleman, B. Vogelstein, R. A. Anders and L. A. Diaz Jr., Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade, Science, 2017, 357, 409–413.
24. Y. Zhao, S. Zhang, J. Xu, Y. Yu, G. Peng, C. V. Cannistraci and J. J. Han, Spatial Reconstruction of Oligo and Single Cells by De Novo Coalescent Embedding of Transcriptomic Networks, Adv. Sci., 2023, 10, e2206307.
25. R. Satija, J. A. Farrell, D. Gennert, A. F. Schier and A. Regev, Spatial reconstruction of single-cell gene expression data, Nat. Biotechnol., 2015, 33, 495–502.
26. T. Stuart, A. Butler, P. Hoffman, C. Hafemeister, E. Papalexi, W. M. Mauck, Y. Hao, M. Stoeckius, P. Smibert and R. Satija, Comprehensive integration of single-cell data, Cell, 2019, 177, 1888–1902.
27. C. Flexa, W. Gomes, I. Moreira, R. Alves and C. Sales, Polygonal coordinate system: visualizing high-dimensional data using geometric DR, and a deterministic version of t-SNE, Expert Syst. Appl., 2021, 175, 114741.
28. K. J. Livak and T. D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method, Methods, 2001, 25, 402–408.
29. L. Fan, A. R. Borenstein, S. Wang, K. Nho, X. Zhu, W. Wen, X. Huang, J. A. Mortimer, M. J. Shrubsole and Q. Dai, Associations of circulating saturated long-chain fatty acids with risk of mild cognitive impairment and alzheimer's disease in the alzheimer's disease neuroimaging Initiative (ADNI) cohort, EBioMedicine, 2023, 97, 104818.
30. M. M. Zhou, L. Ding, M. Wen, H. X. Che, J. Q. Huang, T. T. Zhang, C. H. Xue, X. Z. Mao and Y. M. Wang, Mechanisms of DHA-enriched phospholipids in improving cognitive deficits in aged SAMP8 mice with high-fat diet, J. Nutr. Biochem., 2018, 59, 64–75.
31. Y. Sun, Y. Wu, B. Fang, J. Li, Y. Liu, H. Gao and M. Zhang, Comparative Analysis of Egg Yolk Phospholipid Unsaturation and Its Impact on Neural Health in Alzheimer Disease Mice, Foods, 2025, 14, 792.
32. H. Che, X. Fu, L. Zhang, X. Gao, M. Wen, L. Du, C. Xue, J. Xu and Y. Wang, Neuroprotective Effects of n-3 Polyunsaturated Fatty Acid-Enriched Phosphatidylserine Against Oxidative Damage in PC12 Cells, Cell. Mol. Neurobiol., 2018, 38, 657–668.
33. Y. W. Wang, Q. Li, X. Y. Li, Y. C. Zhao, C. C. Wang, C. H. Xue, Y. M. Wang and T. T. Zhang, A Comparative Study about the Neuroprotective Effects of DHA-Enriched Phosphatidylserine and EPA-Enriched Phosphatidylserine against Oxidative Damage in Primary Hippocampal Neurons, Mar. Drugs, 2023, 21, 410.
34. S. Qu, Q. Wang, Y. Wang, L. Li, L. Zhu, X. Kuang, X. Wang, H. Li, L. Zhao and H. Dai, Design, synthesis, antibacterial/antitumor activity and in vitro stability of novel cordycepin derivatives with unsaturated fatty acid chain, Eur. J. Pharm. Sci., 2023, 187, 106466.
35. X. Gao, X. Su, X. Han, H. Wen, C. Cheng, S. Zhang, W. Li, J. Cai, L. Zheng, J. Ma, M. Liao, W. Ni, T. Liu, D. Liu, W. Ma, S. Han, S. Zhu, Y. Ye and F. F. Zeng, Unsaturated fatty acids in mental disorders: an umbrella review of meta-analyses, Adv. Nutr., 2022, 13, 2217–2236.
36. T. S. Bruun, A. H. Madsen, E. R. Handberg, J. Dall, S. K. Jensen, E. Østrup and A. V. Strathe, The effect of dietary omega-3 fatty acid supplementation on fetal growth, piglet birth weight and plasma fatty acid concentrations, using docosahexaenoic acid in early gestation in sows, Anim. Reprod. Sci., 2023, 259, 107380.
37. A. Zendedel, P. Habib, J. Dang, L. Lammerding, S. Hoffmann, C. Beyer and A. Slowik, Omega-3 polyunsaturated fatty acids ameliorate neuroinflammation and mitigate ischemic stroke damage through interactions with astrocytes and microglia, J. Neuroimmunol., 2015, 278, 200–211.
38. W. Liang, Y. Zhao, G. Quan, R. Yao, H. Chen, X. Weng, W. Li, X. Yue and F. Li, Localization and expression of phospholipase A(2) and polyunsaturated fatty acid profile in the testis tissues of Hu sheep, Anim. Reprod. Sci., 2024, 260, 107381.
39. J. Gambini and K. Stromsnes, Oxidative stress and inflammation: from mechanisms to therapeutic approaches, Biomedicines, 2022, 10, 753.
40. S. A. De Queiroz Cavalcanti, L. A. De Almeida and J. Gasparotto, Effects of a high saturated fatty acid diet on the intestinal microbiota modification and associated impacts on parkinson's disease development, J. Neuroimmunol., 2023, 382, 578171.
41. Y. Zhang, R. Xu, J. Wu, Z. Zhang, Y. Wang, H. Yang and S. Zhang, Nanopore-related cellular death through cytoskeleton depolymerization by drug-induced ROS, Talanta, 2024, 268, 125355.
42. C. F. Song, Y. H. Hu, Z. G. Mang, Z. Ye, H. D. Chen, D. S. Jing, G. X. Fan, S. R. Ji, X. J. Yu, X. W. Xu and Y. Qin, Hernandezine induces autophagic cell death in human pancreatic cancer cells via activation of the ROS/AMPK signaling pathway, Acta Pharmacol. Sin., 2023, 44, 865–876.
43. A. K. Grzegorzewska, D. Wolak and A. Hrabia, Effect of tamoxifen treatment on catalase (CAT) and superoxide dismutase (SOD) expression and localization in the hen oviduct, Theriogenology, 2024, 214, 73–80.
44. S. Stephenie, Y. P. Chang, A. Gnanasekaran, N. M. Esa and C. Gnanaraj, An insight on superoxide dismutase (SOD) from plants for mammalian health enhancement, J. Funct. Foods, 2020, 68, 103917.
45. N. S. Al-Sowayan and R. Abdullah Almarzougi, Vitamin E reduces oxidative stress in brains of male albino male rats undergoing immobilization, Saudi J. Biol. Sci., 2024, 31, 103900.
46. D. Del Rio, A. J. Stewart and N. Pellegrini, A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress, Nutr., Metab. Cardiovasc. Dis., 2005, 15, 316–328.
47. E. E. Alshial, M. I. Abdulghaney, A. S. Wadan, M. A. Abdellatif, N. E. Ramadan, A. M. Suleiman, N. Waheed, M. Abdellatif and H. S. Mohammed, Mitochondrial dysfunction and neurological disorders: a narrative review and treatment overview, Life Sci., 2023, 334, 122257.
48. Q. Li, P. Guo, S. Wang, L. Su, T. Liang, W. Yu, J. Guo, Q. Yang, Z. Tang and J. Liao, Gut microbiota disorders aggravate terbuthylazine-induced mitochondrial quality control disturbance and PANoptosis in chicken hepatocyte through gut-liver axis, Sci. Total Environ., 2024, 913, 169642.
49. Y. Liu, S. Liu, J. Huang, Y. Liu, Q. Wang, J. Chen, L. Sun and W. Tu, Mitochondrial dysfunction in metabolic disorders induced by per- and polyfluoroalkyl substance mixtures in zebrafish larvae, Environ. Int., 2023, 176, 107977.
50. R. Ranjan, M. Kumar, D. K. Swain, S. P. Singh, S. D. Kharche and M. S. Chauhan, Vitamin B7 protects DNA damage and stabilizes mitochondrial transmembrane potential from cryoinjury, Small Rumin. Res., 2022, 212, 106719.
51. S. Tiwari, R. K. Dewry, R. Srivastava, S. Nath and T. K. Mohanty, Targeted antioxidant delivery modulates mitochondrial functions, ameliorates oxidative stress and preserve sperm quality during cryopreservation, Theriogenology, 2022, 179, 22–31.
52. X. Du, Q. Zeng, Y. Luo, L. He, Y. Zhao, N. Li, C. Han, G. Zhang and W. Liu, Application research of novel peptide mitochondrial-targeted antioxidant SS-31 in mitigating mitochondrial dysfunction, Mitochondrion, 2024, 75, 101846.
53. E. Schrama, E. Niks, S. Van Duinen, N. Van Der Beek, M. Kriek, U. Badrising and H. Van Duyvenvoorde, P301 novel JAG2 variants in the first identified dutch patient with limb-girdle muscular dystrophy R27 and a neuropsychiatric phenotype, Neuromuscular Disord., 2023, 33, S118.
54. P. Mourikis and S. Tajbakhsh, Distinct contextual roles for Notch signalling in skeletal muscle stem cells, BMC Dev. Biol., 2014, 14, 2.
55. W. He, J. Hu, Y. Xia and R. Yan, β-site amyloid precursor protein cleaving enzyme 1(BACE1) regulates Notch signaling by controlling the cleavage of Jagged 1 (Jag1) and Jagged 2 (Jag2) proteins, J. Biol. Chem., 2014, 289, 20630–20637.
56. F. Matteini, R. Thambyrajah, J. L. Bartolome, A. F. Perez, E. Mejia-Ramirez, S. M. Vazquez, P. H. Molinero, J. G. Miranda, A. Bigas and M. C. Florian, 3014 – endothelial - JAG2 preserves HSC function upon aging by maintaining HSC epigenetic polarity through Notch signaling activation, Exp. Hematol., 2023, 124, S57.
57. R. Bonfim-Silva, P. Viani De Andrade, C. A. Scrideli, L. G. Tone and C. Gilberto Carlotti Júnior, PO-165 effect of Notch pathway and Skp2 inhibition in cell viability/proliferation of medulloblastoma cells, ESMO Open, 2018, 3, A291–A292.
58. A. Kapoor and D. A. Nation, Role of notch signaling in neurovascular aging and alzheimer's disease, Semin. Cell Dev. Biol., 2021, 116, 90–97.
59. J. Liu, R. Qiu, R. Liu, P. Song, P. Lin, H. Chen, D. Zhou, A. Wang and Y. Jin, YPEL3 negatively regulates endometrial function via the Wnt/β-catenin pathways during early pregnancy in goats, Animals, 2022, 12, 2973.
60. R. Tuttle, M. Simon, D. C. Hitch, J. N. Maiorano, M. Hellan, J. Ouellette, P. Termuhlen and S. J. Berberich, Senescence-associated gene YPEL3 is downregulated in human colon tumors, Ann. Surg. Oncol., 2011, 18, 1791–1796.
61. J. Zhang, X. Wen, X. Y. Ren, Y. Q. Li, X. R. Tang, Y. Q. Wang, Q. M. He, X. J. Yang, Y. Sun, N. Liu and J. Ma, YPEL3 suppresses epithelial-mesenchymal transition and metastasis of nasopharyngeal carcinoma cells through the Wnt/β-catenin signaling pathway, J. Exp. Clin. Cancer Res., 2016, 35, 109.
62. T. A. Slotkin, F. J. Seidler and F. Fumagalli, Targeting of neurotrophic factors, their receptors, and signaling pathways in the developmental neurotoxicity of organophosphates in vivo and in vitro, Brain Res. Bull., 2008, 76, 424–438.
63. T. A. Slotkin, F. J. Seidler and F. Fumagalli, Unrelated developmental neurotoxicants elicit similar transcriptional profiles for effects on neurotrophic factors and their receptors in an in vitro model, Neurotoxicol. Teratol., 2010, 32, 42–51.
64. I. Castilla-Cortázar, I. Iturrieta, M. García-Magariño, J. E. Puche, I. Martín-Estal, G. A. Aguirre, G. Femat-Roldan, L. Cantu-Martinez and Ú. Muñoz, Neurotrophic factors and their receptors are altered by the mere partial IGF-1 deficiency, Neuroscience, 2019, 404, 445–458.
65. M. W. Luczak and A. Zhitkovich, Monoubiquitinated γ-H2AX: abundant product and specific biomarker for non-apoptotic DNA double-strand breaks, Toxicol. Appl. Pharmacol., 2018, 355, 238–246.
66. Y. Ibuki, M. Shikata and T. Toyooka, γ-H2AX is a sensitive marker of DNA damage induced by metabolically activated 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone, Toxicol. In Vitro, 2015, 29, 1831–1838.
67. L. Zhao, D. W. Chang, Y. Gong, C. Eng and X. Wu, Measurement of DNA damage in peripheral blood by the γ-H2AX assay as predictor of colorectal cancer risk, DNA Repair, 2017, 53, 24–30.
68. S. Nakayama, M. Adachi, M. Hatano, N. Inahata, T. Nagao and N. Fukushima, Cytosine arabinoside induces phosphorylation of histone H2AX in hippocampal neurons via a noncanonical pathway, Neurochem. Int., 2021, 142, 104933.
69. S. Di Santo, S. Seiler, A. D. Ducray and H. R. Widmer, Conditioned medium from endothelial progenitor cells promotes number of dopaminergic neurons and exerts neuroprotection in cultured ventral mesencephalic neuronal progenitor cells, Brain Res., 2019, 1720, 146330.
70. G. M. Lopim, D. Vannucci Campos, S. Gomes Da Silva, A. A. De Almeida, R. Lent, E. A. Cavalheiro and R. M. Arida, Relationship between seizure frequency and number of neuronal and non-neuronal cells in the hippocampus throughout the life of rats with epilepsy, Brain Res., 2016, 1634, 179–186.
71. H. Verma, P. Gangwar, A. Yadav, B. Yadav, R. Rao, S. Kaur, P. Kumar, M. Dhiman, G. Taglialatela and A. K. Mantha, Understanding the neuronal synapse and challenges associated with the mitochondrial dysfunction in mild cognitive impairment and alzheimer's disease, Mitochondrion, 2023, 73, 19–29.
72. S. Gul, S. Attaullah, M. H. Alsugoor, S. Bawazeer, S. A. Shah, S. Khan, H. S. Salahuddin and M. Ullah, Folicitin abrogates scopolamine induced oxidative stress, hyperlipidemia mediated neuronal synapse and memory dysfunction in mice, Heliyon, 2023, 9, e16930.
73. S. K. Schmitz, J. J. Hjorth, R. M. Joemai, R. Wijntjes, S. Eijgenraam, P. De Bruijn, C. Georgiou, A. P. De Jong, A. Van Ooyen, M. Verhage, L. N. Cornelisse, R. F. Toonen and W. J. Veldkamp, Automated analysis of neuronal morphology, synapse number and synaptic recruitment, J. Neurosci. Methods, 2011, 195, 185–193.

---

Footnote

† These authors have contributed equally to this work.

---