Sake lees extract obtained using a novel continuous phase-transition extraction method: evaluation of its bioactive composition, anti-aging efficacy and mechanism

Abstract

For the high-value utilization of sake lees (SL), it is essential to explore its potential as a resource for anti-aging bioactives. However, the efficient extraction of SL, the compositional benefits provided, and the resulting anti-aging efficacy in vivo remain to be explored. Thus, a novel continuous phase-transition extraction (CPE) method, an amino acid analyzer, LC-MS, and GC-MS, as well as a classic anti-aging model of Caenorhabditis elegans (C. elegans) were adopted. The results showed that compared to ultrasound-assisted extraction, the total amino acid content of SL extract (SLE) obtained using 80% ethanol in CPE increased by 39.64%, with a notable enhancement in the in vitro scavenging ability of free radicals (p < 0.05). In SLE, the hydrophobic, acidic, and basic amino acids with antioxidant activity accounted for 77.11% of total amino acids. New potential anti-aging compounds were identified, including Lys-Gln, Leu-Arg-Lys, and sphinganine. In particular, 4 mg mL⁻¹ SLE not only promoted a 19.32% increase in the lifespan of C. elegans by enhancing oxidative stress and neuroprotective effects but also ameliorated age-related phenotypes like motoricity and age pigment. Further exploration revealed that the efficacy of SLE is mediated by SKN-1/Nrf2 and HSF-1 pathways, which can be confirmed by the upregulation of key genes, such as skn-1 and hsf-1, especially by inducing a 72.73% increase in nuclear transfer of the transcription factor SKN-1/Nrf2. Taken together, SLE obtained by CPE was abundant in bioactives and contains novel components, thus exerting prominent anti-aging effects in vivo. This study provides a new way to obtain anti-aging active substances efficiently, which is beneficial for application in the fields of health foods and cosmetics.

---

1. Introduction

Sake lees (SL), a by-product produced in huge quantities during sake brewing, is usually discarded as an industrial waste, which has led to serious environmental pollution.^1,2 Actually, SL is rich in premium nutrients and various active components, and there is evidence to support its health benefits. For instance, SL hydrolysate protected against acetaminophen-induced hepatotoxicity via increasing glutathione levels in mice.³ Treatment with sake prevented Parkinson's disease in zebrafish by mitigating oxidative stress.⁴ Moreover, sake supplementation enhanced the activities of antioxidant enzymes, suggesting its significant potential as an anti-aging agent.⁵ Nowadays, aging has become the largest social and economic burden for human beings, and synthetic drugs have potential toxicity and carcinogenicity, which make natural antioxidants an exciting and economically promising focus in anti-aging research.⁶ Given this, leveraging as a raw material for anti-aging products is an efficacious means of establishing high value-added applications for SL.

Importantly, the efficiency of the extraction process determines whether SL can be converted into a high-value product. Subcritical water extraction of SL was carried out at 260 °C, but such excessively high temperatures may damage thermally sensitive active compositions contributing to antioxidant activity, such as peptides and vitamins.⁷ Subsequent studies found that innovative methods like ultrasound and microwave extraction can enhance the productivity of bioactive compounds from wine lees.⁸ However, there are still issues with organic solvent use and energy costs. Supercritical CO₂ extraction is a green alternative and has been gradually applied to the recovery of active substances in wine lees, but requires expensive equipment and significant initial investment.⁹ Although compositional differences exist between wine lees and sake lees, they exhibit similarities such as high γ-aminobutyric acid content.¹⁰ The common characteristics inherent in the described extraction methodologies also pose challenges during sake lees extraction. Consequently, there is an urgent need to employ an extraction method that is cost-effective, environmentally friendly, and highly efficient. Continuous phase-transition extraction (CPE), a novel extraction method for functional ingredients developed by our research team (Fig. 1A), addresses this urgent need. CPE enables the solvent to transition rapidly through a liquid–gas–liquid cycle using the high-pressure pump, while the cyclic and fresh solvent ensures sufficient and efficient extraction.¹¹ Additionally, the solvent is recovered in the vacuum state without causing solvent residue and environmental pollution.¹² Furthermore, CPE enables the extraction of diverse natural substances with distinct polarities by modifying the extraction solvent, the applied pressure, and the controlled temperature.¹³ Given these beneficial attributes, it has been effectively employed in the comprehensive utilization of finger citron fruit, soy sauce by-products and honey pomelo fruit.^14,15 Compared with heat reflux extraction, CPE not only increased the content of finger citron crude flavonoids by 33.22%, but also raised the yield of bergamot polysaccharide by 5.39% while shortening the extraction time by 25%.^14,16 CPE also improved the pumpkin seed oil extraction rate by 14.49% compared with supercritical fluid extraction.¹⁷ Therefore, it is reasonable to believe CPE potentially extracts bioactives from SL in a green and efficient manner, which is suitable for industrial applications.

Fig. 1 Optimization of the extraction process. (A) Schematic diagram of the continuous phase-transition extraction (CPE) system. System 1: n-butane solvent extraction system; system 2: other solvent (e.g., ethanol) extraction system; S1: microfilter; S2: high pressure pump; S3: flowmeter; S4: vacuum pump; S5 and S6: solvent; Vi (i = 1, 2, 3 to 9): valve; Pi (i = 1, 2, 3 to 6): pressure indicator; K1 and K3: heat exchanger; K2: extraction pot; K4 and K8: separation pot; K5 and K9: purification column; K6 and K10: condenser; K7 and K11: solvent storage pot. (B) The basic nutrients of sake lees. (C) Chemical components of SLE obtained from different extraction solvents. (D) Antioxidant activity of SLE obtained from different extraction solvents. (E) Chemical components of SLE obtained using different process parameters. Abbreviations: CPE-1, continuous phase-transition extraction applying 0.8 MPa at 80 °C for 90 min; CPE-2, continuous phase-transition extraction applying 0.2 MPa at 60 °C for 60 min; CPE-3, continuous phase-transition extraction applying 0.5 MPa at 70 °C for 120 min. (F) Antioxidant activity of SLE obtained using different process parameters. (G) Chemical components of SLE obtained under different process flow conditions. Abbreviations: DD, pretreatment of drying and defatting; DND, pretreatment of drying and non-defatting; NDND, pretreatment of non-drying and non-defatting. (H) Antioxidant activity of SLE obtained under different process flow conditions. (I) Chemical components of SLE obtained from CPE and UAE. (J) Antioxidant activity of SLE obtained from CPE and UAE. Statistically significant differences were considered at p < 0.05 and designated with different letters (a, b and c).

Notably, composition analysis of SL extract (SLE) is helpful to clarify its health benefits. However, previous studies have primarily focused on a macroscopic analysis of SL components, reporting that the nutritional composition mainly consists of proteins and carbohydrates.^1,18 Alternatively, some studies have concentrated on investigating the relationship between sake metabolites and flavor, identifying amino acids and organic acids as key components related to sensory perception.^19,20 Further research has delved into an individual component with functional activities, such as γ-aminobutyric acid, which may endow SL with antioxidant and brain function improvement.²¹ Another case is peptides obtained from SL inhibiting angiotensin-converting enzyme and suppressing hypertension.²² A recent study explored the benefits of amino acids in sake in terms of radical scavenging capacity, finding that cysteine, methionine, tyrosine, and tryptophan are the most significant contributors.²³ However, a comprehensive exploration of the anti-aging components in SLE has not yet been reported. In particular, earlier investigations by our team have indicated that CPE can effectively extract raw materials while preserving active substances,^14,24 suggesting that SLE obtained through CPE may maximize the acquisition of actives and even contain previously undiscovered compounds in the mild extraction environment. Thus, further investigation into the composition of SLE extracted using CPE is warranted to gain a deeper understanding of its anti-aging properties.

To date, some biological activities of SLE in vitro and in vivo have received widespread attention, such as antioxidation, lipid-lowering, blood pressure-lowering and neuroprotection.^1,5,25–28 However, the improvement of the physiological function of aging-related organisms by SLE and its exact mechanism remains uncertain, especially whether the SLE derived from CPE will exhibit a superior anti-aging effect and is worth anticipating. Caenorhabditis elegans (C. elegans) serves as an ideal animal model for rapidly evaluating potential anti-aging properties, owing to its notable advantages including a short lifespan, ease of cultivation, and a well-characterized genetic background.²⁹ Simultaneously, age-related changes in the behaviour and physiological indices of C. elegans, including declines in locomotor performance and accumulation of lipofuscin, are quite analogous to those observed in higher animals.³⁰ Besides, a substantial number of genes within C. elegans show marked homology, with a similarity up to 60–80%, and meanwhile, the signaling pathways that regulate lifespan are highly conserved between nematodes and mammals.³¹ Hence, the anti-aging activity characteristics and its mechanism of SLE will be further explored using the C. elegans model.

In this study, a novel CPE method was used to extract SL with different polar solvents, and the conditions with the best extraction effect were screened out. For the first time, the chemical composition of SLE was comprehensively analysed using LC-ESI-LTQ-Orbitrap-MS, GC-MS, and an automatic amino acid analyzer. Next, an in vivo C. elegans model was adopted to determine the anti-aging effects of SLE and to delve into elucidating its intrinsic mechanisms by using gene mutant and green fluorescent protein-bound nematodes. In short, this study not only offers an efficient approach for the optimal utilization of by-products in the brewing industry but also provides a new way for the development of the anti-aging health field.

2. Materials and methods

2.1. Materials

SL was received from Tianjin Nakatani Brewing Co., Ltd. The total protein assay kit (BCA) was procured from the Nanjing Jiancheng Institute of Biological Engineering. The primers, designed specifically for the experiment, were acquired from Sangon Biotech Co., Ltd (Shanghai, China). The analytical-grade reagents utilized in the experiment were sourced from Guangzhou Maolin Biotechnology Co., Ltd (Guangzhou, China).

2.2. SLE extraction

SLE was obtained by the CPE method (PCT/CN2014/082107) developed by our team. Pretreatment of drying or degreasing was performed on SL. Water or 80% ethanol was utilized as the extraction solvent. The extraction parameters were as follows as per our preliminary research: CPE-1, continuous phase-transition extraction applying 0.8 MPa at 80 °C for 90 min; CPE-2, continuous phase-transition extraction applying 0.2 MPa at 60 °C for 60 min; and CPE-3, continuous phase-transition extraction applying 0.5 MPa at 70 °C for 120 min. Then, the crude extract was concentrated to 1/6 of its original volume through low-temperature and reduced-pressure evaporation. Following vacuum freeze-drying, the specimen was reconstituted in ultrapure water and subsequently preserved at −20 °C.

Ultrasound assisted extraction (UAE) was performed as a control experiment. An ultrasonic bath system (SN-QC-100D, Shanghai Sunne Equipment Co., Ltd, Shanghai, China) was used for extraction. The conditions for UAE comprised a temperature of 80 °C, duration of 90 minutes, ethanol concentration at 80%, and liquid-to-solid ratio of 1 : 10.

2.3. Antioxidant capacity in vitro analysis

2.3.1 DPPH radical scavenging rate. Samples were prepared in seven different dilutions (1 : 1 to 1 : 64). At room temperature and protected from light, 100 μL of the sample solution was mixed with 100 μL of DPPH solution in anhydrous ethanol for 30 minutes, followed by the measurement of absorbance at 517 nm. The calculation formula for the radical scavenging rate was as follows:
where A₀ is the absorbance of the blank group, A₁ is the absorbance of the sample group and A₂ is the absorbance of the control group.

2.3.2 ABTS⁺ radical scavenging rate. Samples were prepared in seven different dilutions (1 : 1 to 1 : 64). To measure the absorbance, 100 μL of the sample solution was combined with 100 μL of the ABTS⁺ working solution at room temperature and kept in the dark for 10 minutes. The radical scavenging rate was calculated using the following formula:
where A₀ is the absorbance of the blank group, A₁ is the absorbance of the sample group and A₂ is the absorbance of the control group.

2.4. Analysis of the composition

For proximate analysis, the SL sample was analysed for moisture, crude lipid, carbohydrate, ash, crude fibre, and protein contents according to the methods described by AOAC (2000). The total sugar content of SLE was determined by the phenol–sulfuric acid method with glucose as the standard. The protein content of SLE was determined by using the BCA protein quantification kit. The total polyphenol content of SLE was analyzed using the Folin–Ciocalteu method and gallic acid was used as the reference compound.³²

2.4.1 Free amino acid analysis. An appropriate amount of the sample was diluted with an equal volume of water and then mixed with an equal volume of 5% sulfosalicylic acid; the mixture was centrifuged at 12 000 rpm after standing for 1 h. The supernatant was filtered with a 0.22 μm water filter. An automatic amino acid analyzer (L-8900, Hitachi High-Tech Corporation, Tokyo, Japan) was utilized for the analysis. The detailed operational parameters for the testing were as outlined below: a sulfonic acid cationic resin separation column (4.6 mm × 60 mm) was used for the chromatographic column, and the sample size was 20 μL. The detector used was a tungsten lamp detector. Citric acid (lithium) PF buffer was used as the mobile phase. The flow rate was 0.35 mL min⁻¹ for the elution pump and 0.30 mL min⁻¹ for the derivative pump. Reaction column temperature: 135 °C; the detection wavelength was 570 nm in channel 1 and 440 nm in channel 2.

2.4.2 LC-ESI-LTQ-Orbitrap-MS analysis. SLE was lyophilized and dissolved in methanol. An appropriate amount of the sample was diluted with an equal volume of water and then mixed with an equal volume of 5% sulfosalicylic acid; the mixture was centrifuged at 12 000 rpm after standing for 1 hours. The supernatant was filtered with a 0.22 μm water filter. For analysis, an LTQ Orbitrap Velos mass spectrometer (Thermo Fisher Scientific, USA) equipped with an ESI source was used in the positive mode. The chromatography was performed on a C18 column (50 μm × 2 μm × 15 cm, Thermo Fisher Scientific, USA). Experimental operation parameters were set as follows: column temperature, 30 °C; flow rate, 0.2 mL min⁻¹; sample size, 10 μL; mobile phase A, water (0.1% formic acid); mobile phase B, acetonitrile (0.1% formic acid); ionization mode, ESI+; scanning mode, MRM; skimmer, 65 V; gas flow, 9 L min⁻¹; gas temperature, 300 °C; capillary voltage, 4000 V; and nebulizer, 30 psi. Data analysis was carried out using Compound Discoverer software 3.3 (Thermo Fisher Scientific, USA).

2.4.3 GC-MS analysis. A 1 μL aliquot of the methanol-diluted, freeze-dried extract was injected into the GC-MS system (TSQ 800 EVO, Thermo Fisher Scientific, USA) for analysis. A capillary column, specifically the HP-5MS column (30 m × 250 μm, Thermo Fisher Scientific, USA) with a 0.25 μm coating thickness, was employed. The injector was set to a temperature of 280 °C, and the temperature profile was initiated at 50 °C for a 2-minute hold, followed by a ramp to 280 °C at a rate of 10 °C min⁻¹, with a final hold of 15 minutes. Helium gas, flowing at a constant rate of 1.5 mL min⁻¹, served as the carrier in the gas chromatography process. Identification of compounds was achieved by referencing the NIST 11 library, while the composition percentages were calculated based on the relative abundances observed in the chromatogram. The HP quadruple mass spectrometer was operated in the EI mode at 70 eV with a scan range of 10–700 m/z. The entire analysis, along with a blank solvent, was conducted in triplicate to ensure accuracy.

2.5. Determination of anti-aging activity

2.5.1 Strains and maintenance of C. elegans. Bristol N2 (wild-type), QV225 [skn-1(zj15)], GR1307 [daf-16(mgDf50)], PS3551 [hsf-1(sy441)I], LD1 (ldIs7 [skn-1b/c::GFP + rol-6(su1006)]), CF1553 {muIs84 [pAD76(SOD-3::GFP)]}, RB759 [akt-1(ok525)], TJ356 [zIs356 IV (pdaf-16-daf-16::GFP; rol-6)], and NL5901 [pkIs2386] nematodes were obtained from the Caenorhabditis Genetics Center (Minnesota, USA). In an incubator maintained at 20 °C, all strains were cultivated and preserved on Petri plates with NGM agar inoculated with live Escherichia coli OP50 (E. coli OP50). SLE stock was combined with the E. coli OP50 solution in a 1 : 9 ratio, resulting in final SLE concentrations of 0, 1, 2, and 4 mg mL⁻¹. Using the bleaching method, which involved treating gravid hermaphrodites with sodium hypochlorite, synchronous populations were successfully obtained for the experiment.

2.5.2 Lifespan assay. The lifespan assays were conducted following a previously reported methodology, with minor adjustments made.³³ Each experimental group consisted of at least 50 worms, which were grown at 20 °C. During the reproductive stage, they were transferred to a new culture plate daily, and this operation was repeated approximately every other day later. Worms were considered dead when they showed no reaction to the touch of the platinum needle.

2.5.3 Motoricity assay. At three distinct stages of the life cycle, motor ability was assessed through three different methodologies.³¹ The worms were randomly selected on fresh NGM Petri dishes, and then used after 1 min of adaptation. The nematodes were categorized into three classes based on their motility and counted: class A, where nematodes exhibited a spontaneous sinusoidal movement; class B, characterized by body movement in response to stimulation; and class C, where nematodes only displayed head or tail wiggling upon stimulation. Furthermore, the frequencies of body bending and head swinging were assessed over intervals of 1 minute and 30 seconds, respectively.

2.5.4 Pharynx pumping assay. On the 5th, 10th and 15th days of nematode culture, 10 nematodes were randomly selected on NGM Petri dishes containing OP50 and acclimated for 1 min. Then, within a 30-second observation period, the number of pharynx pumps was recorded, with the extreme maximum and minimum values from each dataset being excluded.

2.5.5 Reproduction assay. This assay was conducted according to a previously reported method.³⁴ During the spawning period, every 24 hours, L4 wild-type larvae were transferred to new plates at a density of 2 worms per plate. The egg-laying plates were kept in 20 °C incubators to confirm egg hatching, allowing for the determination of both daily and overall brood sizes.

2.5.6 Age pigment fluorescence assay. Following 6 and 12 days of treatment, the worms were anesthetized using NaN₃ solution and subsequently mounted on slides for measurement via fluorescence microscopy. ImageJ 1.53k software was utilized to quantify the fluorescence intensity. A minimum of 10 nematodes from each plate were analyzed.

2.5.7 Reactive oxygen species content assay. After treatment with or without SLE for 96 hours, the nematodes were repeatedly transferred to NMG plates to remove OP50. Subsequently, 80 nematodes were transferred to 96-well plates containing H₂DCF-DA, and the fluorescence intensity was measured after 2 hours. The emission wavelength was set at 528 nm, with an excitation wavelength of 485 nm being used.

2.5.8 Biochemical assay. After 4 days of treatment with or without SLE, the worms were cleaned and homogenized, and protein concentrations were measured. The levels of MDA, together with the enzymatic activities of SOD and CAT in the nematodes, were all quantified by utilizing the assay kits acquired from the Nanjing Jiancheng Biological Engineering Research Institute.

2.5.9 Stress resistance assays. After incubating at 20 °C for 72 hours, the nematodes were moved to plates containing a solution of 30% H₂O₂ diluted to 0.1%. The count of viable nematodes was tallied every 30 min until no nematodes were alive. In thermo-tolerance tests, pretreated nematodes were exposed to 37 °C. Survival was noted every 2 hours until all died. The experiment was repeated 3 times with 30 nematodes per group.

2.5.10 Neuroprotective assay. The NL5901 worms cultured to day 5 and 10 were anesthetized with NaN₃, and mounted on agarose pads.³⁵ Using a fluorescence microscope, the visualization of GFP-tagged α-synuclein was achieved. The intensity of GFP fluorescence in each worm was quantified utilizing ImageJ software. Then, the number of body movements of each worm was measured in 60 s intervals.

2.6. Analysis of the anti-aging mechanism

2.6.1 RT-qPCR. Nematodes were cultured for 6 days, and their total RNA was extracted using TRIzol reagent. The HiScript Q RT SuperMix (Vazyme, Nanjing, China) was used for the reverse transcription of RNA into cDNA. Subsequently, cDNA was synthesized utilizing the Hieff qPCR SYBR Green Master Mix (Yeasen, Shanghai, China). The QuantStudio™ 3 Real-Time PCR system (Thermo Fisher Scientific, Waltham, USA) was used to evaluate the expression levels of target genes through RT-qPCR. The relative gene expression was determined using the 2^−ΔΔCt method, with act-1 serving as the internal reference gene. Details regarding the genes and their corresponding PCR primers are provided in Table 1. The experiments were performed in triplicate to ensure reliability.

Table 1 The sequence of primers

Genes	Forward primer sequence	Reverse primer sequence
act-1	CTGTCCTCTCCCTCTACGCTTCC	CAGTAAGATCACGTCCAGCCAAGTC
daf-16	TACATTGCTCGAAGTGCCGA	GTTCCGTCTGGTCGTTGTCT
age-1	TTCGTACGAGCCCAGAGAGA	TTCGTACGAGCCCAGAGAGA
skn-1	AAGACAGTGCTTCTCTTCGGT	TTCTCTTCGGCAGTGAGTGG
pmk-1	TGCTGAATGTACTCGCTCGG	TGGTCATCGTTGAGTCGCTG
sek-1	TACAAGCCGGATGCAAACCT	CATCGTCGCCAAACAGTGTC
hsf-1	TGTCATGCAGCCAGGATTGT	ATCTGCGTTGGTGGATGAGG
hsp-16.2	GTCACTTTACCACTATTTCCGTCC	CTCTTCGACGATTGCCTGTTG
akt-1	GCCATTGGCGGTGATCTCTAT	CGCTTCTACTAGGCGGTGTC
sod-3	TCTACTGCTCGCACTGCTTC	CTGGGAGAGTGTGCTTGGAG
sod-5	TTCTCCGTGGAACTGCTGTC	GAGGCTGACCACCTTATCGG
ctl-1	GTGTCGTTCATGCCAAGGGAG	TTCCAGCGTCAGTTGGATCG
ctl-2	ACACTCATTTCCACCGCCTT	TGAGAGCGAGCCTGTTTCTG

---

2.6.2 Visualization and quantification of SOD-3::GFP. These results were expressed as fluorescence scores relative to the control group. On the 5th day, a random selection of 40 CF1553 worms, either controlled or treated, were placed on an NGM plate to deplete bacteria. These worms were transferred to a solution of 10 mM NaN₃. Using excitation and emission filters set at 485 nm and 530 nm, respectively, the total GFP fluorescence was quantified. The results obtained were presented as fluorescence scores normalized to the control group.

2.6.3 Nuclear DAF-16 and SKN-1 translocation assays. The TJ356 and LD1 strains were pretreated with SLE for 6 days, respectively, and then transferred onto microscope slides for anesthesia using NaN₃ solution. Subsequently, the worms were examined utilizing a Zeiss LSM710 laser scanning confocal microscope. The expression patterns were classified into three categories: “cytosolic”, where no nuclear localization was evident; “intermediate”, characterized by localization in both the anterior and posterior intestines; and “nuclear”, in which nuclear localization was observed throughout the entire intestine. For each treatment, thirty nematodes were analyzed, and the entire experiment was replicated three times.

2.7. Statistical analysis

Statistical analysis was conducted with a minimum of three independent biological replicates. The data presented herein are represented as the average of three replicates ±SD. Survival curves were analyzed using the log-rank (Mantel–Cox) test, facilitated by GraphPad Prism version 9.0.0. SPSS 22.0 software was utilized to ascertain the statistical significance of differences via one-way analysis of variance (ANOVA).

3. Results and discussion

3.1. Continuous phase-transition extraction (CPE) enhanced sake lees extract (SLE) yield and bioactivity retention

To choose a solvent with appropriate polarity, we first conducted the basic nutritional analysis of SL. As presented in Fig. 1B, proteins of 43.70% and carbohydrates of 40.77% constituted the predominant fractions, which indicates that the majority of the active components in SL are likely to be of higher polarity. Thus, we conducted extractions using two eco-friendly polar solvents: 80% ethanol and water. Then, the total contents of amino acid, protein, sugar, and phenolic compounds in SLE, as well as its in vitro antioxidant capacity, were determined. Fig. 1C shows that the concentrations of the three key components in the SLE from the ethanol group were remarkably higher than those in the water group (p < 0.05), especially the total amino acid content, which was 63.16% higher. Besides, the ethanol-extracted SLE demonstrated superior DPPH radical scavenging efficacy to that of the water-extracted one (p < 0.05; Fig. 1D). Considering the above results, we selected 80% ethanol as the subsequent extraction solvent.

Consequently, based on previous CPE extraction experiments, we initially applied three typical process parameters: CPE-1, CPE-2, and CPE-3 (see the Materials and methods section). As a result, there were extremely significant differences in the total amino acid content among the extracts with different process parameters (p < 0.05), with the content ranging from 19.10 ± 0.45 mg g⁻¹ (CPE-3) to 87.49 ± 0.84 mg g⁻¹ (CPE-1). The CPE-1 group exhibited noticeably higher levels of total protein and sugar content than the other two groups (p < 0.05; Fig. 1E). Likewise, the SLE from CPE-1 maintained an over 90% clearance rate for DPPH and ABTS radicals, substantially outperforming other groups with increasing dilutions (p < 0.05; Fig. 1F). Preliminarily, we concluded that CPE-1, specifically continuous phase-transition extraction applying 0.8 MPa at 80 °C for 90 min, ensured the retention of active components while maintaining the excellent antioxidant activity of the extract.

In our previous studies, we found that drying and defatting is conducive to promoting the extraction of active components such as proteins and polysaccharides.¹⁷ In the extraction of rambutan seeds and coffee grounds, the pretreatment of drying and defatting has been employed to enhance the extraction rates of active ingredients.^36,37 Accordingly, to further optimize extraction, SL that underwent drying and defatting (DD), drying and non-defatting (DND), non-drying and non-defatting (NDND) were all extracted utilizing the CPE-1 parameters. As presented in Fig. 1G, the DD group dominated in the key chemical component content, as its total protein content was 3.83 times higher than that of the NDND group and 3.39 times higher than that of the DND group (p < 0.05). The reason might be that drying enhances extraction by avoiding solvent dilution and aiding penetration, while defatting releases bound polysaccharides and proteins. Similarly, compared to the NDND and DND groups, the SLE of the DD group exhibited distinctly better antioxidant activity (Fig. 1H). Taken together, the optimized procedure for SL extraction involved drying and defatting pretreatment followed by CPE-1 parameter-based extraction.

Ultrasound-assisted extraction (UAE), which can extract raw materials to a greater extent due to its ultrasonic cavitation effect, has been widely recognized and applied in the extraction of various raw materials including wine lees. To compare and evaluate the effect of CPE, as depicted in Fig. 1I and J, the total amino acid content of the SLE obtained through CPE exhibited the most significant increase (by 39.64%), followed by the total sugar content (by 23.49%). Without dilution, the SLE obtained through CPE demonstrated a DPPH radical scavenging rate of 89.30% and an ABTS radical scavenging rate of 99.92%, which were 10.78% and 7.39% higher (p < 0.05), respectively, than those obtained through UAE. Consistent with our findings, previous research has indicated that CPE compared to the traditional extraction methods can effectively enhance the extraction yield of active components, especially sugar.^13,23 This could be attributed to the continuous phase transition of the liquid in CPE, ensuring that the solvent remains unsaturated and allows for the full extraction of active substances. Meanwhile, the cyclic mode of CPE ensures efficient extraction within a short period of time, which only takes 90 minutes.

In summary, CPE likely offers excellent conditions for the extraction of SL, and the resulting SLE demonstrates a high retention of bioactive constituents, and manifests potent antioxidant properties.

3.2. SLE exhibited superior bioactive compositions related to anti-aging activity

Whether there are changes in the amino acid composition of SLE or an increase in the content of individual amino acid is an indication of the extraction effect of CPE. A total of 20 proteinogenic amino acids, 5 non-protein amino acids, and 1 dipeptide were detected using an automated amino acid analyzer. In particular, essential amino acids (EAA) accounted for 35.79% of the total amino acids (TAA), which was close to 40% EAA/TAA ratio recommended by the FAO and WHO, indicating that the nutritional value of SLE is exceedingly desirable (Fig. 2A). Remarkably, hydrophobic, acidic, and basic amino acids, identified as playing pivotal roles in antioxidant activity,^38,39 had respective proportions of 49.07%, 17.7%, and 10.34% (Fig. 2B).

Fig. 2 Analysis of free amino acids in SLE. (A) The ratio of hydrophobic amino acids, acidic amino acids and basic amino acids. (B) The ratio of essential amino acids and nonessential amino acids.

Moreover, the most abundant amino acid in SLE was alanine (1.78 mM), whose metabolism yields NADH, an essential intracellular reductant that aids in the mitigation of oxidative stress.⁴⁰ Previous reports have also indicated that alanine is the most abundant amino acid in sake, with concentrations ranging from 0.58 to 1.99 mM.⁴¹ Glutamate, the second most prevalent amino acid in SLE (0.83 mM), was proved to extend lifespan by maintaining mitochondrial respiratory function in C. elegans,⁴² and its concentration was comparatively higher than that reported in previous studies (0.23 to 1.23 mM). Interestingly, it has been previously found that proline (0.68 mM), the third most abundant component in SLE, transiently increases ROS production that leads to SKN-1/Nrf2 activation and thereby extends lifespan in C. elegans.⁴³ Trace amino acids should not be underestimated since, for example, γ-aminobutyric acid (0.18 mM) can slow down the accumulation of ROS, while ornithine (0.04 mM) is easily oxidized by free radicals.^40,44,45 In addition, it is worth mentioning that both ornithine and anserine were discovered in SLE for the first time. Apparently, CPE enabled not only a rich variety of amino acids and an increased content in SLE but also the acquisition of newly discovered substances, which further illustrated its extraction superiority.

In order to further recognize the functional substance present in SLE obtained by CPE, we conducted the identification through the application of LC-ESI-LTQ-Orbitrap-MS. First of all, 28 compounds across 6 categories, including 15 amino acids and their derivatives, 8 lipids and their derivatives, 2 organic acids and their derivatives, 1 saccharide, 1 ketone, and 1 coumarin, were characterized (Table 2). Strikingly, amino acids constituted over half of the detected substances, again suggesting that amino acids may be the primary components in SLE. What's more, SLE was not only rich in a variety of free amino acids but also contained peptides that have been identified for the first time, including Lys-Gln and Leu-Arg-Lys, with the relative contents of these peptides being 4.74% and 3.10%, respectively. The high content was attributed to the fact that approximately 50% of the total nitrogen in sake is composed of free amino acids (30%) and peptides (20%).⁴⁶ Numerous dipeptides present in fermented foods have been reported to exhibit free radical scavenging activity, such as Tyr-Lys, Leu-Arg, and Trp-Tyr.⁴⁷ Similarly, SL has previously been identified as containing peptides with antioxidant activity, among which Ile-Gln-Pro exhibits even greater activity than glutathione and ascorbic acid.^46,48 Also, an increasing number of studies found that free radicals prefer to bind the peptide composed of hydrophobic and basic amino acid residues like Leu, Arg, and Lys, thus being scavenged for exerting antioxidant activity.^49,50 Hence, we held the view that these peptides obtained by CPE likely contribute to the anti-aging health benefits.

Table 2 Tentative identification of the chemical constituents of SLE by LC-ESI-LTQ-Orbitrap-MS

No.	Compound	Formula	RT (min)	Significant ion, m/z	Relative percentage (%)
1	Sulfamic acid	H3NO3S	0.94	97.9909	5.11
2	Saccharopine	C11H20N2O6	1.00	309.1652	6.06
3	Vigabatrin	C6H11NO2	1.00	147.1125	5.40
4	D-(+)-Maltose	C12H22O11	1.22	365.1048	2.92
5	O-Acetyl-L-serine	C5H9NO4	1.48	148.0601	4.16
6	L-(+)-Aspartic acid	C4H7NO4	1.49	134.0444	0.88
7	L-Leucine	C6H13NO2	1.50	132.1039	4.53
8	L-(+)-Arginine	C6H14N4O2	1.71	175.1186	3.28
9	Lys-Gln	C11H22N4O4	1.78	275.1708	4.74
10	Agmatine	C5H14N4	1.79	131.1288	0.01
11	L-Pyroglutamic acid	C5H7NO3	1.80	130.0495	2.70
12	5-Aminovaleric acid	C5H11NO2	1.81	118.0858	3.65
13	Tetrahydro-2-thiophenecarboxylic acid	C5H8O2S	1.85	150.0580	2.48
14	1-(4-Bromophenyl)-2-phenylethan-1-one	C14H11BrO	1.86	275.0036	4.16
15	Glutarylcarnitine	C12H21NO6	1.89	276.1437	4.89
16	6-Aminocaproic acid	C6H13NO2	2.04	132.1016	1.31
17	L-Tyrosine	C9H11NO3	2.06	182.0808	5.69
18	L-Phenylalanine	C9H11NO2	2.72	166.0859	4.89
19	Leu-Arg-Lys	C18H37N7O4	5.11	416.2982	3.10
20	4-Hydroxycoumarin	C9H6O3	11.45	163.0387	4.89
21	Palmitic acid	C16H32O2	12.15	274.2735	6.93
22	2-Amino-1,3,4-octadecanetriol	C18H39NO3	12.21	318.2996	5.84
23	N,N-Diethyldodecanamide	C16H33NO	12.94	256.2631	0.01
24	Sphinganine	C18H39NO2	13.38	302.3047	5.69
25	Stearoyl ethanolamide	C20H41NO2	13.68	310.3097	0.01
26	Oleamide	C18H35NO	14.21	282.2786	0.01
27	Lauramide	C12H25NO	14.59	200.2006	3.16
28	Erucamide	C22H43NO	14.86	338.3414	3.50

---

Furthermore, we made the inaugural discovery of two sphingosines within the extracts of SL: sphinganine (5.69%) and 2-amino-1,3,4-octadecanetriol (5.84%), which possibly facilitate the antioxidant effects of SLE as well. According to the literature, as the precursor of ceramide, sphingosine's carbon chain has double bonds and a terminal hydroxyl group, indicating that it is easy to make the double bond break, thus showing the antioxidant effect.⁵¹ Also noteworthy is the first discovery of 4-hydroxycoumarin (4.89%) in SL, which has been indicated to exhibit antioxidant capacity through the DPPH assay.⁵² To sum up, a diverse array of characteristic components collectively contributed to the efficacy of SLE.

Finally, we employed GC-MS to specifically detect volatile components. 12 molecules, including 2 phenols, 5 organic acids, 2 alcohol, 2 ketone, and 1 amine, were detected in the studied sample (Table 3). Of note, lactic acid (7.39%) and glycolic acid (1.81%) were found, which belong to α-hydroxy acids (AHAs). These substances, previously identified in sake, were recognized as some of the active components in the beverage, and thus were likely to contribute to the efficacy of SLE. Indeed, due to the presence of hydroxyl and carboxyl groups, AHAs are well known to possess antioxidant activity.⁵³ Additionally, 2,4-di-tert-butylphenol (20.21%) was present at a relatively high percentage. This widespread compound in plants is able to efficiently react to free radical sources.^54,55 In fact, our prior research has identified that polar constituents are predominant in SL, with nonpolar components being present in negligible amounts. Consequently, the low detection of volatile components in SLE seems to be reasonable. Nevertheless, the above-mentioned volatile components were successfully extracted by CPE, thereby deepening our understanding of the characteristics of SLE.

Table 3 Compounds and relative percentage detected by GC-MS in SLE

No.	Compound	Formula	RT (min)	Molecular weight	Relative percentage (%)
1	Methyl urea	C2H6N2O	15.42	74.082	2.46
2	Hydroxyacetone	C3H6O2	15.33	74.078	4.93
3	Lactic acid	C3H6O2	15.56	90.078	7.39
4	Glycolic acid	C2H4O3	18.22	76.051	1.81
5	Butylated hydroxytoluene	C15H24O	35.11	220.350	2.14
6	Geranyl isovalerate	C15H26O2	36.82	238.366	1.86
7	Octadecanoic acid	C18H36O2	40.01	284.477	11.06
8	Eicosanoic acid	C20H40O2	40.35	312.530	2.68
9	Hexadecanoic acid	C16H32O2	41.42	256.424	19.88
10	2,4-Di-tert-butylphenol	C14H22O	43.32	206.324	20.21
11	1-Hexadecanol	C16H34O	44.87	242.441	1.42
12	Octaethylene glycol monododecyl ether	C28H58O9	45.31	538.755	22.73

---

Based on the above results, we reached the conclusion that CPE has an excellent extraction effect, which has laid a solid foundation for the activity of SLE. Notably, the diverse bioactive constituents present in SLE possibly exert synergistic effects, thereby enhancing the overall activity of this composite extract. This assumption can be supported by some research findings that amino acids have a synergistic effect with substances, such as other amino acids and phenolic compounds, and that their combination will increase antioxidant activity.^23,56,57 For instance, regarding the free radical absorption capacity, a synergistic interaction has been observed when four amino acids present in sake are combined.²³ The mean lifespan of C. elegans was extended by 39% through the use of whole apple extract, surpassing the effects of its primary constituents (p < 0.05).⁵⁶ In general, supplementation with antioxidants from natural sources is an effective anti-aging strategy, and SLE with diverse bioactive composition makes it a promising focus.⁵⁸ Therefore, we continued to explore the anti-aging effect of SLE in C. elegans.

3.3. SLE extended lifespan and ameliorated age-related phenotypes in C. elegans

The bioactivity of extracts often relies on the synergistic effects of multiple components, and prioritizing holistic efficacy evaluation of raw materials represents an effective strategy for the industrial development of functional ingredients.⁵⁶ Hence, this research employed the whole SLE for analysis. To comprehensively visualize the anti-senility effect of SLE at different doses in C. elegans, we systematically evaluated various aspects, including longevity, mobility, reproduction, and age-related pigments. Simply put, compared to the blank group, the survival curves of worms exposed to three different concentrations of SLE exhibited a notable rightward shift (p < 0.05). In particular, 4 mg mL⁻¹ SLE demonstrated the most pronounced impact on lifespan prolongation, with mean longevity increases of 19.32% and maximum longevity increases of 10.66 days (p < 0.05; Fig. 3A and Table 4). Previous studies have yielded similar findings, reporting that the zymolytic grain extract, a substance resembling sake lees, remarkably extended the lifespan of C. elegans.⁵⁹ Preliminarily, we considered that SLE had the potential to retard senility of C. elegans.

Table 4 Statistical analysis of the lifespan in N2 C. elegans or mutant strains

Genotype	Treatment (mg mL^−1)	Mean lifespan	Median lifespan	Maximum lifespan	% increase in mean lifespan
Results are presented as the mean ± SD (n = 3), and different letters in a column denote values that are significantly different (p < 0.05).
N2	0	14.63 ± 0.47^a	14.00 ± 1.00^a	27.67 ± 0.58^a	—
	1	15.94 ± 0.39^b	15.33 ± 1.53^a	32.67 ± 1.53^b	8.97
	2	16.20 ± 0.32^b	16.00 ± 1.00^a	35.33 ± 1.53^b	10.72
	4	17.46 ± 0.93^b	16.33 ± 0.58^b	38.33 ± 3.06^b	19.32
N2 (35 °C)	0	5.96 ± 0.69^a	7.33 ± 1.15^a	9.33 ± 1.15^a	—
	4	8.33 ± 0.09^b	9.33 ± 1.15^a	11.33 ± 1.15^b	39.59
N2 (H2O2)	0	1.84 ± 0.13^a	2.00 ± 0.50^a	3.50 ± 0.00^a	—
	4	2.63 ± 0.12^b	2.33 ± 0.29^a	4.67 ± 0.29^b	43.39
daf-16 mutant strains	0	16.05 ± 1.57^a	17.33 ± 2.08^a	27.00 ± 1.00^a	—
	4	18.70 ± 1.03^b	18.67 ± 1.53^a	31.67 ± 2.08^a	16.48
skn-1 mutant strains	0	13.99 ± 0.49^a	15.00 ± 0.00^a	25.67 ± 2.08^a	—
	4	15.11 ± 0.65^a	16.00 ± 1.00^a	26.67 ± 3.06^a
hsf-1 mutant strains	0	14.93 ± 0.44^a	16.00 ± 1.00^a	25.67 ± 2.08^a	—
	4	15.14 ± 0.62^a	16.00 ± 1.00^a	26.00 ± 3.61^a
akt-1 mutant strains	0	13.86 ± 0.63^a	14.67 ± 1.53^a	24.33 ± 3.21^a	—
	4	14.29 ± 0.20^a	15.33 ± 1.53^a	24.67 ± 2.89^a

---

Fig. 3 Lifespan prolongation and alleviation of age-associated phenotypes by SLE in C. elegans. (A) The survival curve of N2 worms treated with various concentrations of SLE (1, 2 and 4 mg mL⁻¹). (B) Percentage of each movement category in the ABC movement assay. Worms were classified according to their locomotion: A – free movement, B – stimulated motion, and C – stimulated weak motion. (C) The frequency of the head swing. (D) The frequency of the body bends. (E) The frequency of pharyngeal pumps. (F) The number of offspring. (G) Representative images showing the accumulation of lipofuscin in N2 worms. (H) The relative fluorescence intensity of lipofuscin in each group. (I) Survival curve of the C. elegans N2 strain under H₂O₂-induced oxidative stress. (J) Survival curve of the C. elegans N2 strain under heat shock stress. (K) Representative fluorescence images depicting α-synuclein accumulation in NL5901 worms. (L) The fluorescence intensity of α-synuclein in NL5901 worms treated with SLE. (M) The number of body bends in NL5901 worms treated with SLE. (N) Levels of SOD enzyme activity. (O) Levels of CAT enzyme activity. (P) Accumulation of MDA. (Q) Relative fluorescence intensity of ROS at 2 h. All data are representative of at least three independent experiments. Statistically significant differences were considered at p < 0.05 and designated with different letters (a, b and c). Asterisks (*) denote significant differences from the control group (*p < 0.05, **p < 0.01, ***p < 0.001).

It is well documented that age-related decline in motoricity occurs at different developmental stages. Hence, the motor function of nematodes was measured on the 5th, 10th, and 15th days. As illustrated in Fig. 3B–D, different doses of SLE treatment remarkably relieved locomotory degradation by senescence. Compared with the control ones, the proportion of 4 mg mL⁻¹ SLE-cultured worms exhibiting spontaneous sinusoidal movement was elevated by 50% at both middle and late life stages (p < 0.05). The research results that wheat bran peptides with components similar to those of SLE also demonstrated the efficacy of improving the motility of nematodes can support our perspective.⁶⁰ Moreover, the worms exhibited a maximal enhancement in their pharyngeal pumping rate on the 15th day after 4 mg mL⁻¹ SLE treatment (p < 0.05; Fig. 3E). Accordingly, the administration of SLE enhanced the athletic capabilities of C. elegans to a great extent, going beyond mere augmentation of survival rates.

Remarkably, the “trade-off” mechanism, which involves delaying aging at the expense of fertility, may be closely related to the pro-longevity of the extract. To ascertain if SLE induced adverse effects on C. elegans under the experimental conditions, we monitored the daily progeny production and calculated the total number. Findings showed that neither the daily number of eggs laid nor the total number of eggs laid were noticeably decreased upon SLE treatment (p > 0.05; Fig. 3F). Namely, SLE showed non-reproductive toxicity to C. elegans at these concentrations.

Furthermore, we detected lipofuscin accumulation, a marker of aging, reflected by the intensity of green fluorescence in nematodes. Fig. 3G shows that there was no distinct difference in the fluorescence intensity between the treated and untreated groups on the 6th day, but were present on the 12th day. Interestingly, the medium dose (2 mg mL⁻¹) of SLE yielded an optimal reduction in the lipofuscin level, followed by the 4 mg mL⁻¹ and 1 mg mL⁻¹ doses, each of which also resulted in a lipofuscin decrease exceeding 40.00% (p < 0.05; Fig. 3H). The “mitochondrial–lysosomal axis theory” suggests that the accumulation of lipofuscin is sustained by the robust activity of lysosomes. Subsequently, in a later life stage (12–15 d), the quantity of lipofuscin can be substantially decreased by antioxidant compounds, as lysosomes become metabolically inactive, thereby rendering the reduction quantifiable.⁶¹ Clearly, even when observed in the later stages of life, the supplementation of SLE can significantly reduce the accumulation of lipofuscin in C. elegans, a fact that remains unquestionable.

To conclude, our findings provided evidence that SLE possess the ability to prolong the lifespan and promote the healthspan of C. elegans. Therefore, based on the results of the experiments including lifespan, motoricity, and age pigment fluorescence, we identified 4 mg mL⁻¹ as the optimal SLE concentration for further study.

3.4. SLE strengthened the antioxidant defense system and displayed neuroprotective effects in C. elegans

To point out, evidence suggested a positive inherent relationship between increased longevity and improved stress resistance. Hence, we further evaluated the possible protective effect of SLE against acute oxidative stress, including H₂O₂-induced oxidative stress and 37 °C culture-induced heat stress. The selection of 37 °C was primarily based on its historical use for analyzing heat shock protein induction in diverse organisms, as well as its prevalence in nematode heat stress experiments.^31,62,63 As shown in Fig. 3I and J, the survival curve of the SLE treatment group was significantly shifted to the right in each experiment. Under oxidation and high temperature conditions, the mean lifespan of the SLE group increased by 43.39% and 39.59%, respectively, and the maximum lifespan was also significantly increased (p < 0.05; Table 4). Based on this, we can infer that the anti-aging effects induced by SLE in vivo were possibly mediated through the enhancement of stress tolerance. It was worth noting that with regard to the research findings on zymolytic grain extract, it has been determined that the impact on several physiological indicators during stress, including UV-B and heat stress, can predict its role in improving healthspan.⁵⁹

There is increasing evidence that points towards age serving as a notable determinant in the advancement of neurodegenerative diseases (NDs), particularly Parkinson's disease (PD).³³ In this study, we examined the effects of SLE on mitigating PD symptoms, which exhibit PD-related accumulation of aggregates and motility decline during later life stages. Excitingly, our findings demonstrated that administration of SLE markedly decreased the accumulation of α-synuclein aggregates in NL5901 nematodes, evidenced by a significant reduction in the fluorescence intensity by 20.89% on the 10th day and 25.13% on the 10th day, respectively (p < 0.05; Fig. 3K and L). Furthermore, the application of SLE successfully halted the reduction in motility observed in NL5901 nematodes (p < 0.05; Fig. 3M). Actually, numerous studies have indicated that oxidative stress serves as a unifying factor linking diverse pathological characteristics of PD, including mitochondrial impairments and the accumulation of α-synuclein.^64,65 Previous findings suggested a feasible therapeutic approach for alleviating oxidative stress through the utilization of SLE. In view of this, all the clues together point to the conclusion that SLE delays aging by reducing oxidative stress and displayed neuroprotective effects.

Finally, the free-radical theory proposes that aging is fundamentally the consequence of the persistent generation of free radicals and the oxidative damage in the body. Also, building on our previous research that confirmed the ability of SLE to enhance the stress resistance and protect the nervous system in C. elegans, we aimed to elucidate the connection by assessing the antioxidant defense system. Hence, we assessed the effects of SLE on oxidative by-products and key enzymes. As shown in Fig. 3N and O, the activity of CAT and SOD in nematodes cultured with 4 mg mL⁻¹ SLE statistically increased 1.02 and 5.38 times, respectively (p < 0.05). In addition, SLE treatment remarkably reduced MDA by 69.92% in comparison with the control group (p < 0.05; Fig. 3P). Interestingly, despite a slightly increase in ROS levels observed in the SLE-treated group compared to the control group, no statistically discernible difference existed between them. This is because a moderate increase in ROS levels may convey signaling molecules associated with antioxidant stress, thereby activating antioxidant defenses.^31,66

Collectively, SLE bolstered the antioxidant defense system in C. elegans by enhancing the activity of antioxidant enzymes and inhibiting the accumulation of oxidative by-products, thereby aiding in the resistance to oxidative stress and protection of the nervous system, synthetically exerting anti-aging effects.

3.5. SLE regulated anti-aging effects through the SKN-1/Nrf2 and HSF-1 pathways

The anti-aging effect of SLE has been confirmed, and the mechanism of action needs to be further studied. Thus, to elucidate the anti-aging mechanism induced by SLE in C. elegans, we employed efficient methodologies including mutants, RT-qPCR, and green fluorescent protein (GFP). Importantly, the evolutionarily conserved MAPK cascade, which functions as a transducer of extracellular signals, constitutes a fundamental component in the regulation of lifespan and the response to stress resistance.⁶ The MAPK cascade regulates the key antioxidant and detoxification transcription factor SKN-1, which is analogous to the human nuclear factor erythroid 2-related factor 2 (Nrf2).⁶⁷ In particular, Nrf2 is essential for regulating the expression of key oxidative stress components across all human organs and is deeply implicated in aging processes and neurodegenerative diseases, making it a central target in aging research.⁶⁸ As a pivotal upstream factor, sek-1 encodes a MAPK kinase that phosphorylates PMK-1, thereby activating this signaling pathway.^66,67 In contrast, skn-1 plays a crucial role in modulating the expression of downstream genes that respond to stress.

The aforementioned compositional analysis revealed that SLE contains remarkably high levels of proline. This amino acid has been demonstrated to induce activation of the SKN-1/Nrf2 pathway and promote life span extension in C. elegans, thus suggesting potential modulatory effects of SLE on this pathway.⁴³ To determine whether SLE extended lifespan through SKN-1/Nrf2, we tested the mRNA expression of some key genes, including sek-1, pmk-1, and skn-1. The data exhibited a distinct increase in sek-1 and skn-1 genes by 3.41 and 2.10 times, respectively (p < 0.05; Fig. 4E). For further clarification, lifetime experiments with the skn-1 mutant strains were performed. As presented in Fig. 4G and Table 4, the absence of lifespan increasing in the skn-1 mutant suggested that skn-1 is required for the anti-senescence efficacy of SLE. Then, given that the nuclear localization of SKN-1/Nrf2 serves as an essential prerequisite for its transcriptional activation, we employed transgenic strains expressing the SKN-1::GFP fusion protein to examine whether SLE could induce its nuclear translocation. As expected, the outcomes indicated remarkably increased accumulation of SKN-1/Nrf2 of SLE-treated worms in the nucleus compared to the control groups by 72.73% (p < 0.05; Fig. 4C and D). Evidently, it meant that SLE can activate skn-1 by affecting its subcellular distribution. In summary, we can reach a conclusion that the health effects mediated by SLE are positively associated with the SKN-1/Nrf2 pathway.

Fig. 4 Mechanism of SLE exerting anti-aging effects in C. elegans. (A) Relative fluorescence intensity of SOD-3::GFP. (B) Representative fluorescence images of CF1553 worms. (C) The percentage of transgenic TJ356 and LD1 worms of each category. (D) Representative fluorescence images of TJ356 and LD1 worms with cytosolic (right), intermediate (middle), and nuclear (left) DAF-16::GFP and SKN-1::GFP localization. (E) Levels of mRNA transcription. Survival curves of (F) daf-16, (G) skn-1, (H) akt-1, and (I) hsf-1 mutant strains. Asterisk (*) denotes significant differences from the control group (*p < 0.05, **p < 0.01, ***p < 0.001).

Considering that the supplementation of SLE enhanced the resistance of C. elegans to stress, we speculated that SLE may affect the HSF-1 pathway. Actually, the HSF-1 pathway plays a crucial role in sustaining protein folding homeostasis, mitigating diverse stress conditions, and pathological states (e.g., neuropathy and aging), which are linked to the accumulation of misfolded proteins.⁶⁹ To elucidate this possibility, we first performed a quantitative analysis of mRNA levels of key genes under the HSF-1 pathway, including hsf-1, hsp-16.1, and hsp-16.2. Consistent with our speculation, SLE treatment distinctly upregulated the expression of hsf-1, hsp-16.1 and hsp-16.2 genes (p < 0.05; Fig. 4E). For validation, the life-prolonging effects of SLE in hsf-1 mutants were tested subsequently. As shown in Fig. 4I and Table 4, treatment of SLE failed to prolong the life duration of hsf-1 mutants, confirming that hsf-1 is indispensable. Therefore, we proposed that SLE enhances stress resistance through the HSF-1 pathway, a target for anti-aging effects. Moreover, accumulated studies have established that HSF-1 upregulates the expression of heat shock proteins (HSPs),⁷⁰ which can couple age-related disease proteins, reducing their accumulation during aging.⁶⁶ Accordingly, this may explain the reason why α-synuclein aggregation was reduced and motor performance was improved after SLE treatment in NL5901 nematodes.

Interestingly, many phytochemicals protect against stress and prolong lifespan via SKN-1/Nrf2 and HSF-1 pathways, such as baicalein, tomatidine, and green tea extract.^33,71 These two pathways might have engaged in a mechanistic interplay. Indeed, SKN-1/Nrf2 bound to a functional antioxidant response element (ARE) in the HSF-1 promoter, upregulated the expression of HSF-1, and thereby potentiated the heat-shock response.^72,73 Furthermore, it was also proposed that they engaged in crosstalk by sharing targets like HSP70 and sometimes compensated for each other.⁷⁴ Collectively, the SKN-1/Nrf2 and HSF-1 pathways synergistically contributed to the SLE-mediated lifespan extension mechanism in nematodes and reduced the incidence of neurodegenerative diseases.

3.6. SLE modulated akt-1 and antioxidant enzyme-related genes independent of the IIS pathway

In C. elegans, the insulin/insulin-like growth factor-1 (IIS) signaling pathway functions as a highly conserved and essential modulator of organismal development and aging, closely associated with the two aforementioned pathways.⁷⁵ In contrast, DAF-16/FOXO represents a primary target activated by decreased IIS.⁷⁰ Hence, to examine the impact of SLE on the IIS pathway, we assessed the expression levels of age-1, akt-1, and daf-16 genes. The results showed that SLE did not noticeably regulate the expression levels of age-1 and daf-16, but significantly increased the expression levels of akt-1 (Fig. 4E). Additionally, SLE feeding triggered a 16.48% increase in the mean lifespan of daf-16 mutant strains (p < 0.05; Fig. 4F and Table 4). Meanwhile, no significant difference in the subcellular localization of DAF-16/FOXO was detected between the control and experimental groups (Fig. 4C and D). Thus, it can be confirmed that SLE acts independently of daf-16. Interestingly, a discernible difference in survival outcomes was not observed for akt-1 mutants when the SLE group was compared to the CK group (p > 0.05; Fig. 4H and Table 4). There appeared to be differences in the necessity of different genes in the IIS pathway. The possible explanation is that SLE can regulate the expression of akt-1, but was not enough to regulate daf-16. In fact, akt-1 can transmit signals to genes in other important pathways, phosphorylating SKN-1/Nrf2, which in turn leads to the accumulation of nuclear skn-1 and the activation of its corresponding target gene.⁷⁶ Therefore, SLE-induced longevity might not be associated with the IIS pathway, yet could involve the regulation of akt-1.

Moreover, SKN-1/Nrf2 modulates the expression of phase II detoxifying enzyme genes, including superoxide dismutase (SOD) and catalase (CAT) in C. elegans.⁶⁷ The antioxidant enzyme system is capable of reflecting the antioxidant capacity and influencing the stress tolerance and lifespan of nematodes.³⁶ Consequently, in order to clearly understand the effects of SLE on antioxidant enzyme genes, we performed a quantitative analysis on the genes encoding CAT (ctl-1 and ctl-2) as well as SOD (sod-3 and sod-5). The data showed that in addition to ctl-2, the expressions of sod-3, sod-5 and ctl-1 were remarkably upregulated to varying degrees (p < 0.05; Fig. 4E). Next, the strain CF1553 (SOD-3::GFP) was applied to visualize the accumulation of the SOD-3 protein. The relative quantitative fluorescence analysis revealed that the fluorescence intensity of CF1553 nematodes subjected to SLE treatment was significantly greater than that of the control group by 24.39% (p < 0.05; Fig. 4A and B). To put it simply, these results suggested that SLE promoted the expression of sod-3 and explained the reason why SOD activity substantially increased. Accordingly, by inducing the transcription and expression of antioxidant enzyme genes, SLE could improve the antioxidant capacity of worms and ultimately achieve the goal of extending lifespan.

In summary, the anti-aging effects of SLE in C. elegans primarily targeted SKN-1/Nrf2, with the HSF-1 pathway also playing a mediating role. Additionally, the regulation of genes associated with antioxidant enzymes played a significant role in SLE's efficacy. This led to the strengthening of the antioxidant defense system and stress tolerance in C. elegans, ultimately promoting longevity. Lastly, the IIS pathway might not be associated with SLE.

4. Conclusions

Collectively, compared to ultrasound-assisted extraction, a novel continuous phase-transition extraction method (CPE) significantly improved the extraction efficiency, resulting in a higher retention rate of active components and enhanced free radical scavenging activity in sake lees extract (SLE). Moreover, SLE is rich in amino acids closely associated with antioxidant efficacy, and contains distinctive amino acids such as ornithine and γ-aminobutyric acid. For the first time, antioxidant substances, including sphinganine, 2-amino-1,3,4-octadecanetriol, Lys-Gln, and Leu-Arg-Lys, were discovered in SLE. In terms of efficacy, SLE significantly prolonged the lifespan of C. elegans under normal and stress conditions. Simultaneously, the evidence of age-related phenotypes and the antioxidant defense system being ameliorated suggested a pronounced promotion in the anti-aging capacity of nematodes treated with SLE. Furthermore, the mechanisms underlying the aforementioned effects were mediated by the SKN-1/Nrf2 and HSF-1 pathways, as evidenced by the upregulation of skn-1 and hsf-1 genes and lifespan experiments. In particular, SLE modulates the subcellular localization of SKN-1/Nrf2 (Fig. 5). Overall, these results emphasized that CPE emerges as a promising technique for the extraction of bioactives. Besides, SLE is an excellent resource for anti-aging active factors and can be further exploited as a raw material for functional foods and cosmetics. This study elucidated the potential for by-products from the brewing industry to have a second life and offered strategies for their high-value utilization. Future studies can focus on elucidating its anti-aging effect in mice and human clinical research.

Fig. 5 A schematic diagram of the study on sake lees.

Author contributions

Xiaojuan Liu: conceptualization, methodology, data curation, and writing – review & editing. Chaowan Guo: supervision, project administration and funding acquisition. Xiaojun Zou: conceptualization, methodology, validation, data curation, writing – original draft, writing – review & editing, and visualization. Yuan Xiao: formal analysis, investigation, and writing – review & editing. Yanfeng Nie: investigation and data curation. Jinling Yang: investigation. Jie Xiao: resources, supervision and project administration.

Data availability

The authors confirm that the data supporting the findings of this study are available within the article.

Conflicts of interest

All authors proclaim that they possess no interest conflict.

Acknowledgements

This work was financially supported by the Guangzhou Key R&D Plan Project (grant no. SL2022B03J00806) and the Guangdong Key Areas Research and Development Plan Project (no. 2022B1111080003).

References

1. Y. Motono, S. Nishiumi, M. Yoshida and M. Takaoka, Metabolome analysis of the effects of sake Lees on adipocyte differentiation and lipid accumulation, Fermentation, 2023, 9, 300.
2. K. Yamato, Food-grade vinegar production from the extract of sake lees obtained by subcritical water treatment, J. Food Nutr., 2021, 7, 1–12.
3. K. Kawakami, C. Moritani, M. Uraji, A. Fujita, K. Kawakami, T. Hatanaka, E. Suzaki and S. Tsuboi, Sake lees hydrolysate protects against acetaminophen-induced hepatotoxicity via, activation of the Nrf2 antioxidant pathway, J. Clin. Biochem. Nutr., 2017, 61, 203–209.
4. C. Li, M. Li, Y. Jin, Q. An, H. Dang and W. Gong, Investigating the therapeutic effects of a Japanese sake yeast supplement on a zebrafish model of Parkinson's disease: Antioxidant and inflammatory responses, Exp. Gerontol., 2024, 194, 112509.
5. M. Haghipanah, F. Ghalami, M. Saadat, S. Abbasi-Maleki, R. H. Gholizadeh Salmani, T. Budde and N. Moradikor, Investigation of the neuroprotective action of Japanese sake yeast on dementia type of Alzheimer disease in rats: Behavioral and neurobiochemical assessment, NeuroSci, 2023, 4, 45–53.
6. Y. Lin, C. Lin, Y. Cao and Y. Chen, Caenorhabditis elegans as an in vivo, model for the identification of natural antioxidants with anti-aging actions, Biomed. Pharmacother., 2023, 167, 115594.
7. Y. Murayama, J. Wiboonsirikul, P. Khuwijitjaru, T. Kobayashi and S. Adachi, Antioxidant characteristics of extracts from cereal residues by their subcritical water treatment, J. Oleo Sci., 2012, 61, 465–468.
8. M. E. Martin, E. Grao-Cruces, M. C. Millan-Linares and S. Montserrat-de la Paz, Grape (Vitis vinifera L.) seed oil: A functional food from the winemaking industry, Foods, 2020, 9, 1360.
9. G. P. S. Aguiar, C. D. Magro, G. O. Carvalho, A. E. Santos, M. Lanza and J. V. Oliveira, Co-precipitation of anthocyanin in PHBV by the SEDS technique, J. Food Sci. Technol., 2021, 58, 4217–4224.
10. T. Kimura, Different characteristics of 40 kinds of free amino acids and 5-amino levulinic acid between wines and sakes (Japanese rice wines), J. Future Foods, 2024, 4, 361–368.
11. F. Liu, Q. Kan, K. Feng, Y. Chen, L. Wen, B. He, X. Zhu, C. Wen, Y. Cao and G. Liu, Process of Zanthoxylum armatum DC. oil by a novel low-temperature continuous phase transition extraction: Evaluation of aroma, pungent compounds and quality, LWT, 2023, 176, 114523.
12. Y. Liu, Y. Li, W. Yu, Y. Ma, Y. Cao and L. Zhao, Extraction of high-quality Antarctic krill (Euphausia Superba) oil using low-temperature continuous phase-transition extraction equipment, J. Food Sci., 2024, 89, 9073–9087.
13. G. Liu, T. Hou, S. Guo, H. Lin, M. Chen, J. Miao, X. Liu, Y. Huang, Y. Cao, Y. Lan and M. Song, Comprehensive utilization of immature honey pomelo fruit for the production of value-added compounds using novel continuous phase transition extraction technology, Biology, 2021, 10, 815.
14. H. Chen, J. Wang, X. Liu, A. Zhou, J. Xiao, K. Huang, H. Chen and Y. Cao, Optimization in continuous phase–transition extraction of crude flavonoids from finger citron fruit and evaluation on their antiaging activities, Food Sci. Nutr., 2020, 8, 1636–1648.
15. L. Zhao, Y. Zhang, L. He, W. Dai, Y. Lai, X. Yao and Y. Cao, Soy sauce residue oil extracted by a novel continuous phase transition extraction under low temperature and its refining process, J. Agric. Food Chem., 2014, 62, 3230–3235.
16. S. Wang, Y. Yang, Q. Wang, Z. Wu, X. Liu, S. Chen and A. Zhou, Structural characterization and immunomodulatory activity of a polysaccharide from finger citron extracted by continuous phase-transition extraction, Int. J. Biol. Macromol., 2023, 240, 124491.
17. M. L. Huang, C. H. Peng, S. Cai, C. C. Ou, Y. Q. Jiang and A. M. Zhou, Extract process optimization and component analysis of pumpkin seed oil by continuous phase transition extraction, Sci. Technol. Food Ind., 2024, 45, 163–173 (in Chinese).
18. A. Kurahashi, Ingredients, functionality, and safety of the Japanese traditional sweet drink amazake, J. Fungi, 2021, 7, 469.
19. M. Sugimoto, T. Koseki, A. Hirayama, S. Abe, T. Sano, M. Tomita and T. Soga, Correlation between sensory evaluation scores of Japanese sake and metabolome profiles, J. Agric. Food Chem., 2010, 58, 374–383.
20. H. Nishida, Kuratsuki bacteria and sake making, Biosci. Biotechnol. Biochem., 2024, 88, 249–253.
21. R. Jabeen, N. Jan, B. Naseer, P. K. Sarangi, K. Sridhar, P. K. Dikkala, M. Bhaswant, S. Z. Hussain and B. S. Inbaraj, Development of germinated-brown-rice-based novel functional beverage enriched with γ-aminobutyric acid: Nutritional and bio-functional characterization, Foods, 2024, 13, 1282.
22. Y. Nishidono, S. Misaka, Y. Maejima, K. Shimomura and K. Tanaka, Comparative analysis of functional components in sakekasu (sake lees), Funct. Foods Health Dis., 2024, 14, 74–86.
23. A. Tsuji and T. Koyanagi, Significant contribution of amino acids to antioxidant capacity of Japanese rice wine (sake), J. Sci. Food Agric., 2025, 105, 227–234.
24. G. Liu, J. Zhang, T. Hou, S. An, B. Guo, C. Liu, L. Hu, Y. Huang, S. Zhang, M. Song and Y. Cao, Extraction kinetics, physicochemical properties and immunomodulatory activity of the novel continuous phase transition extraction of polysaccharides from Ganoderma lucidum, Food Funct., 2021, 12, 9708–9718.
25. Y. Motono, T. Imai, T. Emi, T. Iguchi and M. Takaoka, Effect of sake lees on the inhibition of lipid accumulation in adipocytes, Fermentation, 2021, 7, 145.
26. Y. Saito, K. Wanezaki (Nakamura), A. Kawato and S. Imayasu, Structure and activity of angiotensin I converting enzyme inhibitory peptides from sake and sake lees, Biosci. Biotechnol. Biochem., 1994, 58, 1767–1771.
27. H. Bozorgi, A. Rashidy-Pour, N. Moradikor, M. Zamani and E. Motaghi, Neurobehavioral protective effects of Japanese sake yeast supplement against chronic stress-induced anxiety and depression-like symptoms in mice: Possible role of central adenosine receptors, Psychopharmacology, 2024, 241, 401–416.
28. M. Davoodi, F. N. Karimooy, T. Budde, S. Ortega-Martinez and N. Moradi-Kor, Beneficial effects of Japanese sake yeast supplement on biochemical, antioxidant, and anti-inflammatory factors in streptozotocin-induced diabetic rats, Diabetes, Metab. Syndr. Obes., 2019, 12, 1667–1673.
29. V. H. C. Liao, Use of Caenorhabditis elegans To study the potential bioactivity of natural Compounds, J. Agric. Food Chem., 2018, 66, 1737–1742.
30. X. Chen, F. Bahramimehr, N. Shahhamzehei, H. Fu, S. Lin, H. Wang, C. Li, T. Efferth and C. Hong, Anti-aging effects of medicinal plants and their rapid screening using the nematode Caenorhabditis elegans, Phytomedicine, 2024, 129, 155665.
31. W. He, J. Xie, Z. Xia, X. Chen, J. Xiao, Y. Cao and X. Liu, A novel peptide derived from Haematococcus pluvialis, residue exhibits anti-aging activity in Caenorhabditis elegans via the insulin/IGF-1 signaling pathway, Food Funct., 2023, 14, 5576–5588.
32. Y. Dasdemir, B. T. Findik, H. Yildiz and E. Birisci, Blueberry-added black tea: Effects of infusion temperature, drying method, fruit concentration on the iron-polyphenol complex formation, polyphenols profile, antioxidant activity, and sensory properties, Food Chem., 2023, 410, 135463.
33. J. Ke, J. Y. Li, Z. Yang, H. Y. Wu, J. Y. Yu, Y. Yang, C. H. Chen, P. Zhou, F. Hua, W. Wang, F. Hu, G. X. Chu, X. C. Wan and G. H. Bao, Unraveling anti-aging mystery of green tea in C. elegans: Chemical truth and multiple mechanisms, Food Chem., 2024, 460, 140510.
34. C. H. Chen, J. Y. Yu, Z. Yang, J. P. Ke, Y. Qi, Y. Yang, B. Gao, G. Yao and G. H. Bao, Novel methylated flavoalkaloids from Echa 1 green tea inhibit fat accumulation and enhance stress resistance in Caenorhabditis elegans, Food Chem., 2023, 413, 135643.
35. A. G. Wu, Y. Y. Yong, C. L. He, Y. P. Li, X. Y. Zhou, L. Yu, Q. Chen, C. Lan, J. Liu, C. L. Yu, D. L. Qin, J. M. Wu and X. G. Zhou, Novel 18-norspirostane steroidal saponins: Extending lifespan and mitigating neurodegeneration through promotion of mitophagy and mitochondrial biogenesis in Caenorhabditis elegans, Mech. Ageing Dev., 2024, 218, 111901.
36. N. Solomakou, A. Loukri, P. Tsafrakidou, A. M. Michaelidou, I. Mourtzinos and A. M. Goula, Recovery of phenolic compounds from spent coffee grounds through optimized extraction processes, Sustainable Chem. Pharm., 2022, 25, 100592.
37. K. Nilmat, P. Hunsub, S. Ngamprasertsith, W. Sakdasri, A. Karnchanatat and R. Sawangkeaw, Effects of defatting pretreatment on polysaccharide extraction from rambutan seeds using subcritical water: Optimization using the desirability approach, Foods, 2024, 13, 1967.
38. L. Chen, S. Chen, Y. Rong, W. Zeng, Z. Hu, X. Ma and S. Feng, Identification and evaluation of antioxidant peptides from highland barley distiller's grains protein hydrolysate assisted by molecular docking, Food Chem., 2024, 434, 137441.
39. L. He, L. Han, Q. Yu, X. Wang, Y. Li and G. Han, High pressure-assisted enzymatic hydrolysis promotes the release of a bi-functional peptide from cowhide gelatin with dipeptidyl peptidase IV (DPP-IV) inhibitory and antioxidant activities, Food Chem., 2024, 435, 137546.
40. N. K. H. Yiew, J. H. Vazquez, M. R. Martino, S. Kennon-McGill, J. R. Price, F. D. Allard, E. U. Yee, A. J. Layman, L. P. James, K. S. McCommis, B. N. Finck and M. R. McGill, Hepatic pyruvate and alanine metabolism are critical and complementary for maintenance of antioxidant capacity and resistance to oxidative insult, Mol. Metab., 2023, 77, 101808.
41. Y. Inoue, S. Ueda, T. Tanikawa, A. Sano, R. Suzuki, H. Todo, Y. Higuchi and K. Akao, Characterization of carbohydrates, amino acids, viscosity, and antioxidant capacity in rice wines made in Saitama, Japan, with different sake rice, Foods, 2023, 12, 4004.
42. Y. Kamei, T. Tamura, R. Yoshida, S. Ohta, E. Fukusaki and Y. Mukai, GABA metabolism pathway genes, UGA1 and GAD1, regulate replicative lifespan in Saccharomyces cerevisiae, Biochem. Biophys. Res. Commun., 2011, 407, 185–190.
43. C. Edwards, J. Canfield, N. Copes, A. Brito, M. Rehan, D. Lipps, J. Brunquell, S. D. Westerheide and P. C. Bradshaw, Mechanisms of amino acid-mediated lifespan extension in Caenorhabditis elegans, BMC Genet., 2015, 16, 8.
44. W. D. Jiang, Y. P. Deng, X. Q. Zhou, Y. Liu, J. Jiang, S. Y. Kuang, L. Tang, W. N. Tang, P. Wu, Y. A. Zhang and L. Feng, Towards the modulation of oxidative damage, apoptosis and tight junction protein in response to dietary leucine deficiency: A likely cause of ROS-induced gill structural integrity impairment, Fish Shellfish Immunol., 2017, 70, 609–620.
45. B. H. Sarmadi and A. Ismail, Antioxidative peptides from food proteins: A review, Peptides, 2010, 31, 1949–1956.
46. M. Zhou, T. Bu, J. Zheng, L. Liu, S. Yu, S. Li and J. Wu, Peptides in brewed wines: Formation, structure, and function, J. Agric. Food Chem., 2021, 69, 2647–2657.
47. H. Ozawa, T. Miyazawa, G. C. Burdeos and T. Miyazawa, Biological functions of antioxidant dipeptides, J. Nutr. Sci. Vitaminol., 2022, 68, 162–171.
48. Y. Takaya, T. Furukawa, S. Miura, T. Akutagawa, Y. Hotta, N. Ishikawa and M. Niwa, Antioxidant constituents in distillation residue of Awamori spirits, J. Agric. Food Chem., 2007, 55, 75–79.
49. Y. Zhao, X. Liu, S. Zhang, Z. Wang, S. Tian and Q. Wu, Identification and free radical scavenging activity of oligopeptides from mixed-distillate fermented Baijiu grains and soy sauce residue, Metabolites, 2024, 14, 298.
50. Y. Zuo, Z. Yu, X. Shen, H. Zhou, X. Li, Y. Cai and L. Wu, Recent advance on the structure-activity relationship in antioxidant peptides of fish, Sci. Technol. Food Ind., 2023, 44, 419–429 (in Chinese).
51. G. de O. Costa, C. L. M. Pontes, A. L. Parize and L. P. Sandjo, Unveiling chemical responses in the kombucha-based fermentation of black tea, banana flower, and grape juice: LC-ESIMS, GNPS, MS-DIAL, and MS-FINDER-assisted chemical characterization, Food Funct., 2024, 15, 2497–2523.
52. D. Q. Huong, D. Van Truong, N. M. Tam and P. C. Nam, Effect of hydroxyl position on antioxidant ability of hydroxycoumarin derivatives: A theoretical investigation, J. Mol. Liq., 2023, 391, 123312.
53. P. Nuntahirun, R. Hanchaina, A. Ratchatacharoensak, M. Supjaroenpisan, S. Suptawornkul, Y. Wang, T. Kangsamaksin and P. Paoprasert, Development of carbon dots synthesized from green tea and Alpha–hydroxyl acids with enhanced antioxidant activity, photostability and UV protection properties, ChemistrySelect, 2023, 8, e202302541.
54. H. Park, B. Kim, Y. Kang and W. Kim, Study on chemical composition and biological activity of Psidium guajava leaf extracts, Curr. Issues Mol. Biol., 2024, 46, 2133–2143.
55. M. A. Yoon, T. S. Jeong, D. S. Park, M. Z. Xu, H. W. Oh, K. B. Song, W. S. Lee and H. Y. Park, Antioxidant effects of Quinoline Alkaloids and 2,4-Di-tert-butylphenol isolated from Scolopendra subspinipes, Biol. Pharm. Bull., 2006, 29, 735–739.
56. H. Wang, J. Liu, T. Li and R. H. Liu, Blueberry extract promotes longevity and stress tolerance via DAF-16 in Caenorhabditis elegans, Food Funct., 2018, 9, 5273–5282.
57. B. Zhang, T. Xia, W. Duan, Z. Zhang, Y. Li, B. Fang, M. Xia and M. Wang, Effects of organic acids, amino acids and phenolic compounds on antioxidant characteristic of Zhenjiang Aromatic Vinegar, Molecules, 2019, 24, 3799.
58. I. Sadowska-Bartosz and G. Bartosz, Effect of antioxidants supplementation on aging and longevity, BioMed Res. Int., 2014, 2014, 404680.
59. L. Hou, M. Jiang, Q. Guo and W. Shi, Zymolytic Grain Extract (ZGE) significantly extends the lifespan and enhances the environmental stress resistance of Caenorhabditis elegans, Int. J. Mol. Sci., 2019, 20, 3489.
60. C. Li, W. Xu, X. Zhang, X. Cui, A. Tsopmo and J. Li, Antioxidant peptides derived from Millet Bran promote longevity and stress resistance in Caenorhabditis elegans, Plant Foods Hum. Nutr., 2023, 78, 790–795.
61. U. T. Brunk and A. Terman, Lipofuscin: Mechanisms of age-related accumulation and influence on cell function, Free Radical Biol. Med., 2002, 33, 611–619.
62. S. C. Zevian and J. L. Yanowitz, Methodological considerations for heat shock of the nematode Caenorhabditis elegans, Methods, 2014, 68, 450–457.
63. J. Zhao, J. Yu, Q. Zhi, T. Yuan, X. Lei, K. Zeng and J. Ming, Anti-aging effects of the fermented anthocyanin extracts of purple sweet potato on Caenorhabditis elegans, Food Funct., 2021, 12, 12647–12658.
64. Y. Liu, X. Zhang, Y. Wang, J. Wang, H. Wei, C. Zhang and Q. Zhang, Cyclocodon lancifolius fruit prolongs the lifespan of Caenorhabditis elegans via, antioxidation and regulation of purine metabolism, Food Funct., 2024, 15, 3353–3364.
65. S. J. Won, R. Fong, N. Butler, J. Sanchez, Y. Zhang, C. Wong, O. T. Nzoutchoum, A. Huynh, J. Pan and R. A. Swanson, Neuronal oxidative stress promotes α-Synuclein aggregation in vivo, Antioxidants, 2022, 11, 2466.
66. C. Lin, X. Zhang, J. Xiao, Q. Zhong, Y. Kuang, Y. Cao and Y. Chen, Effects on longevity extension and mechanism of action of carnosic acid in Caenorhabditis elegans, Food Funct., 2019, 10, 1398–1410.
67. Y. Ye, Q. Gu and X. Sun, Potential of Caenorhabditis elegans as an antiaging evaluation model for dietary phytochemicals: A review, Compr. Rev. Food Sci. Food Saf., 2020, 19, 3084–3105.
68. M. George, M. Tharakan, J. Culberson, A. P. Reddy and P. H. Reddy, Role of Nrf2 in aging, Alzheimer's and other neurodegenerative diseases, Ageing Res. Rev., 2022, 82, 101756.
69. M. K. Kurop, C. M. Huyen, J. H. Kelly and B. S. J. Blagg, The heat shock response and small molecule regulators, Eur. J. Med. Chem., 2021, 226, 113846.
70. Y. Ge, H. Chen, J. Wang, G. Liu, S. W. Cui, J. Kang, Y. Jiang and H. Wang, Naringenin prolongs lifespan and delays aging mediated by IIS and MAPK in Caenorhabditis elegans, Food Funct., 2021, 12, 12127–12141.
71. S. Govindan, M. Amirthalingam, K. Duraisamy, T. Govindhan, N. Sundararaj and S. Palanisamy, Phytochemicals-induced hormesis protects Caenorhabditis elegans against α-synuclein protein aggregation and stress through modulating HSF-1 and SKN-1/Nrf2 signaling pathways, Biomed. Pharmacother., 2018, 102, 812–822.
72. S. Paladino, A. Conte, R. Caggiano, G. M. Pierantoni and R. Faraonio, Nrf2 pathway in age-related neurological disorders: Insights into microRNAs, Cell. Physiol. Biochem., 2018, 47, 1951–1976.
73. A. T. Von Schulze and P. C. Geiger, Heat and mitochondrial bioenergetics, Curr. Opin. Physiol., 2022, 27, 100553.
74. S. D. Naidu, R. V. Kostov and A. T. Dinkova-Kostova, Transcription factors Hsf1 and Nrf2 engage in crosstalk for cytoprotection, Trends Pharmacol. Sci., 2015, 36, 6–14.
75. K. Lin, H. Hsin, N. Libina and C. Kenyon, Regulation of the Caenorhabditis elegans, longevity protein DAF-16 by insulin/IGF-1 and germline signaling, Nat. Genet., 2001, 28, 139–145.
76. Q. Xu, B. Zheng, T. Li and R. H. Liu, Hypsizygus marmoreus extract exhibited antioxidant effects to promote longevity and stress resistance in Caenorhabditis elegans, Food Funct., 2023, 14, 9743–9754.

---

Footnote

† These authors contributed equally.

---