Anthocyanin-rich black wheat as a functional food for managing type 2 diabetes mellitus: a study on high fat diet-streptozotocin-induced diabetic rats

Abstract

Background: Type 2 Diabetes Mellitus (T2DM) is associated with insulin resistance, hyperglycemia, and hyperlipidemia. Anthocyanins, which are natural antioxidants, have been reported to manage T2DM-related complications. However, the potential of anthocyanin-rich black wheat as a functional food for managing diabetes remains unexplored. Aim: This study aimed to investigate the effects of anthocyanin-rich black wheat on glucose metabolism, insulin sensitivity, lipid profile, oxidative stress, inflammation, and organ protection in high fat diet-streptozotocin (HFD-STZ) induced T2DM rats. Methods: T2DM was induced in rats using HFD-STZ. The rats were fed with either white wheat or anthocyanin-rich black wheat chapatti. Glucose metabolism, insulin sensitivity, lipid profile, antioxidant enzymes, inflammatory markers, and glucose transporters were assessed. Histopathological analysis of the liver, kidneys, and spleen was performed. Results: Compared to white wheat chapatti, black wheat chapatti exhibited higher α-amylase and α-glucosidase inhibitory activities. Black wheat chapatti consumption significantly reduced blood glucose and HbA1c levels, and improved insulin sensitivity, oral glucose tolerance, and insulin tolerance. Antioxidant enzyme (superoxide dismutase and catalase) activities were enhanced. Atherogenic dyslipidemia was attenuated, with improved high-density lipoprotein cholesterol levels. Inflammatory markers (TNF-α, IL-1β, leptin, resistin and cortisol) were reduced, while adiponectin (Acrp-30) levels increased. Black wheat chapatti activated adiponectin-AMPK and PI3K-AKT pathways, upregulating glucose transporters (GLUT-2 and GLUT-4). Histopathology revealed protective effects on the liver, kidneys, and spleen. Conclusions: Anthocyanin-rich black wheat chapatti ameliorates insulin resistance and associated complications in HFD-STZ-induced T2DM rats. It modulates key signaling pathways and glucose transporters, demonstrating its potential as a functional food for managing T2DM and its complications.

---

1. Introduction

Type 2 diabetes (T2DM) is a prevalent metabolic disorder characterized by insulin resistance and β-cell dysfunction, leading to elevated blood glucose levels.¹ The body's cells become resistant to the effects of insulin, forcing the pancreas to respond by producing more insulin. Over time, this compensatory mechanism leads to chronic hyperglycemia, which worsens the disease and contributes to the development of severe complications. These include retinopathy (eye damage leading to blindness), nephropathy (kidney damage), neuropathy (nerve damage), and a heightened risk of cardiovascular diseases such as heart attacks, stroke and atherogenesis.^2,3

Managing T2DM has become a significant global health challenge, especially due to its complications and widespread prevalence. Phytochemicals, specifically anthocyanins, found in various plants have gained attention for their preventive and therapeutic benefits. These bioactive compounds exhibit antioxidant, anti-inflammatory, and anti-diabetic properties, making them effective in reducing the risk of cardiovascular diseases, obesity, insulin resistance, and T2DM.²

Wheat, a staple food and primary source of dietary starch, is typically consumed in refined forms such as bread, pasta, and noodles. This refining process removes the outer fiber, as well as the phytochemically rich embryo and bran layers, leaving the starch-dense endosperm. Whole grain wheat, on the other hand, retains its nutrient-rich components, including dietary fiber, vitamins, and minerals. A large body of evidence supports the consumption of whole grains over refined grains for improving overall health and reducing the risk of chronic diseases.^4,5

Recently, colored wheat varieties—including black, blue, and purple wheat—have gained attention for their unique anthocyanin profiles from researchers. These anthocyanins, found in the pericarp and aleurone layers, contribute to the distinct coloration of these wheat varieties. In purple wheat, anthocyanins are primarily localized in the pericarp layer, while in blue wheat, they are concentrated in the aleurone layer. Black wheat uniquely contains anthocyanins distributed across both the pericarp and aleurone layers.⁶ These colored wheat varieties are rich in dietary fiber, polyphenols, indoles, carotenoids, and other beneficial phytochemicals. Compared to traditional white wheat, colored wheat exhibits more pronounced health-promoting effects, including improved glucose metabolism, enhanced insulin sensitivity, and better management of metabolic disorders.^7,8

Several studies have highlighted the health benefits of colored wheat in relation to T2DM and related conditions. For example, purple wheat has been shown to improve glucose levels, reduce inflammation, and alleviate oxidative stress in overweight and obese individuals.⁸ Similarly, black wheat products have demonstrated significant potential in managing T2DM, as daily substitution, and have been associated with lower glycated albumin levels and a reduction in inflammatory markers such as TNF-α and IL-6.⁹ Another study by Sharma et al. highlighted that black wheat mitigated complications induced by a high-fat diet in a mouse model.¹⁰

The primary aim of this study is to investigate the potential of anthocyanin-enriched black wheat chapatti in regulating insulin resistance and managing type 2 diabetes mellitus (T2DM). The focus is on elucidating the molecular mechanisms underlying its therapeutic effects, particularly through the activation of key cellular pathways such as the phosphoinositide 3-kinase/protein kinase B (PI3K/AKT) pathway and the adenosine monophosphate-activated protein kinase (AMPK) pathway.¹¹ Both pathways play essential roles in glucose metabolism and insulin sensitivity.¹² By targeting these key molecular pathways, we hypothesize that incorporating anthocyanin-rich colored wheat chapatti into the diet could offer a novel approach for managing T2DM.

Therefore, this study aims to explore the therapeutic potential of biofortified black wheat chapatti in modulating insulin resistance and improving glucose metabolism through the regulation of PI3K/AKT and AMPK pathways, offering a promising dietary intervention for the management of T2DM.

2. Materials and methods

2.1 Plant materials and chemicals used

The anthocyanin-rich colored wheat varieties, notably black wheat designated as NABIMG-11,^13,14 were selected for use in this study. To establish comparative effects, C-306, which is a white wheat variety served as the control. Cultivation and advancement of all test varieties were conducted in the research fields of the National Agri-Food Biotechnology Institute (NABI). All chemical reagents were purchased from Sigma-Aldrich, St Louis, Missouri, USA, including α-amylase, α-glucosidase, p-nitrophenyl α-D-glucopyranoside, streptozotocin (STZ) and acarbose. Glucose, potassium sodium tartrate, dinitrosalicylic acid and sodium chloride (NaCl) were obtained from HiMedia Laboratories Private Limited, India.

2.2 α-Amylase inhibitory activity

The α-amylase inhibitory activity of white and black wheat was assessed following the method by Chen et al. with slight adjustments.¹⁵ Acarbose (a synthetic drug with the ability to inhibit carbohydrate digesting α-amylase and α-glucosidase enzymes) was used as a reference inhibitor and positive control. In a nutshell, 200 μL of a sodium phosphate buffer containing NaCl (6 mM, pH 6.9) was combined with 100 μL of soluble starch (0.05%) as a substrate and 100 μL of wheat extracts (ranging from 0.25 to 1.0 mg mL⁻¹, in 0.25 increments). A 100 μL buffer served as the blank sample. After thorough mixing, the samples were pre-incubated at 37 °C for 10 minutes, followed by the addition of 100 μL of α-amylase (5 U) and further incubation at 37 °C for 5 minutes.

Next, 2.0 mL of the DNS reagent (1% dinitrosalicylic acid and 12% potassium sodium tartrate) were added, and the mixture was incubated at 100 °C for 5 minutes. After cooling to room temperature, the reaction mixture was diluted by adding 3 mL of distilled water, and the absorbance was measured at 540 nm using a spectrophotometer. The IC₅₀ values were calculated by using the AAT-Bioquest IC₅₀ calculator (https://www.aatbio.com/tools/ic50-calculator).

2.3 α-Glucosidase inhibitory activity

The α-glucosidase inhibitory assay was conducted in a 96-well plate following the method by Li et al. with slight adjustments.¹⁶ Briefly, 25 μL of wheat extract (ranging from 0.25 to 1.0 mg mL⁻¹, in 0.25 increments) prepared in 0.1 M phosphate buffer was mixed with an equal volume (25 μL) of an enzyme solution containing 0.5 U/mL of enzyme activity. The mixture was incubated at 37 °C for 10 minutes to facilitate the enzymatic reaction.¹⁵ The buffer served as the blank sample, and acarbose was used as the positive control. After the incubation, 25 μL of the substrate – p-nitrophenyl α-D-glucopyranoside (0.5 mM concentration in 0.1 M phosphate buffer, pH 6.8) – was added to the mixture and allowed to incubate at 37 °C for 30 minutes, and then the reaction was halted by adding 100 μL of 0.2 M sodium carbonate solution. The absorbance was measured at 405 nm. The IC₅₀ values were calculated by using the AAT-Bioquest IC₅₀ calculator (https://www.aatbio.com/tools/ic50-calculator).

2.4 Animal experiments

The experimental procedures received approval from the animal ethical committee of the National Agri-Food Biotechnology Institute (NABI/2039/CPCSEA/IAEC/2021/01), following the guidelines of CPCSEA (Committee for the Purpose of Control and Supervision of Experiments on Animals). Male Sprague-Dawley (SD) rats weighing 250 ± 50 g were obtained from the central animal facility at ImTech (Institute of Microbial Technology), Chandigarh, and accommodated at the NABI animal house facility. Before the experiment, the rats were provided with a standard laboratory diet/normal pellet diet (NPD) and water. The rats were kept in standard cages under consistent conditions of temperature (22 ± 1 °C) and humidity (60 ± 5%), following a 12 hour light/dark cycle. They had unrestricted access to food and water throughout the housing period.

2.4.1 Animal model of T2DM with insulin resistance. To develop a Type 2 Diabetes Mellitus (T2DM) rat model with insulin resistance, a combination of a High-Fat Diet (HFD) and a single dose of streptozotocin (STZ) were administered. Rats that met specific blood glucose criteria (70–90 mg dl⁻¹) underwent an acclimatization period and were randomly assigned to 10 groups with n = 6–8 rats per group (refer to Table 1). Groups (T₁^B), (T₁^W), (T₃^B) and (T₃^W) were supplemented with the HFD with black (TAC ≊ 100 ppm) and white wheat chapatti (TAC ≊ 4 ppm) replacement¹⁷ (Table 2), whereas T₂^B and T₂^W groups only received respective chapatti diets and all these group diets were isocaloric with group (C), (C⁺), (C⁻) and (C⁺⁺) diets, where these groups were supplemented with a normal pellet diet. The anthocyanin-rich black and white wheat seeds were ground to obtain whole wheat flour. Unfermented flat bread (chapattis) were prepared and dried, and then ground into a fine powder (ESI File 1†). Rats with fasting blood glucose levels between 160 and 190 mg dl⁻¹ were considered further. During the 8th week, rats in the T2DM positive controls (C⁺ and C⁺⁺) received an intraperitoneal (I.P.) injection of 55 mg kg⁻¹ STZ and 1 U kg⁻¹ insulin. To prevent mortality in the remaining treatment groups that received STZ, they also received 0.5U insulin (T₂^B, T₃^B, T₂^W and T₃^W) (ESI File 1†). Rats with blood glucose levels above 250 mg dl⁻¹ were considered diabetic. Throughout the 12-week experiment, rats had ad libitum access to water and food, with daily monitoring of food intake, water consumption, body weight, and weekly measurements of blood glucose. In the 13th week, the rats were fasted overnight, and blood samples were collected in dry tubes for serum isolation, and after isolation, the samples were immediately stored at −80 °C for further biochemical analysis. After blood sample collection, all the rats were sacrificed using dry ice. After euthanasia, organs such as the liver, kidneys, spleen, and adipose tissue were procured, weighed, and stored for biochemical assays. Additionally, tissue samples were fixed in formalin for histological analysis.

Table 1 Grouping of animals used in this study

Group no.	Group description	Abbreviations
1	NPD (normal pellet diet) control	C
2	NPD + HFD (NH) negative control	C^−
3	Black wheat chapatti + HFD (BH)	T1^B
4	White wheat chapatti + HFD (WH)	T1^W
5	NPD + STZ + INSULIN (NSI) (positive control)	C^+
6	Black wheat chapatti + STZ (BS)	T2^B
7	White wheat chapatti + STZ (WS)	T2^W
8	NPD + HFD + STZ + INSULIN (NHSI) (positive control)	C^++
9	Black wheat chapatti + HFD + STZ (BHS)	T3^B
10	White wheat chapatti + HFD + STZ (WHS)	T3^W

---

Table 2 Composition of isocaloric diets (% w/w) used in this study

Ingredients	NPD (normal pellet diet) (g kg^−1)	NPD + high fat diet (HFD)	HFD with wheat replacement (black and white wheat) (g kg^−1)
NPD/wheat (as per diet)	1000	365	526.633
Casein	—	250	95
Lard	—	320	318
Vitamin/mineral mixture	—	65	60
Total	1000	1000	999.633

---

2.4.2 Oral glucose tolerance test (OGTT) and intra-peritoneal insulin tolerance test (IP-ITT). Following 12 weeks of treatment, both the OGTT and IP-ITT were conducted on all the rats. For OGTT, after a 16-hour fasting period, rats were orally administered glucose at 2 g per kg body weight, and blood glucose levels were measured at time intervals of 0, 15, 30, 45, 60, 90, and 120 minutes. For the IP-ITT, rats were fasted for at least 2 hours before the intra-peritoneal insulin injection of 1 U per kg body weight, ensuring full access to drinking water. Blood glucose levels were determined at time intervals of 0, 15, 30, 45, 60, 90, and 120 minutes. The results of OGTT and IP-ITT were expressed as an area under the curve (AUC) over 120 minutes, using GraphPad Prism version 5.0.

2.4.3 Estimation of serum biochemical indexes. The concentration of serum alanine aminotransferase (ALT) and aspartate transaminase (AST), reflecting liver function, along with urea and creatinine, indicative of renal function, were determined using a calorimetric method. The lipid profile, covering low-density lipoprotein (LDL), high-density lipoprotein (HDL), triglycerides, total cholesterol (TC), and very low-density lipoprotein (VLDL), was evaluated by using commercial kits (ERBA) following the manufacturer's instructions.

Oxidative stress parameters and antioxidants, including malondialdehyde (MDA), superoxide dismutase (SOD), and catalase, were measured manually following the established protocols.^17,18 H₂O₂ levels were evaluated using a commercially available kit (Elabscience Biotechnology Incorporation, USA).

2.4.4 Fatty acid estimation through GC-MS/MS. Whole blood was procured and was lyophilized for further estimation of fatty acids through gas chromatography. The sample was injected into a DB-5 column (30 m × 0.25 mm, 0.25 μm film thickness, Agilent) using helium as the carrier gas. The lipid profile of the samples was determined using the following temperature gradient: 80 °C for 2 min, 80–170 °C at 30 °C min⁻¹, 170–240 °C at 4 °C min⁻¹ and 240 °C held for 30 min, and the samples were ionized by the impact of electrons at 70 eV.

2.4.5 Atherogenic indices. Atherogenic indices were calculated using lipid profile parameters as per the method described by Oršolić et al.¹⁸ Atherogenic index (AI) = log₁₀ [TG/HDL].

Atherogenic coefficient (AC) = [(TC − HDL)/HDL].

Cardioprotective index (CPI) = [HDL/LDL].

Cardiac risk ratio (CRR) = [TC/HDL].

2.4.6 Determination of the HOMA index. Serum insulin levels were determined according to the manufacturer's instructions (Elabscience). The homeostatic model assessment (HOMA) methods developed by Matthews et al. were used to determine the HOMA-IR and β-cell dysfunction (HOMA-β).¹⁹

Quantitative insulin sensitivity check index (QUICKI) and McAuley's index (McA) were analysed according to Katz et al. and McAuley et al.^20,21

2.4.7 Inflammatory marker estimation. ELISA kits were employed to quantify the levels of inflammatory and pro-inflammatory cytokines, including C-reactive protein (CRP), tumor necrosis factor (TNF-α), interleukin (IL)-6, IL-1β, and IL-17A, interferon (IFN)-γ, leptin, resistin, adipocyte-secreted protein (Acrp)-30, cortisol, and β2-microglobulin in the serum, using commercial kits following the manufacturer's instructions (Elabscience). The absorbance was measured at 37 °C using a SpectraMax® i3x multi-mode microplate reader at 450 nm.

2.4.8 RNA extraction and real-time PCR. Total RNA was extracted from the liver and white adipose tissue using the TRIzol reagent (Bio-Rad, USA) as per the manufacturer's instructions. Following RNA extraction, cDNA synthesis was conducted using the iScriptcDNA synthesis kit (Bio-Rad; 1708891). Quantitative real-time PCR (qRT-PCR) analysis was conducted using the iTaq™ Universal SYBR® Green PCR Master Mix (Bio-Rad) on a Bio-Rad real-time PCR detection system. Gene expression levels were normalized to GAPDH, and the results were calculated using 2-log (ΔCT). Primer sequences utilized are listed in Table 3.

Table 3 The primers used in the quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR)

Genes	Primer pairs
AMPK (adenosine monophosphate kinase)	For: CCTTCGGCAAAGTGAAGATTGGA
	Rev: GTCCATGAAGGAACCCGTTG
FAS (fatty acid synthase)	For: GAAACCTGACGGCATCATTG
	Rev: CGGTGTCCTCAGAGTTGTGG
CPT-1A (carnitine palmitoyltransferase-I)	For: CTCAAGATGGCAGAGGCTCA
	Rev: GGGGAACACACCAGTGATGA
PI-3-K (phosphoinositide 3-kinase)	For: ACAAAGCTCTACTCTAGGCGTG
	Rev: TTACCAGCATGGTCATGGGC
AKT (protein kinase B)	For: AGAGAGCCGAGTCCTACAGAATA
	Rev: CCGAGAGAGGTGGAAAAACA
GSK-3β (glycogen synthase kinase-3β)	For: TCGTCCATCGATGTGTGGTC
	Rev: TTGTCCAGGGGTGAGCTTTG
GLUT-2 (glucose transporter-2)	For: CATTGGCTGGAAGAAGCGTATCAG
	Rev: GGAGACCTTCTGCTCAGTCGACG
G-6-pase (glucose-6-phosphatase)	For: AACGTCTGTCTGTCCCGGATCTAC
	Rev: ACCTCTGGAGGCTGGCATTG
PEPCK (phosphoenolpyruvate carboxykinase)	For: CTCACCTCTGGCCAAGATTGGTA
	Rev: GTTGCAGGCCCAGTTGTTGA
FBP1 (fructose-1,6-bisphosphatase)	For: ATGGCAGTGCCACTATGTTG
	Rev: AGTCCTTCGCATAGCCTTCA
ACC (acetyl-CoA carboxylase)	For: ATGGGCGGAATGGTCTCTTTC
	Rev: TGGGGACCTTGTCTTCATCAT
SIRT1 (sirtuin-1)	For: CAGTGTCATGGTTCCTTTGC
	Rev: CACCGAGGAACTACCTGAT
Glut 4 (glucose transporter-4)	For: GGGCTGTGAGTGAGTGCTTTC
	Rev: CAGCGAGGCAAGGCTAGA
GAPDH (housekeeping gene)	For: TGCTGGGGCTGGCATTGCTC
	Rev: TCCTTGCTGGGCTGGGTGGT
Adiponectin R1	For: CTTCTACTGCTCCCCACAGC
	Rev: TCCCAGGAACACTCCTGCTC
Adiponectin R2	For: CCACACAACACAAGAATCCG
	Rev: CCCTTCTTCTTGGGAGAATGG

---

2.4.9 Histological analyses. Organs including the liver, kidneys, spleen, and visceral adipose tissue were extracted and fixed overnight in a 10% formalin solution. Before staining, tissue samples underwent two washes in phosphate-buffered saline solution and were dehydrated, and then embedded in paraffin for histological analysis. Sections, approximately 5 μm in thickness, were obtained by using a Leica microtome from paraffin blocks and mounted on glass slides. Standardized protocols were followed for hematoxylin and eosin staining. The stained sections were examined using a compound microscope (Leica, India).

2.4.10 Immunofluorescence (IF). Tissue section slides were incubated overnight at 4 °C with primary antibodies against AMPK (Santacruz, anti-mouse, 1 : 100 dilution), phospho-AMPK alpha, AKT, and phospho-AKT (Cell Signalling Technology, anti-rabbit, 1 : 200 dilution), followed by incubation with secondary antibodies at room temperature for 2 hours (FITC-anti-mouse, BD Biosciences; Alexa Fluor 488-anti-rabbit, Cell Signalling Technology, 1 : 1000 dilution). The immune-fluorescently stained sections and cells were examined and photographed using a fluorescence microscope (Nikon, India).

2.4.11 Statistical analysis. All data analyses were conducted using one-way and two-way analysis of variance (ANOVA), a t-test, or Tukey's multiple comparison tests to determine the statistical differences among various groups. Figures were generated using GraphPad Prism version 5.01. A P value < 0.05 was considered statistically significant. Data are represented as means ± SD. Fat cell diameter count and the intensity of immunofluorescence in the liver and adipose tissue were calculated using ImageJ 1.54f version.

3. Results

3.1 Colored wheat chapatti exhibits pronounced control over post-prandial glucose release

In vitro anti-diabetic activity was demonstrated using α-amylase and α-glucosidase inhibitory assays in different wheat chapattis, along with acarbose as the positive control. The results depicted in Fig. 1a and b indicate that various concentrations of wheat extracts and acarbose (as discussed in the Materials and methods section) were utilized to achieve maximum inhibitory activity against the amylase and glucosidase enzymes. The findings suggest that black wheat chapatti (BWC) exhibits a higher percentage inhibition of 6.49% and 11.31% against α-glucosidase and α-amylase, respectively, compared to white wheat chapatti (WWC), as shown in Table 4. Moreover, it was observed that enzyme activity was inhibited in a concentration-dependent manner (0.25–1 mg ml⁻¹). The IC₅₀ values showed that black wheat chapatti demonstrated a similar inhibitory effect on both α-amylase and α-glucosidase as the positive control, acarbose. White wheat chapatti, however, showed slightly higher IC₅₀ values (0.755 for α-amylase and 0.7832 for α-glucosidase), indicating a comparatively lower inhibitory effect, as shown in Table 5.

Fig. 1 Comparison of in vitro carbohydrate digestion ability of black wheat chapatti (BWC) with white wheat chapatti (WWC). (a and b) In vitro inhibition of alpha-amylase and alpha-glucosidase was higher for BWC. Significance levels: *p < 0.05 and ***p < 0.001. All the measurements were performed in triplicate (n = 3). Positive control: acarbose.

Table 4 Comparison of α-amylase and α-glucosidase inhibitory activities of white wheat chapatti (WWC) and black wheat chapatti (BWC) indicated higher activity of BWC

Inhibition (%) at 1 mg ml^−1
	α-Glucosidase	α-Amylase
WWC	78.22	60.64
BWC	84.46	70.82
Acarbose	96.11	90.1

---

Table 5 Comparison of IC₅₀ values of white wheat chapatti (WWC) and black wheat chapatti (BWC) against α-amylase and α-glucosidase inhibition

Varieties	IC50 (α-amylase)	IC50 (α-glucosidase)
Acarbose	0.7300	0.7519
Black wheat chapatti	0.7395	0.756
White wheat chapatti	0.755	0.7832

---

3.2 Colored wheat chapatti modulates the body weight change, food and water intake, and morphometric parameters in T2DM rats

3.2.1 Body weight. All groups showed a general increase in body weight, but after the induction of diabetes with the STZ injection during the 8th week, a sudden weight loss was observed at the end of the 8th week in specific groups, namely C⁺⁺, T₁^B, T₃^B, T₁^W, and T₃^W, as shown in Fig. 2a, confirming the development of a diabetic model. By the end of the 12th week, in the HFD + STZ treated T2DM groups, a significant increase in body weight was observed in the positive control and black wheat chapatti groups (C⁺⁺ and T₃^B), but not in the white wheat chapatti group (T₃^W). Among the HFD control groups, including the negative control (C⁻), black wheat chapatti control (T₂^B), and white wheat chapatti control (T₂^W) groups, the black wheat chapatti control group showed a reduction in body weight, distinguishing it from the other groups that experienced a resurgence in body weight after the initial decline.

Fig. 2 Continuous physical observation of rats during the 12-week study period. (a) Black wheat ameliorated body weight loss observed by the 12th week of the experiment, following STZ treatment administered in the 8th week to induce type 2 diabetes. (b and c) Food intake and water intake were significantly improved in the black wheat control and type 2 diabetic groups compared to the white wheat groups. (d–f) Morphometric parameters such as head–body, head–tail and circumference were significantly improved at the 12th week of the experiment. All values are expressed as mean ± SD of 5–6 rats per group. Statistical analysis was done using two-way ANOVA. Significance levels: *p < 0.05, **p < 0.01 and ***p < 0.001. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ).

3.2.2 Food intake and water consumption. The food and water intake changes of the NPD control group were mild over the 12 weeks. In the high-fat diet (HFD) control groups (C⁻, T₁^B and T₁^W), an initial increase in food and water intake occurred until the 8th week. Notably, the food and water intake significantly decreased in the T₁^B control group. The C⁻ and T₁^W show the severity of the disease.

Conversely, in the control groups such as C⁺, T₂^B and T₂^W, food intake decreased after the induction of STZ, but by the end of 12th week, the food intake was maintained in the C⁺ and T₂^B groups only. The food intake was seen to be continuously increasing in the white wheat STZ control (T₂^W). However, the water intake significantly increased in these groups, and by the end of the experiment, the symptoms were reversed in the C⁺ and T₂^B control groups.

A similar trend was observed in the HFD-STZ T2DM positive control group, with a significant decrease in the food and water intake. However, no significant changes were noted in the food and water intake in the T₃^B and T₃^W T2DM groups after induction of STZ in the 8th week of the experiment. At the end of the study, there was a significant increase in the food and water intake in the C⁺⁺ and T₃^W white wheat chapatti T2DM groups. The food and water intake was regulated in the black wheat chapatti supplementation groups, as shown in Fig. 2b and c.

3.2.3 Morphometric parameters. Morphometric parameters, including head–body, head–tail, and waist circumference, were measured at the end of the study to gain additional insights into the risk of T2DM. Notably, head–body and head–tail measurements showed consistency across all the groups (Fig. 2d and e). However, a reduction in the body circumference was observed in the T₃^W white wheat chapatti group. In contrast, the black wheat T₃^B group, along with its control STZ (T₂^B) group, exhibited more favourable outcomes with the regain of the body circumference, as depicted in Fig. 2f.

3.3 Colored wheat modulates the organ index, fasting blood glucose, HbAIc, OGTT and ITT in T2DM rats

3.3.1 Organ indexes. Organ indexes, which reflect the workload of organs in an organism to some extent, were assessed by harvesting organs such as the liver, kidneys, and spleen. As shown in Fig. 3a and b, a discernable increase in the liver and kidney indices was observed in the white wheat T₃^W T2DM groups; apparently, a similar trend was seen in its control groups (T^W_I and T₂^W). In contrast, the black wheat T₃^B T2DM and its control groups (T^B_I and T₂^B) exhibited a reversal of severity, showing a significant decrease in the liver and kidney indices. However, there was no significant alteration observed in the spleen index across all the groups, as depicted in Fig. 3c.

Fig. 3 Monitoring of organ indexes and glucose homeostasis at the end of the 12-week intervention. (a–c) Black wheat chapatti improves the liver and kidney indexes compared to WWC, while the spleen index remained unaltered. Statistical analysis was done using two-way ANOVA. (d–g) Black wheat and the positive control showed improvement in FBG, HbA1c, OGTT and ITT in STZ-treated groups, suggesting enhanced glucose tolerance and improved insulin sensitivity. Statistical analysis was done using two-way ANOVA for FBG and rest of the analyses were done through one-way ANOVA. All values are expressed as mean ± SD of 5–6 rats per group. Significance levels: *p < 0.05, **p < 0.01 and ***p < 0.001. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ).

3.3.2 Glucose homeostasis. Assessment of fasting blood glucose (FBG) and glycated hemoglobin (HbA1c) was performed and oral glucose tolerance test (OGTT) and ITT were conducted to evaluate glucose homeostasis across all groups after 12 weeks of the experiment. The high-fat diet (HFD) control group did not show significant changes in the FBG and HbA1c levels. However, noteworthy changes were observed in the positive control (C⁺ and C⁺⁺) (p < 0.05) groups, as well as in the STZ-treated black wheat chapatti control group (T₂^B) and T2DM group (T₃^B), with lower levels of FBG and HbA1c (Fig. 3d and e). Furthermore, a significant decrease in the area under the curve (AUC) for both the OGTT and ITT was noted in all the positive control (C⁺ and C⁺⁺) and black wheat-chapatti fed groups (T₁^B, T₂^B and T₃^B). This decrease suggests enhanced glucose tolerance and improved insulin sensitivity, as illustrated in Fig. 3f and g.

3.4 Colored wheat ameliorates the serum insulin levels and HOMA indexes

Fig. 4a illustrates no significant change in insulin in the HFD groups. The STZ-treated positive control group (C⁺) and the T₂^B black wheat chapatti group exhibited a decrease in the insulin level as compared to the white wheat group. Conversely, severe hyperinsulinemia was observed in the HFD-STZ treated white wheat and positive control (C⁺⁺) groups, which was reversed in the black wheat chapatti T2DM group (T₃^B). In addition to it, to demonstrate insulin resistance, homeostasis model assessment of insulin resistance was measured. As shown in Fig. 4b, the HOMA-IR was higher for the white wheat chapatti-fed (T₂^W and T₃^W) groups. HOMA-β remained unchanged across all the groups. QUICKI and MCAi were also analysed to check the insulin sensitivity among the different groups. QUICKI and MCAi were significantly improved in the T₂^B and T₃^B black wheat chapatti (BWC) groups with no observable changes in the positive controls and WWC groups (Fig. 4d and e).

Fig. 4 Monitoring of serum insulin and HOMA indexes at the end of the 12-week intervention. (a) Black wheat improves the insulin levels. (b–e) Black wheat improves insulin sensitivity as depicted by lower HOMA-IR and higher QUICKI and MCAi values in the STZ-treated groups, while HOMA-β remained unchanged. All data are expressed as means ± SD of n = 4–5 rats per group. Statistical analysis was done using one-way ANOVA. Significance levels: *p < 0.05, **p < 0.01 and ***p < 0.001. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ).

3.5 Colored wheat ameliorates the lipid profile in T2DM rats

The effects of the treatments on lipid abnormalities are summarized in Fig. 5. The serum total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL) and very low-density lipoprotein (VLDL) levels were significantly lowered (p < 0.001), accompanied by a significant improvement in the high density lipoprotein (HDL) levels (Fig. 5a–e) in the BWC supplementation groups as compared to the WWC groups. The lipid profile markers such as TG, TC and VLDL were disturbed in the HFD (C⁻ and T₁^W) control groups; however, these levels were restored in the BWC (T₁^B) groups. No significant change was observed in the HDL and LDL levels among all the HFD control groups. TC, TG and VLDL remained unchanged across all the (C⁺, T₂^B and T₂^W) groups. The HDL and LDL levels were significantly attenuated in the T₂^B BWC control group. Similarly, in the case of the T2DM groups, BWC improved the lipid metabolism in the T2DM rats to a certain extent, as it can be seen through the heat map (Fig. 5f). In addition to it, the fatty acid composition in whole blood was determined using GC-MS, as shown in ESI Fig. 1.† The results suggested that omega-6 polyunsaturated fatty acids (PUFAs) such as arachidonic and linoleic fatty acids were ameliorated in the T2DM black (T₃^B) wheat group as compared to the white wheat T2DM group. Monounsaturated fatty acids (MUFAs) and saturated fatty acids such as oleic acid were significantly higher in the T₃^W T2DM group. There was no significant difference between the palmitic and stearic acids in the black and white wheat T2DM groups. In contrast, elaidic acid was higher in the black wheat group. Conclusively, black wheat chapatti consumption improved the PUFA levels; however, white wheat improved the MUFA and saturated fatty acid levels in the T2DM group.

Fig. 5 Monitoring of the lipid profile at the end of the 12-week intervention. (a–e) Black wheat chapatti improves the serum lipid profile in comparison with white wheat chapatti by lowering total triglycerides (TG), total cholesterol (TC), low density lipoprotein (LDL) and very low density lipoprotein, and by elevating high density lipoprotein. (f) The heat map depicts a comparison of the lipid profile, indicating that black wheat ameliorates the lipid profile in T2DM rats. All values are expressed as mean ± SD of n = 5–6 rats per group. Statistical analysis was done using one-way ANOVA. Significance level is denoted by *p < 0.05, **p < 0.01 and ***p < 0.001. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ).

3.6 Colored wheat chapatti modulates the atherogenic and cardioprotective indexes in T2DM rats

Employing mathematical calculations, we assessed the atherogenic indices, revealing significant improvements in the T2DM rats fed with black wheat chapatti (T₃^B). Notably, the atherogenic index and atherogenic coefficient exhibited substantial improvement in the BWC T2DM group (T₃^B) compared to the WWC T2DM (T₃^W) group, where these indices were significantly higher, as shown in ESI Fig. 2a and b.† Both the HFD and STZ control groups supplemented with BWC demonstrated a similar positive trend in the amelioration of the atherogenic coefficient. Fig. 2c illustrates an enhanced cardioprotective index in black wheat T2DM (T₃^B) rats and their controls (T₁^B, T₂^B) as well, while a contrasting trend was observed in the white wheat T2DM (T₃^W) group and in its control groups as well (T₁^W and T₂^W). The cardiac risk ratio was markedly higher in the white wheat chapatti groups (p < 0.001) compared to the black wheat (T₁^B, T₂^B and T₃^B) and positive control (C⁺ and C⁺⁺) groups (ESI Fig. 2d†). Overall, the atherogenic profile was notably poorer in groups fed with white wheat chapatti. The black wheat chapatti groups exhibited a better atherogenic profile than the positive control group and resembled the normal pellet diet groups, as depicted in ESI Fig. 2e.†

3.7 Colored wheat chapatti modulates the biochemical profile and oxidative stress/antioxidant markers in T2DM rats

Data describing the effect of anthocyanin rich colored wheat and the biochemical profile are summarized in Fig. 6. The white wheat chapatti fed T2DM group, T₃^W, in conjunction with its control groups such as T₁^W and T₂^W showed poor biochemical profiles of serum compared to the positive control (C⁺ and C⁺⁺) and black wheat (T₁^B, T₂^B and T₃^B) groups and normal pellet diet groups (C), characterized by higher levels of CRP (p < 0.05), cortisol (p < 0.05), SGPT (p < 0.05) and SGOT (p < 0.05) (Fig. 6a–e). Levels of β2-microglobulin remained unaltered across all the groups (Fig. 6b). Lower level of creatinine is the marker of low muscle mass in T2DM. We found that the creatinine levels were significantly reduced in the T2DM white wheat (T₃^W) groups (Fig. 6f), indicating lower muscle mass. The HFD (T₁^W) and STZ (T₂^W) groups also showed lower creatinine levels. Notably, as shown in Fig. 6g and h, anti-oxidant enzymes including catalase and SOD were considerably improved in the black wheat T2DM (T₃^B) group. The T₂^B control group showed significant amelioration in the SOD and catalase anti-oxidant activities. However, the anti-oxidant status remained unchanged in the black wheat HFD (T₁^B) control. Lipid peroxidation, estimated as MDA, showed a significant increase in the white wheat (T₁^W, T₂^W and T₃^W) groups (p < 0.05), when compared with their respective control groups. Black wheat chapatti supplementation has significantly mitigated the MDA levels. Furthermore, hydrogen peroxide (H₂O₂) content was significantly reduced (p < 0.05) in the T2DM (T₃^B) groups and a similar pattern was observed in the HFD and STZ control groups (T₁^B and T₂^B), as compared to the white wheat supplementation groups (T₁^W, T₂^W and T₃^W) (Fig. 6i and j).

Fig. 6 Impact of anthocyanin-rich colored wheat intervention on biochemical parameters at the end of the 12-week intervention. (a–c) Black wheat chapatti improves the inflammatory markers by ameliorating the CRP, β2-microglobulin and cortisol levels. (d–f) Black wheat chapatti improves the SGOT, SGOT and creatinine levels. (g and h) Black wheat ameliorates anti-oxidant markers such as SOD and catalase. (i and j) Black wheat regulates the oxidative stress by regulating the MDA and H₂O₂ levels. All values are expressed as mean ± SD of n = 4–6 rats per group. Statistical analysis was done using one-way ANOVA. Significance level is denoted by *p < 0.05, **p < 0.01 and ***p < 0.001. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ).

3.8 Colored wheat chapatti ameliorates the inflammatory profile in T2DM rats

Our 12-week anthocyanin rich colored wheat chapatti supplementation study demonstrated a noteworthy reduction in circulating pro-inflammatory cytokines in the black wheat and positive control T2DM groups compared to the white wheat groups. Specifically, there were significant decreases in TNF-α (p < 0.05), IL-6 (p < 0.05), IL-β1(p < 0.05), IFN-γ (p < 0.05) and IL-17A (p < 0.05) (Fig. 7a–e). A similar behaviour was observed in the HFD and STZ control groups fed with black wheat chapatti. In order to understand the influence of colored wheat chapatti on the overall energy balance, we specifically investigated adipokines, essential regulators of systemic energy homeostasis. Adipokines, particularly Acrp-30 (p < 0.05), exhibited a substantial increase in the T₃^B black wheat fed T2DM group with a similar pattern observed in its HFD (T₁^B) and STZ (T₂^B) control groups. A contrasting trend was seen for the white wheat-fed groups such as T₁^W, T₂^W and T₃^W (Fig. 7f). Cytokines such as leptin (p < 0.05) and resistin (p < 0.05) responsible for insulin resistance were seen to be higher in the T₁^W, T₂^W and T₃^W groups (Fig. 7g and h). Their levels were controlled in all the BWC supplementation groups (T₁^B, T₂^B and T₃^B). Thus, the data showed that anthocyanin rich black wheat chapatti helps in alleviating the inflammation induced due to T2DM (Fig. 7i).

Fig. 7 Impact of anthocyanin-rich colored wheat on inflammation regulation at the end of the 12-week intervention. (a–e) Anthocyanin rich black wheat reduces inflammation by managing inflammatory markers such as TNF-α, IL-6, IL-β1, IFN-γ and IL-17A. (f–h) Adipokines such as leptin and resistin responsible for insulin resistance were significantly attenuated in the black wheat-treated group. Adipokines such as Acrp-30 responsible for increasing insulin sensitivity were significantly ameliorated in the black wheat fed groups. (i) The heat map depicts a comparison of inflammatory markers, indicating that black wheat ameliorates the inflammatory markers in T2DM rats. All values are expressed as mean ± SD of n = 4–5 rats per group. Significance level is denoted by *p < 0.05, **p < 0.01 and ***p < 0.001. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ).

3.9 Colored wheat chapatti modulates the expression of genes involved in insulin signalling and regulates the glucose–lipid metabolism pathways in T2DM rats

The study focused on the gene expression analysis of vital components within the insulin signaling pathway, including PI3K, AKT, AMPK, adiponectin, GLUT-4, GLUT-2, and SIRT-1, to delve into the molecular underpinnings of T2DM pathogenesis.

The results revealed a downregulation in the expression of genes crucial for enhancing insulin sensitivity and promoting fatty acid oxidation, such as AMPK, Adipo-R1, Adipo-R2, and GLUT-4, across all white wheat control (T₁^W and T₂^W) groups and T2DM (T₃^W)-treated groups compared to the black wheat groups, as illustrated in Fig. 8a–d. This pattern indicates increased insulin resistance, contributing to the progression of T2DM. Similarly, genes critical for the activation of insulin signaling in the liver, including PI3K, AKT, GLUT-2, and SIRT-1, showed significant downregulation in the white wheat T2DM group (T₃^W) and its controls (T₁^W and T₂^W), reinforcing the trend of impaired insulin signaling.

Fig. 8 Black wheat enhances insulin signaling and glucose uptake in the liver and adipose tissues. (a–d) qRT-PCR response improves insulin resistance by activating the AMPK, Adipo-R1, Adipo-R2 and GLUT-4 expressions, respectively. (e–i) Black wheat chapatti supplementation improves the gene expressions of insulin signaling pathway genes such as PI3K, AKT, GLUT-2, SIRT-1 and GSK3-β. (j) The heat map depicts a comparison of the insulin signaling pathway genes and glucose uptake in T2DM rats. All values are expressed as mean ± SD of n = 4–6 rats per group. Significance level is denoted by *p < 0.05, **p < 0.01 and ***p < 0.001. Abbreviations: AMPK – adenosine monophosphate kinase, PI3K – phosphoinositide 3-kinase, AKT – protein kinase B, SIRT1 – sirtuin-1, GSK-3β – glycogen synthase kinase-3β, C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ).

Conversely, anthocyanin-rich black wheat diets in the T2DM group (T₃^B) exhibited significant upregulation in the expressions of Adipo-R1 (p < 0.05), Adipo-R2 (p < 0.05), AMPK (p < 0.05), and Glut-4 (p < 0.05) (Fig. 8a–d); there was an increase in insulin sensitivity and glucose uptake, and thus, pathogenesis of T2DM was reversed after consumption of black wheat; however, no such significant change was observed in the STZ and HFD black wheat control groups, except for the Adipo-R1. So, it shows that black wheat consumption ameliorated insulin resistance through AMPK-adiponectin receptor activation in the T2DM groups. A similar change was observed in the genes responsible for the activation of insulin signalling in the liver: the expressions of PI3K (p < 0.05), AKT, (p < 0.01), GLUT-2 (p < 0.001) and SIRT-1 (p < 0.001) were significantly ameliorated in the T2DM (T₃^B) groups of black wheat, with their controls (T₁^B and T₂^B) also favouring a similar trend. However, no notable alteration was detected in the gene expression of GSK-3β, except for the positive control groups, where it was significantly lowered as compared to the control group (Fig. 8e–j). Furthermore, the genes involved in glucose lipid metabolism and gluconeogenesis post insulin signalling activation showed improvement in the black wheat groups (T₁^B, T₂^B and T₃^B) as compared to the T₁^W, T₂^W and T₃^W groups, as shown in ESI Fig. 3.†

3.10 Colored wheat chapatti alters the tissue damage in the T2DM rats

3.10.1 Histological observations of the liver. Hematoxylin and eosin staining was done in order to determine the internal morphology of the organ, where hematoxylin stained the nucleus and eosin stained the remaining extracellular matrix. Liver morphology was normal in the NPD control group, with no significant histopathological changes, as shown in Fig. 9I(a). In contrast, hepatic lobules showed a disordered arrangement, with eroding hepatic sinusoid; additionally, the hepatocytes were swollen and enlarged, accompanied by deposition of fat vacuoles with clear boundaries in the negative control group (C⁻), and higher severity of fat deposition and higher neutrophils infiltration were observed in the white wheat T2DM (T₃^W) groups and their controls. Even the positive control (C⁺) groups showed a disordered morphology with high storage of large fat vacuoles. This disorderliness was reduced in the T2DM positive control group (C⁺⁺), and in the black wheat T2DM (T₃^B) groups and in the HFD (T₁^B) and STZ (T₂^B) control groups with reduced lipid droplet storage, reduced swollenness of the hepatocytes and alleviated hepatic lesions and with no infiltration observed for the immune cells, thus indicating the potential protective effect of black wheat against the pathological alterations in T2DM.

Fig. 9 (I) Two-dimensional hematoxylin and eosin (H&E) staining images showing the morphology of liver tissue. (a) Intact morphological structure in the control group was observed. (b, d, e, g and j) The hepatocytes were swollen and enlarged, accompanied by deposition of fat vacuoles with clear boundaries in the negative control group, and higher severity of fat deposition and higher neutrophil infiltration were observed in the white wheat T2DM (T₃^W) groups and its controls. (c, f, h and i) The anthocyanin rich black wheat ameliorated the disorderliness with lower fat vacuoles, reducing the swollenness of the hepatocytes as compared to white wheat fed groups. This disorderliness was reduced in the T2DM positive (C⁺⁺) control group. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ). (II) Two-dimensional hematoxylin and eosin (H&E) staining images showing the morphology of kidney tissue. (a) The morphological structure was normal in the control group with glomeruli surrounded by Bowman's capsule, without any inflammatory changes. (b, h, d, g and j) The T2DM (C⁺⁺) positive control group showed damaged nephrons with the degenerated glomeruli and the basement membrane. All white wheat fed groups showed severity, with more thickening of the basement membrane, expansion of glomeruli with degenerated glomeruli and more inflammatory cells, and exhibited severe pathological changes such as glomerular hypertrophy. (c, f and i) The anthocyanin rich black wheat fed groups showed less expansion of glomeruli, less thickening of the basement membrane and presence of few inflammatory cells. (e) Moreover, the C⁺ control group also showed the normal morphology of the glomerulus. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ). (III) Two-dimensional hematoxylin and eosin (H&E) staining images showing the morphology of spleen tissue. (a) The control group exhibited an intact morphological structure, marked by a sustained ratio of red to white pulp. (b, d, g and j) Spleen was totally damaged with significant reduction of the red pulp to white pulp ratio, accompanied by massive hemosiderin deposition in macrophages. (c, e, f, h and i) Damage to spleen was reversed in the positive control (C⁺ and C⁺⁺) groups. Meanwhile, the anthocyanin rich black wheat fed groups maintained the white to red pulp ratio. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ). (IV) Two-dimensional hematoxylin and eosin (H&E) staining images showing the morphology of adipose tissue. (a) The histological examination of visceral white adipose tissue reveals distinctive patterns with an intact morphological structure in the control group. (b, e and h) The negative control (C⁻) and both positive control (C⁺ and C⁺⁺) groups exhibited larger adipocytes characterized by fat accumulation in a single large droplet. (d, g and j) The white wheat chapatti groups such as T₁^W and T₂^W controls and T2DM diabetic T₃^W groups showed larger accumulation of fat in a single large droplet, which expanded and covered most of the cytoplasm. (c, f and i) The anthocyanin rich black wheat fed groups showed lower deposition of fat with a lower adipocyte diameter. The white wheat fed groups showed higher deposition of fat, accompanied by a larger adipocyte diameter, as calculated using ImageJ, as shown in (k). Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ).

3.10.2 Histological observations of the kidneys. The rat kidney sections were stained with haematoxylin and eosin, as mentioned in the Materials and methods section (Fig. 9II). The healthy control (C) rat kidneys showed normal glomeruli surrounded by Bowman's capsule, without any inflammatory changes. The negative control group fed with HFD (C⁻) showed degenerated glomeruli infiltrated by inflammatory cells and thickening of the basement membrane (Fig. 9b). Even the T2DM (C⁺⁺) positive control group showed damaged nephrons with degenerated glomeruli and basement membrane. All white wheat fed groups showed severity, with more thickening of the basement membrane, expansion of glomeruli with degenerated glomeruli and more inflammatory cells, and exhibited severe pathological changes such as glomerular hypertrophy, as shown in Fig. 9d, g and j. The T₁^B, T₂^B and T₃^B groups showed the effect of anthocyanin supplementation, especially the T2DM group with the features of healing, i.e., less expansion of glomeruli, less thickening of the basement membrane and the presence of few inflammatory cells (Fig. 9c, f and i).

3.10.3 Histological observations of the spleen. As shown in Fig. 9III, the histopathology of spleen was disordered in the HFD negative control (C⁻) and the white wheat T₁^W, T₂^W and T₃^W groups as the spleen was totally damaged with significant reduction of the red pulp to white pulp ratio, accompanied by massive hemosiderin deposition in macrophages. However, these alterations of the ratio was reversed in the positive control (C⁺ and C⁺⁺) groups and in the black wheat (T₃^B) T2DM groups, followed by the HFD (T₁^B) and STZ (T₂^B) control groups.

3.10.4 Histological observations of the adipose tissue. As shown in Fig. 9IV, the histological examination of visceral white adipose tissue revealed distinctive patterns. Normal adipocyte distribution was observed with ordinary sizes of cells in the NPD control group. Conversely, the negative control (C⁻) and both positive control (C⁺ and C⁺⁺) groups exhibited larger adipocytes characterized by fat accumulation in a single large droplet. The white wheat chapatti groups such as T₁^W and T₂^Wcontrols and T2DM diabetic T₃^W groups showed larger accumulation of fat in a single large droplet which expanded and covered most of the cytoplasm. In contrast, rats fed with black wheat chapatti T2DM (T₃^B) and the control groups (T₁^B and T₂^B) displayed a healed morphology with reduced fat accumulation, accompanied by the restoration of adipocyte diameters. Overall, fat accumulation was reduced in black wheat chapatti rats (Fig. 9IV(c, f and i)).

3.11 Colored wheat chapatti ameliorates the protein expression involved in the insulin signaling and glucose–lipid metabolism in T2DM rats

3.11.1 Effect of colored wheat chapatti on the AKT and p-AKT levels. The AKT and p-AKT expression levels in the liver tissue were qualitatively analyzed using immunofluorescence, as shown in Fig. 10I and II, and the findings suggest that the levels of the expressions of AKT and p-AKT and their intensity of fluorescence were markedly high in the NPD control (C) group. The intensity of fluorescence was reduced in the white wheat chapatti T2DM (T₃^W) groups, followed by the HFD (T₁^W) and STZ (T₂^W) treated control groups. Even the T2DM positive control (C⁺⁺) group showed a lower intensity of fluorescence, indicating a lower expression of AKT; however, no such change was observed in the case of p-AKT immunofluorescence. However, the black wheat T2DM (T₃^B) groups showed higher fluorescence. The HFD (T₁^B) and STZ (T₂^B) control groups showed similar fluorescence to that of the T2DM black wheat group. The intensity as well as expression were approximately similar to those of the control group.

Fig. 10 (I) Colored wheat ameliorates the AKT expression in liver tissue. The expression was qualitatively analyzed and calculated using ImageJ and is represented in (k). (a) The level of expression of AKT and its intensity of fluorescence was markedly high in the NPD control (C) group. (b, d, g, h and j) The intensity of fluorescence was reduced in the white wheat chapatti T2DM (T₃^W) groups, followed by the HFD (T₁^W) and STZ (T₂^W) treated control groups. Even the T2DM positive control (C⁺⁺) group showed a lower intensity of fluorescence, depicting a lower expression of AKT. (c, e, f and i) The intensity of fluorescence was markedly higher in the black wheat fed groups and the (C⁺) group, depicting insulin activation and further glucose management. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ). (II) Colored wheat enhances the p-AKT expression in liver tissue. The expression was qualitatively analyzed and calculated using ImageJ and is represented in (k). (a) The level of expression of AKT and its intensity of fluorescence was markedly high in the NPD control (C) group. (b, d, g and j) The intensity of fluorescence was reduced in the white wheat chapatti T2DM (T₃^W) groups, followed by the HFD (T₁^W) and STZ (T₂^W) treated control groups. (c, e, f, h and i) The intensity of fluorescence was markedly higher in the black wheat fed groups, and the (C⁺⁺) and (C⁺) groups, depicting insulin activation and further glucose management. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ). (III) Colored wheat enhances the AMPK expression in adipose tissue. The expression was qualitatively analyzed and calculated using ImageJ and is represented in (k). (a, c, e, f, h and i) The intensity of fluorescence and expression of AMPK were higher in the NPD control (C), positive control (C⁺ and C⁺⁺), and black wheat T2DM and its HFD and STZ groups – T₁^B, T₂^B and T₃^B control groups. The intensity of fluorescence was markedly higher in the black wheat fed groups, depicting glucose uptake by the cells through glut-4 receptors and further management of fatty acid oxidation. (b, d, g and j) The intensity of fluorescence was reduced in the white wheat chapatti T2DM (T₃^W) groups, followed by the HFD (T₁^W) and STZ (T₂^W) treated control groups. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ). (IV) Black wheat enhances the p-AMPK expression in adipose tissue. The expression was qualitatively analyzed and calculated using ImageJ and is represented in (k). (c, f and i) The intensity of fluorescence was markedly higher in the black wheat fed groups, depicting glucose uptake by the cells through glut-4 receptors and further management of the glucose–lipid metabolism. (a, e and h) Intensity of p-AMPK was equal between the control (C) group and the positive (C⁺ and C⁺⁺) control groups, but was lesser than the black chapatti (T₁^B, T₂^B and T₃^B) groups. (b, d, g and j) The intensity of fluorescence was reduced in the white wheat chapatti groups. Abbreviations: C (NPD + control group), C⁻ (NPD + HFD), T₁^B (BWC + HFD), T₁^W (WWC + HFD), C⁺ (NPD + STZ + insulin), T₂^B (BWC + STZ), T₂^W (BWC + STZ), C⁺⁺ (NPD + STZ + HFD + insulin), T₃^B (BWC + HFD + STZ), T₃^W (WWC + HFD + STZ).

3.11.2 Effect of colored wheat chapatti on the AMPK and p-AMPK levels. The AMPK and p-AMPK expression levels in the adipose tissue were also qualitatively analyzed in terms of immunofluorescence intensity, as shown in Fig. 10III and IV. Fig. 10III shows that the intensity of fluorescence and expression of AMPK were higher in the NPD control (C), positive control (C⁺ and C⁺⁺), and black wheat T2DM groups and its HFD and STZ groups – T₁^B, T₂^B and T₃^B control groups. However, the intensity was lower in all white wheat T₁^W, T₂^W and T₃^W groups. Similarly, the results were observed for the p-AMPK levels; the intensity of florescence was also lowered in T₁^W, T₂^W and T₃^W groups, indicating a lower expression of p-AMPK. The intensity of p-AMPK was equal between the control (C) group and the positive (C⁺ and C⁺⁺) control groups, but was less than those of the black chapatti (T₁^B, T₂^B and T₃^B) groups.

4. Discussion

The present study demonstrates the therapeutic potential of anthocyanin-rich colored wheat in mitigating various aspects of type 2 diabetes mellitus. A 12-week in vivo study was conducted in order to determine the pathogenesis of T2DM. A HFD-STZ-induced T2DM model was established in Sprague Dawley rats. Rats were supplemented with a HFD for 8 weeks, and after measuring blood glucose, the rats were given an intra-peritoneal injection of STZ. Dosage of insulin was standardized in order to prevent mortality. Compared to white wheat, anthocyanin-rich black wheat significantly improved the mortality rate, glucose homeostasis, insulin sensitivity and lipid metabolism, and attenuated oxidative stress and inflammation in the HFD-STZ-induced T2DM rat model.

Black wheat exhibited ability to improve glucose homeostasis and insulin sensitivity, as evidenced by the reduced fasting blood glucose levels and HbA1c, and improved the insulin sensitivity indices (HOMA-IR, HOMA-β, MCAi, and QUICKI). These findings are consistent with previous studies that have reported the beneficial effects of anthocyanins on glucose metabolism.^22,23 The potential mechanisms by which anthocyanins improve glucose homeostasis include the inhibition of α-amylase and α-glucosidase, increased glucose uptake, and enhanced insulin signalling.^15,24 Our study highlighted a lower glycemic index and higher α-amylase and α-glucosidase inhibitory activities of anthocyanin-rich colored wheat compared to white wheat. Even the IC₅₀ results also suggested that black wheat chapatti may have a stronger potential to slow down carbohydrate digestion and regulate glucose release, which could help in managing postprandial glucose levels more effectively than white wheat chapatti. The lower glycemic index of anthocyanin-rich black wheat, likely due to its higher anthocyanin content, lower carbohydrates, and dietary fibers, further supports its role in maintaining glucose homeostasis.^25,26

The study also demonstrated the beneficial effects of black wheat on lipid metabolism and cardiovascular risk. The intervention significantly improved the lipid profile (TG, TC, LDL, VLDL and HDL) and reduced the cardiovascular risk indices (AIP, AC, CRR and CPI). These findings are in line with the existing literature on the role of anthocyanins in improving lipid metabolism.²⁷ The potential mechanisms by which anthocyanins exert these effects include increased fatty acid oxidation, reduced lipogenesis, and enhanced cholesterol efflux.¹⁸ The reduction in lipid levels and improvement in the cardiovascular risk indices suggest the potential anti-atherosclerotic effects of anthocyanin-rich colored wheat, which are crucial in managing the cardiovascular complications associated with T2DM.

Black wheat intervention effectively attenuated oxidative stress and inflammation associated with T2DM. The study showed improved antioxidant enzyme activity (SOD and catalase) and reduced oxidative stress markers (MDA and H₂O₂) in the black wheat intervention groups. Moreover, inflammatory markers (TNF-α, IL-6, IL-1β, IFN-γ, IL-17A, leptin and resistin) were significantly reduced, while anti-inflammatory adipokine (Acrp-30) levels were enhanced. These findings are consistent with previous studies that have reported the antioxidant and anti-inflammatory properties of anthocyanins.^28–30 The potential mechanisms by which anthocyanins reduce oxidative stress and inflammation include scavenging free radicals, enhancing antioxidant enzyme activity, and modulating inflammatory signaling pathways. The attenuation of oxidative stress and inflammation is particularly important in T2DM, as these factors contribute to the development and progression of various complications associated with the disease.

The study also investigated the impact of black wheat on PI3K/AKT and adiponectin-SIRT1-AMPK signaling pathways, which play crucial roles in glucose and lipid metabolism. The results showed improved activation of these pathways in the black wheat intervention groups, as evidenced by the increased phosphorylation of AKT, enhanced expression of adiponectin receptors, and activation of SIRT1 and AMPK. These findings are in agreement with the existing literature on the role of these pathways in T2DM and the effects of anthocyanins on their activation.^9,31–34 The modulation of these signaling pathways by anthocyanin-rich colored wheat suggests its potential in regulating glucose and lipid metabolism at the molecular level, which is essential for the prevention and management of T2DM.

Histopathological observations in the liver, kidney, spleen, and adipose tissue further supported the anti-diabetic effects of black wheat. The intervention groups exhibited reduced pathological alterations in these tissues, such as reduced inflammation, oxidative stress, and lipid accumulation. These findings are consistent with previous studies that have reported the protective effects of anthocyanins on various tissues in T2DM.^35–39 The histopathological evidence highlights the potential of anthocyanin-rich colored wheat in preventing and reversing the tissue damage associated with T2DM, which is crucial for maintaining overall health and preventing long-term complications.

The present study provides a comprehensive evaluation of the anti-diabetic effects of anthocyanin-rich colored wheat, encompassing glucose homeostasis, insulin sensitivity, lipid metabolism, oxidative stress, inflammation, molecular signaling pathways, and histopathological observations. The findings consistently demonstrate the therapeutic potential of anthocyanin-rich black wheat in managing T2DM and its associated complications. The study not only highlights the beneficial effects of black wheat on various aspects of T2DM, but also provides insights into the potential mechanisms underlying these effects, such as the inhibition of α-amylase and α-glucosidase, increased glucose uptake, enhanced insulin signaling, increased fatty acid oxidation, reduced lipogenesis, enhanced cholesterol efflux, scavenging of free radicals, enhancement of antioxidant enzyme activity, and modulation of inflammatory signaling pathways.

The results of this study contribute to the growing evidence supporting the use of functional foods and nutraceuticals, such as black wheat, in the prevention and management of T2DM. The findings suggest that incorporating anthocyanin-rich black wheat into the diet could offer a natural and effective approach to combat this prevalent metabolic disorder. However, further research, including human clinical trials, is needed to assess the efficacy and optimal dosage of anthocyanin-rich colored wheat in managing T2DM and to explore its potential synergistic effects with other anti-diabetic agents or lifestyle interventions.

In conclusion, anthocyanin-rich colored wheat represents a promising therapeutic agent for the comprehensive management of type 2 diabetes mellitus, providing a strong foundation for future research and the development of innovative strategies to prevent and treat T2DM using functional foods and nutraceuticals. Anthocyanin-rich colored wheat represents a promising functional food ingredient for the comprehensive management of type 2 diabetes mellitus, offering a natural and effective approach to combat this prevalent metabolic disorder.

Author contributions

This study was conceptualized and designed by A. B. and M. G. V. T. carried out the majority of the experiments, analyzed the data, and drafted the manuscript. A. K., B. S., E. C., M. Y., and U. A. provided technical assistance and contributed to specific experimental procedures. A. K., M. K., U. A., and A. T. were responsible for critical reviewing, editing, and formatting of the manuscript to ensure clarity and consistency. The final review of the manuscript was conducted by A. B. and M. G., who provided expert insights and ensured that the manuscript adhered to high-quality standards.

Data availability

The authors confirm that the data supporting the findings of this study are available within the article or its ESI.†

Conflicts of interest

The authors declare that there are no competing interests.

Acknowledgements

The authors are also thankful to the National Agri-Food Biotechnology Institute, Mohali, DBT, GOI and Panjab University (DBT-BUILDER GRANT), Chandigarh for providing financial help along with the lab facility for conducting this study.

References

1. J. Valabhji, T. Gorton, E. Barron, S. Safazadeh, F. Earnshaw, C. Helm and C. Bakhai, Early findings from the NHS Type 2 Diabetes Path to Remission Programme: a prospective evaluation of real-world implementation, Lancet Diabetes Endocrinol., 2024, 12, 653–663.
2. J. Xiao, Recent advances in dietary flavonoids for management of T2DM, Curr. Opin. Food Sci., 2022, 44, 100806.
3. R. A. DeFronzo, E. Ferrannini, L. Groop, R. R. Henry, W. H. Herman, J. J. Holst, F. B. Hu, C. R. Kahn, I. Raz, G. I. Shulman, D. C. Simonson, M. A. Testa and R. Weiss, Type 2 diabetes mellitus, Nat. Rev. Dis. Primers, 2015, 1, 1–22.
4. Z. Li, H. Yan, L. Chen, Y. Wang, J. Liang, X. Feng, S. Hui and K. Wang, Effects of whole grain intake on glycemic control: A meta–analysis of randomized controlled trials, J. Diabetes Invest., 2022, 13, 1814–1824.
5. W. Luo, J. Zhou, X. Yang, R. Wu, H. Liu, H. Shao, B. Huang, X. Kang, L. Yang and D. A. Liu, Chinese medical nutrition therapy diet accompanied by intermittent energy restriction alleviates type 2 diabetes by enhancing pancreatic islet function and regulating gut microbiota composition, Food Res. Int., 2022, 161, 111744.
6. M. Garg, M. Chawla, V. Chunduri, R. Kumar, S. Sharma, N. K. Sharma, N. Kaur, A. Kumar, J. K. Mundey, M. K. Saini and S. P. Singh, Transfer of grain colors to elite wheat cultivars and their characterization, J. Cereal Sci., 2016, 71, 138–144.
7. P. Dangi, N. Chaudhary, A. Paul, A. Sharma, I. Dutta and R. Razdan, Pigmented Wheat: Nutrition Scenario and Health Benefits, 2023.
8. T. H. Gamel, S. M. G. Saeed, R. Ali and E. S. M. Abdel-Aal, Purple Wheat: Food Development, Anthocyanin Stability, and Potential Health Benefits, Foods, 2023, 12, 1358.
9. L. Liu, T. Zhang, J. Hu, R. Ma, B. He, M. Wang and Y. Wang, Adiponectin/SIRT1 Axis Induces White Adipose Browning After Vertical Sleeve Gastrectomy of Obese Rats with Type 2 diabetes, Obes. Surg., 2020, 30, 1392–1403.
10. S. Sharma, P. Khare, A. Kumar, V. Chunduri, A. Kumar, P. Kapoor, P. Mangal, K. K. Kondepudi, M. Bishnoi and M. Garg, Anthocyanin–Biofortified Colored Wheat Prevents High Fat Diet–Induced Alterations in Mice: Nutrigenomics Studies, Mol. Nutr. Food Res., 2020, 64, 1900999.
11. M. Shahwan, F. Alhumaydhi, G. M. Ashraf, P. M. Hasan and A. Shamsi, Role of polyphenols in combating Type 2 Diabetes and insulin resistance, Int. J. Biol. Macromol., 2022, 206, 567–579.
12. Y. Huang and X. Zhang, Luteolin alleviates polycystic ovary syndrome in rats by resolving insulin resistance and oxidative stress, Am. J. Physiol. Endocrinol. Metab., 2021, 320, E1085–E1092.
13. M. Garg, NABIMG-11-Black (BW/2* PBW621)(IC0620916; INGR17003), a Wheat (Triticum aestivum) Germplasm with Black grain colour (purple pericarp+ blue aleuron), Indian J. Plant Genet. Res., 2018, 31, 334–335.
14. A. Kumari, S. Sharma, N. Sharma, V. Chunduri, P. Kapoor, S. Kaur, A. Goyal and M. Garg, Influence of biofortified colored wheats (purple, blue, black) on physicochemical, antioxidant and sensory characteristics of chapatti (Indian flatbread), Molecules, 2020, 25(21), 5071.
15. Z. Chen, C. Wang, Y. Pan, X. Gao and H. Chen, Hypoglycemic and hypolipidemic effects of anthocyanins extract from black soybean seed coat in high fat diet and streptozotocin-induced diabetic mice, Food Funct., 2018, 9, 426–439.
16. D. Q. Li, Z. M. Qian and S. P. Li, Inhibition of three selected beverage extracts on α-glucosidase and rapid identification of their active compounds using HPLC-DAD-MS/MS and biochemical detection, J. Agric. Food Chem., 2010, 58, 6608–6613.
17. P. Kapoor, A. Kumari, B. Sheoran, S. Sharma, S. Kaur, R. K. Bhunia and M. Garg, Anthocyanin biofortified colored wheat modifies gut microbiota in mice, J. Cereal Sci., 2022, 104, 103433.
18. N. Oršolić, I. Landeka Jurčević, D. Đikić, D. Rogić, D. Odeh, V. Balta, E. Perak Junaković, S. Terzić and D. Jutrić, Effect of Propolis on Diet-Induced Hyperlipidemia and Atherogenic Indices in Mice, Antioxidants, 2019, 8, 156.
19. D. R. Matthews, J. P. Hosker, A. S. Rudenski, B. A. Naylor, D. F. Treacher and R. C. Turner, Homeostasis model assessment: Insulin resistance and β-cell function from fasting plasma glucose and insulin concentrations in man, Diabetologia, 1985, 7, 412–419.
20. A. Katz, S. S. Nambi, K. Mather, A. D. Baron, D. A. Follmann, G. Sullivan and M. J. Quon, Quantitative insulin sensitivity check index: A simple, accurate method for assessing insulin sensitivity in humans, J. Clin. Endocrinol. Metab., 2000, 85, 2402–2410.
21. K. A. McAuley, S. M. Williams, J. I. Mann, R. J. Walker, N. J. Lewis-Barned, L. A. Temple and A. W. Duncan, Diagnosing insulin resistance in the general population, Diabetes Care, 2001, 24, 460–464.
22. S. Tian, M. Wang, C. Liu, H. Zhao and B. Zhao, Mulberry leaf reduces inflammation and insulin resistance in type 2 diabetic mice by TLRs and insulin Signalling pathway, BMC Complementary Altern. Med., 2019, 19, 326.
23. K. H. Choi, H. A. Lee, M. H. Park and J. S. Han, Mulberry (Morus alba L.) Fruit Extract Containing Anthocyanins Improves Glycemic Control and Insulin Sensitivity via Activation of AMP-Activated Protein Kinase in Diabetic C57BL/Ksj-db/db Mice, J. Med. Food, 2016, 19, 737–745.
24. P. Ockermann, L. Headley, R. Lizio and J. Hansmann, A Review of the Properties of Anthocyanins and Their Influence on Factors Affecting Cardiometabolic and Cognitive Health, Nutrients, 2021, 13, 8.
25. C. Chusak, P. Pasukamonset, P. Chantarasinlapin and S. Adisakwattana, Postprandial Glycemia, Insulinemia, and Antioxidant Status in Healthy Subjects after Ingestion of Bread made from Anthocyanin-Rich Riceberry Rice, Nutrients, 2020, 12, 3.
26. T. Mao, F. N. U. Akshit and M. S. Mohan, Effects of anthocyanin supplementation in diet on glycemic and related cardiovascular biomarkers in patients with T2DM: A systematic review and meta-analysis of randomized controlled trials, Front. Nutr., 2023, 10, 1199815.
27. X. Q. Hu, K. Thakur, G. H. Chen, F. Hu, J. G. Zhang, H. B. Zhang and Z. J. Wei, Metabolic Effect of 1-Deoxynojirimycin from Mulberry Leaves on db/db Diabetic Mice Using Liquid Chromatography–Mass Spectrometry Based Metabolomics, J. Agric. Food Chem., 2017, 65, 4658–4667.
28. K. Thompson, W. Pederick and A. B. Santhakumar, Anthocyanins in obesity-associated thrombogenesis: a review of the potential mechanism of action, Food Funct., 2016, 7, 2169–2178.
29. A. Nemes, J. R. Homoki, R. Kiss, C. Hegedűs, D. Kovács, B. Peitl, F. Gál, L. Stündl, Z. Szilvássy and J. Remenyik, Effect of Anthocyanin-Rich Tart Cherry Extract on Inflammatory Mediators and Adipokines Involved in T2DM in a High Fat Diet Induced Obesity Mouse Model, Nutrients, 2019, 11, 9.
30. M. Monagas, N. Khan, C. Andrés-Lacueva, M. Urpí-Sardá, M. Vázquez-Agell, R. M. Lamuela-Raventós and R. Estruch, Dihydroxylated phenolic acids derived from microbial metabolism reduce lipopolysaccharide-stimulated cytokine secretion by human peripheral blood mononuclear cells, Br. J. Nutr., 2009, 102, 201–206.
31. D. A. Fruman, H. Chiu, B. D. Hopkins, S. Bagrodia, L. C. Cantley and R. T. Abraham, The PI3K pathway in human disease, Cell, 2017, 170, 605–635.
32. B. Dai, Q. Wu, C. Zeng, J. Zhang, L. Cao, Z. Xiao and M. Yang, The effect of Liuwei Dihuang decoction on PI3K/Akt signaling pathway in liver of type 2 diabetes mellitus (T2DM) rats with insulin resistance, J. Ethnopharmacol., 2016, 192, 382–389.
33. M. Iwabu, T. Yamauchi, M. Okada-Iwabu, K. Sato, T. Nakagawa, M. Funata, M. Yamaguchi, S. Namiki, R. Nakayama, M. Tabata, H. Ogata, N. Kubota, I. Takamoto, Y. K. Hayashi, N. Yamauchi, H. Waki, M. Fukayama, I. Nishino, K. Tokuyama and T. Kadowaki, Adiponectin and AdipoR1 regulate PGC-1α and mitochondria by Ca²⁺ and AMPK/SIRT1, Nature, 2010, 464, 1313–1319.
34. Z. Shen, X. Liang, C. Q. Rogers, D. Rideout and M. You, Involvement of adiponectin-SIRT1-AMPK signaling in the protective action of rosiglitazone against alcoholic fatty liver in mice, Am. J. Physiol.: Gastrointest. Liver Physiol., 2010, 298, G364–G374.
35. M. Motshakeri, M. Ebrahimi, Y. M. Goh, H. H. Othman, M. Hair-Bejo and S. Mohamed, Effects of Brown Seaweed (Sargassum polycystum) Extracts on Kidney, Liver, and Pancreas of Type 2 Diabetic Rat Model, Evidence-Based Complementary Altern. Med., 2014, 379407.
36. Z. Zuo, W. Pang, W. Sun, B. Lu, L. Zou, D. Zhang and Y. Wang, Metallothionein–Kidney Bean Polyphenol Complexes Showed Antidiabetic Activity in Type 2 Diabetic Rats by Improving Insulin Resistance and Regulating Gut Microbiota, Foods, 2023, 12, 16.
37. N. Kandasamy and N. Ashokkumar, Renoprotective effect of myricetin restrains dyslipidemia and renal mesangial cell proliferation by the suppression of sterol regulatory element binding proteins in an experimental model of diabetic nephropathy, Eur. J. Pharmacol., 2014, 743, 53–62.
38. Y. Wu, G. Jia, B. Wang, J. Xiong, J. Xu, P. Zheng, Y. Yuan, Y. Li, T. Jiang, A. Al Mamun, K. Xu, Y. Liu, H. Cao and J. Xiao, Fibroblast growth factor 1 ameliorates diabetes-induced splenomegaly via suppressing inflammation and oxidative stress, Biochem. Biophys. Res. Commun., 2020, 528, 249–255.
39. J. Manna, G. L. Dunbar and P. Maiti, Curcugreen Treatment Prevented Splenomegaly and Other Peripheral Organ Abnormalities in 3xTg and 5xFAD Mouse Models of Alzheimer's Disease, Antioxidants, 2021, 10, 6.

---

Footnote

† Electronic supplementary information (ESI) available. See DOI: https://doi.org/10.1039/d4fo05065g

---