Open Access Article
This Open Access Article is licensed under a
Creative Commons Attribution 3.0 Unported Licence

Evaluation of the in vitro effects of the increasing inclusion levels of yeast β-glucan, a casein hydrolysate and its 5 kDa retentate on selected bacterial populations and strains commonly found in the gastrointestinal tract of pigs

Brigkita Venardou a, John V. O'Doherty b, Mary J. McDonnell b, Anindya Mukhopadhya ac, Claire Kiely b, Marion T. Ryan a and Torres Sweeney *ac
aSchool of Veterinary Medicine, University College Dublin, Belfield, Dublin 4, Ireland. E-mail: torres.sweeney@ucd.ie
bSchool of Agriculture and Food Science, University College Dublin, Belfield, Dublin 4, Ireland
cFood for Health Ireland, University College Dublin, Belfield, Dublin 4, Ireland

Received 31st August 2020 , Accepted 20th January 2021

First published on 16th February 2021


Abstract

Previously, the 5 kDa retentate (5kDaR) of a casein hydrolysate (CH) and yeast β-glucan (YBG) were identified as promising anti-inflammatory dietary supplements for supporting intestinal health in pigs post-weaning. However, their direct effects on intestinal bacterial populations are less well-known. The main objectives of this study were to determine if the increasing concentrations of the CH, 5kDaR and YBG individually, can: (1) alter the bacterial and short-chain fatty acid profiles in a weaned pig faecal batch fermentation assay, and (2) directly influence the growth of selected beneficial (Lactobacillus plantarum, L. reuteri, Bifidobacterium thermophilum) and pathogenic (Enterotoxigenic Escherichia coli, Salmonella Typhimurium) bacterial strains in individual pure culture growth assays. The potential of CH as a comparable 5kDaR substitute was also evaluated. The 5kDaR increased lactobacilli counts and butyrate concentration in the batch fermentation assay (P < 0.05) and increased L. plantarum (linear, P < 0.05), L. reuteri (quadratic, P < 0.05) and B. thermophilum (linear, P < 0.05) counts and reduced S. typhimurium (quadratic, P = 0.058) counts in the pure culture growth assays. CH increased butyrate concentration (P < 0.05) in the batch fermentation assay. YBG reduced Prevotella spp. counts (P < 0.05) and butyrate concentration (P < 0.05) in the batch fermentation assay. Both CH and YBG had no major effects in the pure culture growth assays. In conclusion, the 5kDaR had the most beneficial effects associated with increased counts of Lactobacillus and Bifidobacterium genera and butyrate production and reduced S. typhimurium counts in vitro indicating its potential to promote gastrointestinal health.


Introduction

Gastrointestinal functionality, homeostasis and health are greatly influenced by the residing microbiota.1 Two widely known beneficial constituents of this microbial community are the genera Lactobacillus and Bifidobacterium due to their contributions to carbohydrate metabolism, colonisation resistance against pathogens, immunomodulation and maintenance of intestinal barrier function.2–5Prevotella genus is another important commensal of the gastrointestinal microbiota involved in the degradation of complex dietary carbohydrates providing the host with energy and beneficial metabolites such as short-chain fatty acids (SCFA).6–8 From a health perspective, the Enterobacteriaceae family is a significant intestinal population, as it includes many human and swine pathogens such as Escherichia coli and Salmonella enterica subsp. enterica serovars (e.g. Typhimurium, Enteritidis).9–12 Disturbances to the composition and/or metabolic activities of the gastrointestinal microbiota can result in dysbiosis.13 Post-weaning diarrhoea in pigs is a classic example of a dysbiotic condition whereby pigs have reduced feed intake, resulting in reduced growth and performance and leading to significant economic losses.14 In humans, dysbiosis is associated with a wide range of diseases and disorders such as inflammatory bowel disease, colorectal cancer and metabolic disorders.13

Diet is an important driver of the composition of the gastrointestinal microbiota. Extensive research has been carried out to identify dietary supplements which promote the growth of beneficial bacteria and/or inhibit the colonisation of pathogens. Of interest are the bioactive peptides derived from the bovine milk proteins, casein and whey. These peptides exhibit a broad range of biological activities such as antihypertensive,15 antioxidative,16 immunomodulatory17–19 and antibacterial against various pathogenic and spoilage bacteria.20–24 Another interesting finding is the growth-promoting and protective properties of milk bioactive peptides to beneficial bacteria such as Lactobacillus spp. and Bifidobacterium spp.19,23,25,26 Furthermore, there is evidence that these bioactive peptides can be multifunctional. For instance, a casein peptide exhibiting antibacterial, antioxidant and antihypertensive capacity has been previously identified.22

Recently, dietary supplementation of weaned pigs with a 5 kDa retentate (5kDaR) of a sodium caseinate hydrolysate (CH) combined with yeast β-glucan (YBG), a non-digestible polysaccharide with known immunomodulatory activity,27,28 alleviated the negative impact of weaning and improved faecal consistency.29 It was hypothesised that the YBG protected the 5kDaR from hydrolysis in the small intestine. While the 5kDaR has established anti-inflammatory activity both in vitro30,31 and in the weaned pig model,29 its direct effects on the GIT microbiota, including, antimicrobial activity against pathogens and/or stimulatory effects on beneficial bacterial species are still undetermined. To further understand the mode of action of the 5kDaR, a batch fermentation assay using faecal inoculum and pure culture growth assays were employed as these are established methods with which to investigate the effects of bioactive compounds on selected bacterial groups within a microbial community and on specific bacterial strains.32,33 The primary objective of this study was to investigate the effects of the increasing concentrations of CH, its 5kDaR and YBG individually on selected bacterial populations and on SCFA production in the faeces of weaned pigs using a batch fermentation assay. Based on the results of the primary objective, we then determined if the beneficial changes were evident in specific bacterial species. Thus, the second objective of this study was to determine whether the increasing concentrations of CH, its 5kDaR and YBG individually enhance the growth of the beneficial genera Lactobacillus spp. and Bifidobacterium spp. and/or have antimicrobial activity specific to animal and foodborne pathogens in pure culture growth assays. As the production of the 5kDaR is expensive, the final objective of this study was to evaluate the potential of CH as a comparable substitute to 5kDaR.

Materials and methods

An outline of the experimental processes of the study is provided in Fig. S1.

Casein hydrolysates and YBG

The CH and its 5kDaR were produced from the hydrolysis of sodium caseinate (NaCas, ≈90% w/w protein, Kerry Food Ingredients, Listowel, Ireland) derived from bovine milk and have been described previously.31 The YBG was derived from Saccharomyces cerevisiae (Biothera Pharmaceuticals, Inc., Eagan, MI, USA) and has been described previously.27 All compounds were stored at room temperature in sealed containers.

Batch fermentation assay

Faecal inoculum. Faeces from 29 newly weaned crossbred pigs (Large White × Landrace) from a commercial farm (Perma pigs Limited, Co. Kildare, Ireland) were collected and pooled. The pooled faeces were aliquoted and stored at −20 °C. The faecal inoculum (FI) was prepared one day prior to the batch fermentation assay by performing a 5-fold dilution of the pooled faeces on weight basis (1[thin space (1/6-em)]:[thin space (1/6-em)]5 w/v) in pre-reduced phosphate buffered saline (Sigma-Aldrich, St Louis, MO, USA) after the addition of oxyrase (Sigma-Aldrich, St Louis, MO, USA), an enzyme that removes oxygen from the broth. The FI was stored at 4 °C within a sealed container with anaerobic conditions established using AnaeroGen 2.5 L sachets (Thermo Fisher Scientific, Waltham, MA, USA).34
Fermentation assay. The modified batch fermentation assay was designed based on previous studies.34,35 The media and reagents used were purchased by Sigma-Aldrich (St Louis, MO, USA) unless otherwise stated. The composition of the fermentation medium (FM-medium) was as follows: 5 g L−1 yeast extract (Y1625), 10 g L−1 ascorbic acid (A4544), 10 g L−1 sodium acetate (S5636), 5 g L−1 (NH4)2SO4 (A3920), 2 g L−1 urea (U5378), 0.2 g L−1 MgSO47H2O (M2773), 0.01 g L−1 FeSO47H2O (F8633), 0.007 g L−1 MnSO4xH2O (M7899), 0.01 g L−1 NaCl (S5886), 1 ml L−1 Tween 80 (P4780), 0.05 g L−1 hemin (51280) and 0.5 g L−1L-cysteine hydrochloride (C1276). The pH was adjusted to 7.0. The FM-medium was autoclaved for dissolution and sterilisation and stored at 4 °C. The tested casein hydrolysates and YBG were diluted in a final volume of 21 ml FI/FM medium at 1, 2.5 and 5 mg ml−1 concentrations. The FI[thin space (1/6-em)]:[thin space (1/6-em)]FM-medium ratio was 1[thin space (1/6-em)]:[thin space (1/6-em)]10 v/v. The batch fermentation was carried out in glass tubes (PYREX™ Disposable Round-Bottom Rimless Glass Tubes, Fisher Scientific, Co. Dublin, Ireland) with rubber stoppers (Saint-Gobain Rubber stopper grey blue 17/22 x H 25MM, VWR, Co. Dublin, Ireland). Anaerobic conditions were established and maintained by the addition of oxyrase and CO2 flushing. Control tubes (0 mg ml−1) containing only FI and FM-medium were also included. All tubes were incubated at 39 °C for 24 h with gentle stirring (100 rpm). A volume of 5 ml fermentation broth was collected at 0, 10 and 24 h in duplicate tubes. The collected samples were centrifuged at 12[thin space (1/6-em)]000g for 5 minutes. The supernatants and pellets were stored in −20 °C until further analysis. All experiments were repeated on three independent occasions, hence n = 3 biological replicates.

Short chain fatty acid (SCFA) analysis

The SCFA profile of the supernatants was determined using gas liquid chromatography as described previously.36 Each supernatant sample (1 g) was diluted with distilled water (2.5 × weight of sample) and centrifuged at 1400g for 10 minutes (Sorvall GLC-2 B laboratory centrifuge, DuPont, Wilmington, DE, USA). One ml of the subsequent supernatant and 1 ml of internal standard (0.05% 3-methyl-n-valeric acid in 0.15 M oxalic acid dihydrate) were mixed with 3 ml distilled water. The reaction mixture was centrifuged at 500g for 10 min and the supernatant was filtered through 0.45 PTFE (polytetrafluoroethylene) syringe filter into a chromatographic sample vial. An injection volume of 1 μl was injected into a Varian 3800 GC equipped with an EC™ 1000 Grace column (15 m × 0.53 mm I.D.) with 1.20 μm film thickness. The temperature programme set was 75–95 °C increasing by 20 °C per minute, which was held for 30 seconds. The detector and injector temperature were 280 and 240 °C, respectively, while the total analysis time was 12.42 minutes.

Quantification of bacterial groups using quantitative real time polymerase chain reaction (QPCR)

DNA extraction. Microbial genomic DNA was extracted using QIAamp Fast DNA stool mini kit (Qiagen, West Sussex, UK) according to the manufacturer's instructions. The DNA quantity and quality were evaluated using a Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
Bacterial primers. The list of the domain-, family- or genus-specific primers targeting the 16S rRNA gene of the selected bacterial groups are provided in Table 1.
Table 1 List of forward and reverse primers used for the bacterial quantification by QPCR
Target bacterial group Forward primer (5′-3′), Reverse primer (5′-3′) Amplicon length (bp) T m (°C)
bp, base pairs; Tm, melting temperature.
Total bacteria F: GTGCCAGCMGCCGCGGTAA, R: GACTACCAGGGTATCTAAT 291 64.2, 52.4
Lactobacillus spp. F: AGCAGTAGGGAATCTTCCA, R: CACCGCTACACATGGAG 341 54.5, 55.2
Bifidobacterium spp. F: GCGTGCTTAACACATGCAAGTC, R: CACCCGTTTCCAGGAGCTATT 125 60.3, 59.8
Enterobacteriaceae F: ATGTTACAACCAAAGCGTACA, R: TTACCYTGACGCTTAACTGC 185 54.0, 56.3
Prevotella spp. F: CACRGTAAACGATGGATGCC, R: GGTCGGGTTGCAGACC 514 58.3, 56.9


Plasmid and standard curve preparation. Bacterial genomic DNA from Bifidobacterium thermophilum (DSMZ 20210), Lactobacillus plantarum (DSMZ 20174) and S. typhimurium phage type (PT) 12 was extracted from pure cultures using DNeasy® Blood & Tissue kit (Qiagen, West Sussex, UK), whereas for Prevotella spp. bacterial genomic DNA of P. bryantii (DSMZ 11371) was used. Bacterial strains and genomic DNA were purchased from Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) except for S. typhimurium PT 12.37 The targeted genes were amplified with a conventional PCR with the respective primers and genomic locations being outlined in Table S1. The amplicons were incorporated into a vector using the TOPO™ TA Cloning™ Kit for Sequencing (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA). One Shot™ TOP10 Chemically Competent E. coli were transformed according to the manufacturer's instructions using a heat shock method. LB agar (Lennox, Co. Dublin, Ireland) plates containing ampicillin (100 μg ml−1) were inoculated with the bacterial culture (50 μl) using a sterile plate spreader and incubated at 37 °C overnight. Individual colonies were re-plated, screened for the presence of the plasmid and preserved on cryoprotective beads (TS/71-MX, Protect Multi-purpose, Technical Service Consultants Ltd, Lancashire, UK) that were stored at −80 °C. The transformed E. coli was re-cultured by transferring a single cryoprotective bead in 200 ml LB Broth Base (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) containing ampicillin and incubated at 37 °C for 18 h at 150 rpm. The plasmids carrying the target genes were purified on a large scale using the GenElute™ HP Plasmid Maxiprep kit (Sigma-Aldrich, St Louis, MO, USA) and linearised using APA1 (Promega, Madison, WI, USA) restriction enzyme according to the manufacturer's instructions. The linearised plasmids were further purified using the GenElute™ PCR Clean-Up kit (Sigma-Aldrich, St. Louis, MO, USA). The purified, linearized plasmids were quantified spectrophotometrically and copy number per μl was determined using an online tool which employs the formula mol g−1 × molecules per mol = molecules per g using Avogadro's number, 6.022 × 1023 molecules per mol provided by the URI Genomics & Sequencing Center (http://cels.uri.edu/gsc/cndna.html). Standard curves were prepared using 5-fold serial dilutions for the purposes of QPCR.
QPCR. The final reaction volume (20 μl) included 3 μl template DNA, 1 μl of each primer (10 μM), 5 μl nuclease-free water and 10 μl of Fast SYBR® Green Master Mix (Applied Biosystems. Foster City, CA, USA) for the Lactobacillus spp. or GoTaq® qPCR Master Mix (Promega, Madison, WI, USA) for the remaining bacterial groups. All QPCR reactions were performed in duplicate and were carried out on ABI 7500 Fast PCR System (Applied Biosystems, Foster City, CA, USA). The cycling conditions included a denaturation step of 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Dissociation curves were generated to confirm the specificity of the resulting PCR products. In addition, the PCR products were visualised on an agarose gel stained with ethidium bromide, to ensure that the PCR products from the sample and plasmid were of equal size. The efficiency of each QPCR reaction was established by plotting the threshold cycles (Ct) derived from 5-fold serial dilutions of the plasmid against their arbitrary quantities and only assays exhibiting 90–110% efficiency and single products were used in this study. Bacterial counts were determined using a standard curve derived from the mean Ct value and the log transformed gene copy number of the plasmid and expressed as log transformed gene copy number per gram of digesta (LogGCN per g digesta).

Bacterial strains and growth conditions

The strains L. plantarum (DSMZ 20174), L. reuteri (DSMZ 20016) and B. thermophilum (DSMZ 20210) were selected as they are commensals with well characterised health-promoting properties. The selected pathogenic strains were the enterotoxigenic E. coli (ETEC) O149A+, a predominant cause of post-weaning diarrhoea in weaned piglets, and S. typhimurium PT12, an important foodborne pathogen. Specific information for each bacterial strain is provided in Table S2.L. plantarum, B. thermophilum and S. typhimurium strains were as above, L. reuteri was purchased from Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures and ETEC was kindly provided from the Central Veterinary Research laboratory (DAFM-Laboratories Backweston, Co. Kildare, Ireland).

All bacterial strains were revived from cryoprotective beads that were stored at −20 °C. L. plantarum and L. reuteri were inoculated in 10 ml volume of de Man, Rogosa and Sharpe broth (MRS, Oxoid Ltd, Hampshire, UK) and incubated aerobically at 37 °C for 48 h. B. thermophilum was streaked onto MRS agar (MRSA, Oxoid Ltd, Hampshire, UK) and incubated anaerobically at 37 °C for 48 h. Anaerobic conditions were established within sealed containers using AnaeroGen 2.5 L and 3.5 L sachets (Thermo Fisher Scientific, Waltham, MA, USA). ETEC and S. typhimurium were inoculated in 10 ml Tryptone Soya Broth (TSB, Oxoid Ltd, Hampshire, UK) and incubated aerobically at 37 °C for 48 h. All bacterial strains were sub-cultured by transferring 1 ml of the previous culture to 9 ml of the respective sterile medium and incubated aerobically at 37 °C for 24 h. In the case of B. thermophilum a few colonies were inoculated into 10 ml MRS and incubated anaerobically at 37 °C for 24 h. Lactobacilli and ETEC and S. typhimurium cultures were additionally streaked on MRSA and Tryptone Soya Agar (TSA, Oxoid Ltd, Hampshire, UK) respectively to ensure purity. The 24 h cultures were used for the subsequent assays.

Pure culture growth assays

The assays were designed based on methodologies from previous experiments with some modifications.38–40 The assays were carried out in 96-well microtiter plate (CELLSTAR, Greiner Bio-One, Kremsmünster, Austria). Casein hydrolysates and YBG were diluted in 10% MRS and 10% TSB at a working concentration of 4 mg ml−1 and stored at 4 °C. Contamination checks were performed regularly to ensure the sterility of the subsequent assays. Further 2-fold dilutions (2–0.25 mg ml−1) were performed each time prior to the assay. All bacterial strains were diluted in 10% medium (MRS or TSB) to obtain an inoculum of 106–107 CFU (colony-forming unit) per ml with initial bacterial enumeration being performed each time. 100 μl of each compound and each dilution was transferred to duplicate wells and 100 μl inoculum was added. Control wells containing 100 μl of 10% medium and 100 μl inoculum were also included. To evaluate the sterility, blank wells containing 100 μl of 10% medium and 100 μl of each dilution of each compound were considered. Plates were agitated gently to ensure thorough mixing and incubated aerobically at 37 °C for 18 h, apart from B. thermophilum that was incubated anaerobically.

After incubation, spread plating was used to determine both the bacterial viability and counts at the increasing concentrations of each compound. A modified Miles and Misra method was used to determine the final bacterial concentration.41 Briefly, the content of the wells was mixed by pipetting and 25 μl from each well was transferred to 225 μl Maximum Recovery Diluent (MRD, Oxoid Ltd, Hampshire, UK). Following a 10-fold serial dilution (10−1–10−8), 20 μl was transferred onto MRSA for L. plantarum, L. reuteri and B. thermophilum and TSA for ETEC and S. typhimurium. Plates were incubated aerobically at 37 °C for 24 h with the exception of B. thermophilum which was incubated anaerobically at 37 °C for 48 h. The dilution resulting in 5–50 colonies was selected to calculate CFU per ml using the formula CFU per ml = Average colony number × 50 × dilution factor. Bacterial counts were logarithmically transformed (logCFU per ml) for the subsequent statistical analysis. All experiments were carried out with technical replicates on three independent occasions, hence, n = 3 biological replicates.

Statistical analysis

Statistical analysis was performed using Statistical Analysis Software (SAS) 9.4 (SAS Institute, Cary, NC, USA). All data were initially tested for normality using PROC UNIVARIATE procedure.
Batch fermentation assay. To determine the robustness of the assay over time, the bacterial counts of selected bacterial groups in the untreated control flasks (n = 9) were analysed by repeated measures analysis using the PROC MIXED procedure42 with the fixed effect of time (0, 10 and 24 h). The bacterial counts of selected bacterial groups and SCFA concentrations at 10 and 24 h were analysed using PROC GLM procedure. The model assessed the effect of the compound concentration with the experimental unit being the biological replicate. 0 h was used as a covariate.
Pure culture growth assay. The bacterial counts from the pure culture growth assays were analysed using PROC GLM procedure for the presence of linear and quadratic effects of concentration for each compound. The biological replicate was the experimental unit. The LSMEANS statement was additionally used to calculate the least-square means and the standard error of the means (SEM).

Probability values of P < 0.05 denote statistical significance, whereas probability values between 0.05 and 0.1 are considered numerical tendencies. Results are presented as least-square means ± SEM.

Results

Evaluation of the robustness of the batch fermentation assay

The ability of the batch fermentation assay to maintain a complex faecal bacterial community was evaluated by determining the changes in the counts of the selected bacterial groups in the untreated control tubes (0 mg ml−1) at the different time points, presented in Table 2. The counts of total bacteria initially decreased at 10 h before increasing at 24 h (P < 0.05). The counts of lactobacilli increased to the greatest extent at 10 h (P < 0.05). The counts of bifidobacteria increased predominantly at 24 h (P < 0.05). The counts of Enterobacteriaceae increased at 10 h solely (P < 0.05). The counts of Prevotella spp. decreased predominantly at 10 h (P < 0.05).
Table 2 Effect of time on the log transformed gene copy number per g faeces of the different bacterial groups (Least-square means with their standard errors)
Bacterial group (logGCN per g faeces) Time SEM P-Value
0 h 10 h 24 h Time effect
logGCN per g faeces, log transformed gene copy number per gram of faeces. a,b,cMean values within a row with different superscript letter were significantly different (P < 0.05).
Total bacteria 9.24b 8.99a 9.70c 0.085 <0.001
Lactobacilli 8.20a 8.42b 8.55c 0.060 <0.001
Bifidobacteria 6.11a 6.21b 6.53c 0.053 <0.001
Enterobacteriaceae 6.93a 8.01b 8.11b 0.048 <0.001
Prevotella spp. 8.82c 7.87b 7.75a 0.057 <0.001


Effects of casein hydrolysates and YBG on the selected faecal bacterial populations

The effects of the different concentrations of CH, 5kDaR and YBG on the selected bacterial populations in the batch fermentation assay are presented in Table 3.
Table 3 Effects of CH, 5kDaR and YBG on the log transformed gene copy number per g faeces of selected bacterial groups at 10 and 24 h in the batch fermentation assay (Least-square means with their standard errors)
Compound Sampling point Bacterial group (logGCN per g faeces) Compound concentration (mg ml−1) SEM P-Value
0 1 2.5 5
logGCN per g faeces, log transformed gene copy number per gram of faeces. a,b,cMean values within a row with different superscript letter were significantly different (P < 0.05).
CH 10 h Total bacteria 8.93 9.10 9.16 9.06 0.158 0.772
Lactobacilli 8.39 8.53 8.70 8.69 0.074 0.061
Bifidobacteria 6.18 6.16 6.24 6.12 0.053 0.528
Enterobacteriaceae 8.00 8.07 8.19 8.11 0.061 0.222
Prevotella spp. 7.99 8.08 8.17 8.05 0.047 0.134
24 h Total bacteria 9.83 9.85 9.94 9.95 0.047 0.242
Lactobacilli 8.65 8.60 8.73 8.67 0.051 0.399
Bifidobacteria 6.65 6.65 6.61 6.55 0.034 0.211
Enterobacteriaceae 8.16 8.09 8.21 8.17 0.046 0.427
Prevotella spp. 7.96 7.84 7.94 7.87 0.049 0.355
5kDaR 10 h Total bacteria 8.73 8.77 8.49 9.05 0.151 0.169
Lactobacilli 8.44a 8.52a 8.47a 8.75b 0.058 0.028
Bifidobacteria 6.32 6.41 6.43 6.43 0.033 0.113
Enterobacteriaceae 7.92 7.99 8.01 8.12 0.071 0.333
Prevotella spp. 7.81 7.87 7.85 7.97 0.045 0.150
24 h Total bacteria 9.54a 9.76b 9.83b 9.88b 0.061 0.022
Lactobacilli 8.58 8.64 8.61 8.72 0.039 0.148
Bifidobacteria 6.60 6.70 6.67 6.68 0.032 0.231
Enterobacteriaceae 7.96 7.94 8.02 8.05 0.048 0.424
Prevotella spp. 7.68 7.73 7.73 7.75 0.054 0.810
YBG 10 h Total bacteria 9.34 8.80 8.91 9.05 0.121 0.072
Lactobacilli 8.42 8.33 8.24 8.31 0.087 0.561
Bifidobacteria 6.14 6.01 5.90 5.79 0.090 0.118
Enterobacteriaceae 8.14 7.97 8.04 8.06 0.044 0.143
Prevotella spp. 7.82c 7.66bc 7.58ab 7.42a 0.053 0.006
24 h Total bacteria 9.74 9.69 9.75 9.56 0.129 0.737
Lactobacilli 8.44 8.45 8.36 8.36 0.086 0.802
Bifidobacteria 6.36 6.27 6.19 6.04 0.081 0.116
Enterobacteriaceae 8.23 7.87 7.98 8.07 0.079 0.072
Prevotella spp. 7.61b 7.41ab 7.38a 7.22a 0.071 0.038


CH. CH had no effect on the counts of total bacteria, lactobacilli, bifidobacteria, Enterobacteriaceae and Prevotella spp. at all tested concentrations and time points (P > 0.05).
5kDaR. There was no effect of any 5kDaR concentration on total bacterial counts at 10 h (P > 0.05), however, these were increased at all 5kDaR concentrations at 24 h compared to the control (P < 0.05). There was an increase in lactobacilli counts at 5 mg ml−1 at 10 h compared to the control (P < 0.05), however, no effects were observed at all tested concentrations at 24 h (P > 0.05). 5kDaR had no effect on the counts of bifidobacteria, Enterobacteriaceae and Prevotella spp. at all tested concentrations and time points (P > 0.05).
YBG. There was a decrease in Prevotella spp. counts at 2.5 and 5 mg ml−1 at both time points compared to the control (P < 0.05). YBG had no effect on the counts of total bacteria, lactobacilli, bifidobacteria and Enterobacteriaceae at all tested concentrations and time points (P > 0.05).

Effects of casein hydrolysates and YBG on SCFA production

The effects of the different concentrations of CH, 5kDaR and YBG on the SCFA production in the batch fermentation assay are presented in Table 4.
Table 4 Effects of CH, 5kDaR and YBG on the SCFA profile at 10 and 24 h in the batch fermentation assay (Least-square means with their standard errors)
Compound Sampling point SCFA (mmol per lit) Compound concentration (mg ml−1) SEM P-Value
0 1 2.5 5
SCFA, short-chain fatty acids. a,bMean values within a row with different superscript letter were significantly different (P < 0.05).
CH 10 h Acetate 27.71 26.93 36.18 21.23 9.602 0.785
Butyrate 0.79 0.37 1.01 0.90 0.423 0.083
Propionate 0.35 0.51 1.22 0.40 0.761 0.924
Total SCFA 28.14 28.75 40.82 21.97 11.372 0.768
24 h Acetate 25.35 24.85 28.46 27.63 1.581 0.436
Butyrate 0.33a 2.20b 1.89b 1.63b 0.227 0.032
Propionate 0.38 0.47 0.55 0.49 0.154 0.893
Total SCFA 26.58 28.46 31.75 30.15 1.599 0.302
5kDaR 10 h Acetate 24.17 22.14 22.80 21.40 2.915 0.918
Butyrate 0.49 0.34 0.35 0.41 0.072 0.489
Propionate 0.30 0.29 0.28 0.22 0.054 0.739
Total SCFA 25.32 23.13 23.79 22.38 3.106 0.919
24 h Acetate 24.57 24.39 26.86 21.74 4.303 0.886
Butyrate 0.37a 1.41b 1.46b 0.82a 0.160 0.006
Propionate 0.34 0.42 0.46 0.35 0.054 0.365
Total SCFA 25.68 27.07 29.15 23.14 4.399 0.827
YBG 10 h Acetate 27.49 24.09 22.89 24.15 1.488 0.242
Butyrate 0.71b 0.40a 0.41a 0.51ab 0.068 0.046
Propionate 0.73 0.49 0.49 0.57 0.211 0.823
Total SCFA 29.75 25.41 24.29 25.82 1.682 0.203
24 h Acetate 26.39 25.07 23.35 24.44 0.889 0.197
Butyrate 1.38 1.38 1.33 1.19 0.056 0.147
Propionate 0.66 0.57 0.51 0.54 0.032 0.061
Total SCFA 28.88 27.44 25.53 26.54 0.988 0.192


CH. There was no effect of any CH concentration at 10 h (P > 0.05), however, butyrate concentration was increased at all CH concentrations at 24 h compared to the control (P < 0.05). CH had no effect on total SCFA, acetate and propionate production at all tested concentrations and time points (P > 0.05).
5kDaR. There was no effect of any 5kDaR concentration at 10 h (P > 0.05), however, butyrate concentration was increased at 1 and 2.5 mg ml−1 at 24 h compared to the control (P < 0.05). 5kDaR had no effect on total SCFA, acetate and propionate production at all tested concentrations and time points (P > 0.05).
YBG. There was a decrease in butyrate concentration at 1 and 2.5 mg ml−1 at 10 h compared to the control (P < 0.05). Butyrate concentration was numerically reduced at 5 mg ml−1 at 10 h compared to the control (P = 0.074). However, no effects on butyrate production were observed at all tested concentrations at 24 h (P > 0.05). YBG had no effect on total SCFA, propionate and acetate production at all tested concentrations and time points (P > 0.05).

Stimulatory and antibacterial properties of casein hydrolysates and YBG in pure bacterial cultures

The effects of the increasing concentrations of CH, 5kDaR and YBG on the growth of a panel of selected beneficial (L. plantarum, L. reuteri, B. thermophilum) and pathogenic (ETEC, S. typhimurium) bacterial strains were evaluated in the pure culture growth assays and are presented in Table 5.
Table 5 Bacterial counts following exposure to increasing concentrations of CH, 5kDaR and YBG in the pure culture growth assays (Least-square means with their standard errors)
Compound Bacterial strain Final bacterial concentration (logCFU per ml) SEM P-Value
0 mg ml−1 0.25 mg ml−1 0.5 mg ml−1 1 mg ml−1 2 mg ml−1 Linear effect Quadratic effect
CFU, colony-forming unit.
CH L. plantarum 7.88 8.04 7.96 8.09 8.21 0.066 0.001 0.500
L. reuteri 7.72 7.64 7.70 7.49 7.67 0.079 0.417 0.088
B. thermophilum 6.43 6.57 6.58 6.60 6.79 0.204 0.127 0.852
ETEC 8.55 8.67 8.61 8.42 8.72 0.085 0.440 0.166
S. typhimurium 8.92 8.86 9.08 9.03 9.15 0.050 0.002 0.533
5kDaR L. plantarum 7.67 7.91 7.86 8.19 8.45 0.079 <0.001 0.896
L. reuteri 7.02 7.62 7.70 7.61 7.70 0.108 0.011 0.049
B. thermophilum 7.00 7.27 7.31 7.41 7.88 0.127 <0.001 0.877
ETEC 8.78 8.65 8.65 8.68 8.71 0.077 0.984 0.354
S. typhimurium 9.30 8.80 8.77 8.68 8.73 0.194 0.017 0.058
YBG L. plantarum 7.18 7.29 7.46 7.58 7.50 0.107 0.008 0.041
L. reuteri 7.08 7.48 7.60 7.58 7.37 0.204 0.027 0.041
B. thermophilum 6.44 6.73 6.60 6.38 6.26 0.387 0.330 0.877
ETEC 8.67 8.46 8.40 8.37 8.58 0.060 <0.001 0.001
S. typhimurium 8.87 9.00 8.97 8.91 9.00 0.075 0.863 0.629


CH. There was a linear increase in the counts of L. plantarum and S. typhimurium in response to the increasing CH concentrations (P < 0.05). CH did not have any effect on the counts of L. reuteri, B. thermophilum and ETEC at all concentrations tested (P > 0.05).
5kDaR. There was a beneficial linear increase in the counts of L. plantarum and B. thermophilum in response to the increasing 5kDaR concentrations (P < 0.05). There was a beneficial quadratic effect of the increasing 5kDaR concentrations observed in L. reuteri with maximum counts observed at 0.25 mg ml−1 (P < 0.05). There was a beneficial quadratic effect of the increasing 5kDaR concentrations observed in S. typhimurium, with lowest counts observed at 1 mg ml−1 (P < 0.05). 5kDaR had no effect on the ETEC counts at all concentrations tested (P > 0.05).
YBG. There was a quadratic effect of the increasing YBG concentration in L. plantarum, L. reuteri and ETEC counts (P < 0.05). The inclusion of 1 mg ml−1 was identified as the optimal concentration to stimulate the growth of L. plantarum and L. reuteri counts, while decreasing ETEC counts. YBG had no effect on the counts of B. thermophilum or S. typhimurium at all concentrations tested (P > 0.05).

Discussion

Gastrointestinal dysbiosis is associated with compromised health in both animals and humans. Dietary supplementation with natural bioactives may contribute to the maintenance of a healthy gastrointestinal microbiota by stimulating beneficial bacterial populations such as lactobacilli and bifidobacteria or by inhibiting pathogen overgrowth. Previous research identified 5kDaR and YBG as potential natural dietary supplements for weaned pigs.29 Hence, the main objective of this study was to identify the direct effects of the 5kDaR and YBG on key bacterial populations and species in the gut. As the production of 5kDaR from the parent CH is expensive, the potential of CH to be used as a comparable substitute to 5kDaR was also investigated in this study.

The fermentation conditions used in this study supported the growth of the targeted bacterial groups and maintained a relatively complex microbial community. Batch fermentation is a well-recognised screening assay for the in vitro evaluation of the direct effects of the tested compounds on the faecal microbiota.33,43 The reductions in bacterial counts of total bacteria and Prevotella spp. between 0 and 10 h are most likely due to the loss of viable bacteria caused by freezing and thawing of the faeces. QPCR does not differentiate between live and dead cells resulting in higher bacterial counts at 0 h.44 Consequently, the 0 h time point represents a screenshot of the pooled faecal microbiota of the sampled animals and an overestimation of the viable counts of each bacterial group in the batch fermentation assay, whereas the 10 h time point represents the surviving faecal microbiota adapted to the new environment and treatments. Finally, the growth-stimulating effects of the different tested compounds most likely resulted in a more rapid depletion of nutrients and accumulation of toxic metabolites, common characteristics of the closed and uncontrolled environment of the batch fermentation assay,43 which probably explain the lack of any further effect in some instances (e.g. 5kDaR increased lactobacilli at 10 h but not at 24 h.

The total bacteria as well as the lactobacilli and bifidobacteria that contribute significantly to the gastrointestinal health and growth of the host2,4,5,45,46 were among the bacterial groups measured in the batch fermentation assay. The Enterobacteriaceae family was also included in this study as it is considered a reliable marker of a dysbiotic microbiota and intestinal dysfunction that contribute to the development of gastrointestinal and metabolic disorders and diseases in humans and pigs.14,47,48 Of the three compounds tested, 5kDaR increased the counts of total bacteria and lactobacilli with no effect on bifidobacteria and Enterobacteriaceae counts, while CH and YBG had no major effects on these bacterial populations. The ability of 5kDaR to stimulate lactobacilli growth within a complex microbial community was in agreement with previous studies in which the ileal and colonic counts of this bacterial population were increased in weaned and growing pigs supplemented with casein-derived peptides.49,50

An additional bacterial group that was measured in the batch fermentation assay was Prevotella spp. which is the predominant genus in weaned pigs.51,52 The Prevotella-dominant enterotype-like group in pigs is associated with increased body weight and average daily gain, which is attributed to better energy gain from the plant-based diet.6 A Prevotella dominant enterotype is also present in humans and is associated with a healthier diet (high fibre/low fat); however, the role of the different species and strains of this genus in human health and disease is controversial.53 The addition of 5kDaR and CH had no effect on Prevotella spp. counts, whereas YBG reduced its counts. Despite being saccharolytic bacteria, variation in the repertoire of polysaccharide-degrading enzymes exist among the different Prevotella spp. members.8,54 This might lead to a limited ability to utilise YBG as observed for oat β-glucan55 and, consequently, to the need to compete for nutrients with other members of the faecal microbiota, thus explaining the reduced counts.

Acetate, propionate and butyrate are the major SCFA with many health benefits to the host produced during the microbial fermentation that takes place in the GIT.56,57 Butyrate, in particular, is the major energy source for colonocytes and its absence is associated with energetic stress and autophagy, which is observed in the colonic epithelium of germ-free mice.58 Furthermore, butyrate, as a histone deacetylase inhibitor, interferes with the expression of pro-inflammatory cytokines exerting anti-inflammatory activity in mice and suckling pigs.59,60 The addition of 5kDaR and CH increased butyrate concentration. Dietary supplementation of weaned and growing pigs with casein-derived peptides was also associated with an increase in butyrate production.49,50 YBG, contrarily, decreased butyrate concentration. This is probably linked with the reduction of certain members of the microbiota due to YBG supplementation. Prevotella genus, for instance, has previously been correlated with increased butyrate production,61 most likely via bacterial cross-feeding interactions.

It was indicated that these bioactives affect the faecal microbiota in the batch fermentation assay. Thus, the direct effects of these compounds on the growth of selected Lactobacillus spp. and Bifidobacterium spp. strains with known benefits to human and animal health were evaluated. Human and pig isolates of L. plantarum, L. reuteri and B. thermophilum confer colonisation resistance against various intestinal pathogens including S. typhimurium and pathogenic E. coli strains and reduce disease incidence through competitive exclusion and the production of organic acids and bacteriocins.62–74 These strains have also been associated with beneficial changes in the composition of the microbiota, immunomodulation and maintenance of intestinal integrity.70,75–79 The addition of 5kDaR had the most pronounced effect, as it increased B. thermophilum and both Lactobacillus spp. strains consistent with the results from the batch fermentation assay. Thus, 5kDaR seems to be capable of directly stimulating the growth of health-promoting genera in the mammalian gut. CH solely increased L. plantarum, indicating variability within the lactobacilli population with regard to utilising this compound. Casein-derived and cheese-originating peptides have previously been shown to enhance the growth of various members of the Lactobacillus and Bifidobacterium genera which is in agreement with the observations of this study.23,25,26 YBG slightly increased L. plantarum and L. reuteri counts with no effect on B. thermophilum counts. The absence of any effect of YBG on B. thermophilum counts might be attributed to the inability of this bacterium to utilise this polysaccharide.80

The pathogens that were included in the pure culture growth assays of this study were S. typhimurium and ETEC O149 of the Enterobacteriaceae family. S. typhimurium causes foodborne disease in humans, with pigs and their meat products being the major source of human infection.81 Most pigs are asymptomatic carriers of S. typhimurium; however, in immunocompromised animals such weaned pigs, S. typhimurium infection can cause intestinal disease.81,82 The pathogenic strain, ETEC O149, is the predominant cause of post-weaning diarrhoea in weaned pigs characterised by increased mortality, diarrhoea and stunted growth.83 The addition of 5kDaR inhibited S. typhimurium growth. A casein-derived peptide with antibacterial activity against S. typhimurium has been identified previously.21 Most milk-derived peptides exert their antibacterial activity by interfering with the functionality and permeability of the bacterial cell membrane.84 YBG led to a slight reduction of the ETEC counts. The potential of dietary YBG supplementation to control ETEC infection in weaned pigs has been reported previously.85 However, the lower faecal ETEC counts and reduced duration and severity of diarrhoea observed in that study were attributed to a more controlled inflammatory response primed by the YBG supplementation, rather than the direct effect indicated in this study.85,86

Despite the beneficial properties of 5kDaR that have been identified in this and previous studies,29–31 the production of this compound is expensive. The parent CH was considered as a potential alternative; however, it had no or less pronounced effects on the various bacterial populations and strains that were included in the assays of this study. Butyrate concentration was the only exception as CH stimulated its production to a greater extent compared to 5kDaR.

Conclusions

The addition of 5kDaR in the batch fermentation and pure culture growth assays was consistently associated with increases in beneficial bacterial groups such as lactobacilli and B. thermophilum and a reduction in S. typhimurium. 5kDaR also stimulated the production of butyrate in the batch fermentation assay, a major energy source and immunomodulatory molecule of the intestinal epithelium. The findings of this study provide additional information regarding the mode of action of this bioactive within the gastrointestinal environment. Therefore, further in vivo nutritional studies are required on the 5kDaR potential to alleviate the negative impact of inflammatory diseases and disorders on the composition and metabolism of the mammalian gastrointestinal microbiota such as the weaning stress in pigs.

A major drawback of the 5kDaR is that it requires an expensive production process that could be overcome via the use of the parent CH. In this study, CH stimulated butyrate production. Despite CH being a less effective bioactive than 5kDaR in these in vitro studies, its digestion during the transit from the upper GIT could result in the release of the more effective 5kDaR. Thus, further research should be considered regarding the use of CH as a dietary supplement.

Author contributions

Conceptualization, T. S. and J. V. O'D.; methodology, B. V., M. J. M., A. M., M. R. and T. S.; formal analysis, B. V. and J. V. O'D.; investigation, B. V. and C. K.; data curation, B. V.; writing—original draft preparation, B. V.; writing—review and editing, B. V., J. V. O'D, M. J. M., A. M., C. K., M. R. and T. S.; funding acquisition, T. S. and J. V. O'D. All authors have read and agreed to the published version of the manuscript.

Conflicts of interest

There are no conflicts to declare.

Acknowledgements

This research was supported by Food for Health Ireland project funded by Enterprise Ireland, grant number CC200800001 and by Science Foundation Ireland, grant number 14/IA/2548. The authors acknowledge the contribution of the laboratory staff in Lyons Research Farm and the School of Veterinary Medicine at University College Dublin and thank Áine O'Doherty from the Pathology Division, Central Veterinary Research laboratory, DAFM-Laboratories Backweston, Co. Kildare, Ireland for kindly providing us with the ETEC O149 bacterial strain.

References

  1. I. Sekirov, S. L. Russell, L. C. Antunes and B. B. Finlay, Gut microbiota in health and disease, Physiol. Rev., 2010, 90, 859–904 CrossRef CAS.
  2. S. Lebeer, J. Vanderleyden and S. C. De Keersmaecker, Genes and molecules of lactobacilli supporting probiotic action, Microbiol. Mol. Biol. Rev., 2008, 72, 728–764 CrossRef CAS.
  3. Z. Sun, H. M. Harris, A. McCann, C. Guo, S. Argimon, W. Zhang, X. Yang, I. B. Jeffery, J. C. Cooney, T. F. Kagawa, W. Liu, Y. Song, E. Salvetti, A. Wrobel, P. Rasinkangas, J. Parkhill, M. C. Rea, O. O’Sullivan, J. Ritari, F. P. Douillard, R. P. Ross, R. Yang, A. E. Briner, G. E. Felis, W. M. de Vos, R. Barrangou, T. R. Klaenhammer, P. W. Caufield, Y. Cui, H. Zhang and P. W. O’Toole, Expanding the biotechnology potential of lactobacilli through comparative genomics of 213 strains and associated genera, Nat. Commun., 2015, 6, 8322 CrossRef CAS.
  4. A. O'Callaghan and D. van Sinderen, Bifidobacteria and their role as members of the human gut microbiota, Front. Microbiol., 2016, 7, 925 Search PubMed.
  5. A. Sarkar and S. Mandal, Bifidobacteria-Insight into clinical outcomes and mechanisms of its probiotic action, Microbiol. Res., 2016, 192, 159–171 CrossRef.
  6. Y. Ramayo-Caldas, N. Mach, P. Lepage, F. Levenez, C. Denis, G. Lemonnier, J. J. Leplat, Y. Billon, M. Berri, J. Dore, C. Rogel-Gaillard and J. Estelle, Phylogenetic network analysis applied to pig gut microbiota identifies an ecosystem structure linked with growth traits, ISME J., 2016, 10, 2973–2977 CrossRef.
  7. T. Chen, W. Long, C. Zhang, S. Liu, L. Zhao and B. R. Hamaker, Fiber-utilizing capacity varies in Prevotella- versus Bacteroides-dominated gut microbiota, Sci. Rep., 2017, 7, 2594 CrossRef.
  8. T. Accetto and G. Avgustin, The diverse and extensive plant polysaccharide degradative apparatuses of the rumen and hindgut Prevotella species: A factor in their ubiquity?, Syst. Appl. Microbiol., 2019, 42, 107–116 CrossRef CAS.
  9. M. A. Croxen, R. J. Law, R. Scholz, K. M. Keeney, M. Wlodarska and B. B. Finlay, Recent advances in understanding enteric pathogenic Escherichia coli, Clin. Microbiol. Rev., 2013, 26, 822–880 CrossRef CAS.
  10. O. Gal-Mor, E. C. Boyle and G. A. Grassl, Same species, different diseases: how and why typhoidal and non-typhoidal Salmonella enterica serovars differ, Front. Microbiol., 2014, 5, 391 Search PubMed.
  11. H. B. Kim and R. E. Isaacson, Salmonella in swine: Microbiota interactions, Annu. Rev. Anim. Biosci., 2017, 5, 43–63 CrossRef.
  12. I. Garcia-Menino, V. Garcia, A. Mora, D. Diaz-Jimenez, S. C. Flament-Simon, M. P. Alonso, J. E. Blanco, M. Blanco and J. Blanco, Swine Enteric Colibacillosis in Spain: Pathogenic Potential of mcr-1 ST10 and ST131 E. coli Isolates, Front. Microbiol., 2018, 9, 2659 CrossRef.
  13. A. K. DeGruttola, D. Low, A. Mizoguchi and E. Mizoguchi, Current understanding of dysbiosis in disease in human and animal models, Inflammatory Bowel Dis., 2016, 22, 1137–1150 CrossRef.
  14. R. Gresse, F. Chaucheyras-Durand, M. A. Fleury, T. Van de Wiele, E. Forano and S. Blanquet-Diot, Gut microbiota dysbiosis in postweaning piglets: Understanding the keys to health, Trends Microbiol., 2017, 25, 851–873 CrossRef CAS.
  15. E. Haque and R. Chand, Antihypertensive and antimicrobial bioactive peptides from milk proteins, Eur. Food Res. Technol., 2007, 227, 7–15 CrossRef.
  16. O. Power, P. Jakeman and R. J. FitzGerald, Antioxidative peptides: enzymatic production, in vitro and in vivo antioxidant activity and potential applications of milk-derived antioxidative peptides, Amino Acids, 2013, 44, 797–820 CrossRef CAS.
  17. G. A. Biziulevicius, O. V. Kislukhina, J. Kazlauskaite and V. Zukaite, Food-protein enzymatic hydrolysates possess both antimicrobial and immunostimulatory activities: a “cause and effect” theory of bifunctionality, FEMS Immunol. Med. Microbiol., 2006, 46, 131–138 CrossRef CAS.
  18. S. F. Gauthier, Y. Pouliot and D. Saint-Sauveur, Immunomodulatory peptides obtained by the enzymatic hydrolysis of whey proteins, Int. Dairy J., 2006, 16, 1315–1323 CrossRef CAS.
  19. A. Mukhopadhya and T. Sweeney, in Milk Proteins: From Structure to Biological Properties and Health Aspects, ed. I. Gigli, IntechOpen, 2016, ch. 5, pp. 83–100,  DOI:10.5772/63509.
  20. I. López-Expósito, F. Minervini, L. Amigo and I. Recio, Identification of antibacterial peptides from bovine κ-casein, J. Food Prot., 2006, 69, 2992–2997 CrossRef.
  21. K. B. McCann, B. J. Shiell, W. P. Michalski, A. Lee, J. Wan, H. Roginski and M. J. Coventry, Isolation and characterisation of a novel antibacterial peptide from bovine αS1-casein, Int. Dairy J., 2006, 16, 316–323 CrossRef CAS.
  22. I. López-Expósito, A. Quirós, L. Amigo and I. Recio, Casein hydrolysates as a source of antimicrobial, antioxidant and antihypertensive peptides, Le Lait, 2007, 87, 241–249 CrossRef.
  23. G. Robitaille, C. Lapointe, D. Leclerc and M. Britten, Effect of pepsin-treated bovine and goat caseinomacropeptide on Escherichia coli and Lactobacillus rhamnosus in acidic conditions, J. Dairy Sci., 2012, 95, 1–8 CrossRef CAS.
  24. K. Berding, M. Wang, M. H. Monaco, L. S. Alexander, A. T. Mudd, M. Chichlowski, R. V. Waworuntu, B. M. Berg, M. J. Miller, R. N. Dilger and S. M. Donovan, Prebiotics and bioactive milk fractions affect gut development, microbiota, and neurotransmitter expression in piglets, J. Pediatr. Gastroenterol. Nutr., 2016, 63, 688–697 CrossRef CAS.
  25. M. Poch and A. Bezkorovainy, Bovine milk κ-casein trypsin digest is a growth enhancer for the genus Bifidobacterium, J. Agric. Food Chem., 1991, 39, 73–77 CrossRef CAS.
  26. B. Bottari, A. Quartieri, B. Prandi, S. Raimondi, A. Leonardi, M. Rossi, A. Ulrici, M. Gatti, S. Sforza, M. Nocetti and A. Amaretti, Characterization of the peptide fraction from digested Parmigiano Reggiano cheese and its effect on growth of lactobacilli and bifidobacteria, Int. J. Food Microbiol., 2017, 255, 32–41 CrossRef CAS.
  27. T. Sweeney, C. B. Collins, P. Reilly, K. M. Pierce, M. Ryan and J. V. O'Doherty, Effect of purified beta-glucans derived from Laminaria digitata, Laminaria hyperborea and Saccharomyces cerevisiae on piglet performance, selected bacterial populations, volatile fatty acids and pro-inflammatory cytokines in the gastrointestinal tract of pigs, Br. J. Nutr., 2012, 108, 1226–1234 CrossRef CAS.
  28. P. De Oliva-Neto, S. S. Oliveira, E. Zilioli and M. Zilioli Bellini, in Probiotics and prebiotics in human nutrition and health, eds. V. Rao and L. Rao, IntechOpen, 2016, ch. 16, pp. 331–344,  DOI:10.5772/63647.
  29. A. Mukhopadhya, J. V. O'Doherty and T. Sweeney, A combination of yeast beta-glucan and milk hydrolysate is a suitable alternative to zinc oxide in the race to alleviate post-weaning diarrhoea in piglets, Sci. Rep., 2019, 9, 616 CrossRef.
  30. A. Mukhopadhya, N. Noronha, B. Bahar, M. T. Ryan, B. A. Murray, P. M. Kelly, I. B. O'Loughlin, J. V. O'Doherty and T. Sweeney, Anti-inflammatory effects of a casein hydrolysate and its peptide-enriched fractions on TNFalpha-challenged Caco-2 cells and LPS-challenged porcine colonic explants, Food Sci. Nutr., 2014, 2, 712–723 CrossRef CAS.
  31. A. Mukhopadhya, N. Noronha, B. Bahar, M. T. Ryan, B. A. Murray, P. M. Kelly, I. B. O'Loughlin, J. V. O'Doherty and T. Sweeney, The anti-inflammatory potential of a moderately hydrolysed casein and its 5 kDa fraction in in vitro and ex vivo models of the gastrointestinal tract, Food Funct., 2015, 6, 612–621 RSC.
  32. G. R. Gibson, H. M. Probert, J. V. Loo, R. A. Rastall and M. B. Roberfroid, Dietary modulation of the human colonic microbiota: updating the concept of prebiotics, Nutr. Res. Rev., 2004, 17, 259–275 CrossRef CAS.
  33. K. Venema and P. van den Abbeele, Experimental models of the gut microbiome, Best Pract. Res., Clin. Gastroenterol., 2013, 27, 115–126 CrossRef CAS.
  34. T. H. T. Tran, C. Boudry, N. Everaert and J. Bindelle, Prebiotic potential of novel carbohydrates in an in vitro co-inoculation fermentation model of the bacteria isolated from pig intestine and Salmonella, J. Anim. Sci., 2016, 94, 58–61 CrossRef CAS.
  35. M. Rossi, C. Corradini, A. Amaretti, M. Nicolini, A. Pompei, S. Zanoni and D. Matteuzzi, Fermentation of fructooligosaccharides and inulin by bifidobacteria: a comparative study of pure and fecal cultures, Appl. Environ. Microbiol., 2005, 71, 6150–6158 CrossRef CAS.
  36. K. M. Pierce, T. Sweeney, P. O. Brophy, J. J. Callan, E. Fitzpatrick, P. McCarthy and J. V. O'Doherty, The effect of lactose and inulin on intestinal morphology, selected microbial populations and volatile fatty acid concentrations in the gastro-intestinal tract of the weanling pig, Anim. Sci., 2006, 82, 311–218 CrossRef CAS.
  37. T. Sweeney, S. Dillon, J. Fanning, J. Egan, C. J. O'Shea, S. Figat, J. J. M. Gutierrez, C. Mannion, F. Leonard and J. V. O'Doherty, Evaluation of seaweed-derived polysaccharides on indices of gastrointestinal fermentation and selected populations of microbiota in newly weaned pigs challenged with Salmonella Typhimurium, Anim. Feed Sci. Technol., 2011, 165, 85–94 CrossRef CAS.
  38. P. Kontula, A. von Wright and T. Mattila-Sandholm, Oat bran b-gluco- and xylo-oligosaccharides as fermentative substrates for lactic acid bacteria, Int. J. Food Microbiol., 1998, 45, 163–169 CrossRef CAS.
  39. H. Kaplan and R. W. Hutkins, Fermentation of fructooligosaccharides by lactic acid bacteria and bifidobacteria, Appl. Environ. Microbiol., 2000, 66, 2682–2684 CrossRef CAS.
  40. R. Crittenden, S. Karppinen, S. Ojanen, M. Tenkanen, R. Fagerström, J. Mättö, M. Saarela, T. Mattila-Sandholm and K. Poutanen, In vitro fermentation of cereal dietary fibre carbohydrates by probiotic and intestinal bacteria, J. Sci. Food Agric., 2002, 82, 781–789 CrossRef CAS.
  41. A. A. Miles, S. S. Misra and J. O. Irwin, The estimation of the bactericidal power of the blood, J. Hyg., 1938, 38, 732–749 CAS.
  42. R. C. Littell, G. A. Milliken, W. W. Stroup, R. D. Wolfinger and O. Schabenberger, SAS for Mixed Models, SAS Publishing, 2nd edn, 2006 Search PubMed.
  43. A. N. Payne, A. Zihler, C. Chassard and C. Lacroix, Advances and perspectives in in vitro human gut fermentation modeling, Trends Biotechnol., 2012, 30, 17–25 CrossRef CAS.
  44. K. Rudi, B. Moen, S. M. Dromtorp and A. L. Holck, Use of ethidium monoazide and PCR in combination for quantification of viable and dead cells in complex samples, Appl. Environ. Microbiol., 2005, 71, 1018–1024 CrossRef CAS.
  45. A. L. Servin, Antagonistic activities of lactobacilli and bifidobacteria against microbial pathogens, FEMS Microbiol. Rev., 2004, 28, 405–440 CrossRef CAS.
  46. V. D. Valeriano, M. P. Balolong and D. K. Kang, Probiotic roles of Lactobacillus sp. in swine: insights from gut microbiota, J. Appl. Microbiol., 2017, 122, 554–567 CrossRef CAS.
  47. N. R. Shin, T. W. Whon and J. W. Bae, Proteobacteria: microbial signature of dysbiosis in gut microbiota, Trends Biotechnol., 2015, 33, 496–503 CrossRef CAS.
  48. Y. Litvak, M. X. Byndloss, R. M. Tsolis and A. J. Baumler, Dysbiotic Proteobacteria expansion: a microbial signature of epithelial dysfunction, Curr. Opin. Microbiol., 2017, 39, 1–6 CrossRef CAS.
  49. R. Gustavo Hermes, F. Molist, J. Francisco Perez, A. Gomez de Segura, M. Ywazaki, R. Davin, M. Nofrarias, T. K. Korhonen, R. Virkola and S. M. Martin-Orue, Casein glycomacropeptide in the diet may reduce Escherichia coli attachment to the intestinal mucosa and increase the intestinal lactobacilli of early weaned piglets after an enterotoxigenic E. coli K88 challenge, Br. J. Nutr., 2013, 109, 1001–1012 CrossRef CAS.
  50. H. Wang, J. Shen, Y. Pi, K. Gao and W. Zhu, Low-protein diets supplemented with casein hydrolysate favor the microbiota and enhance the mucosal humoral immunity in the colon of pigs, J. Anim. Sci. Biotechnol., 2019, 10, 79 CrossRef.
  51. E. A. B. Pajarillo, J.-P. Chae, M. P. Balolong, H. B. Kim and D.-K. Kang, Assessment of fecal bacterial diversity among healthy piglets during the weaning transition, J. Gen. Appl. Microbiol., 2014, 60, 140–146 CrossRef CAS.
  52. L. Chen, Y. Xu, X. Chen, C. Fang, L. Zhao and F. Chen, The maturing development of gut microbiota in commercial piglets during the weaning transition, Front. Microbiol., 2017, 8, 1688 CrossRef.
  53. G. Precup and D. C. Vodnar, Gut Prevotella as a possible biomarker of diet and its eubiotic versus dysbiotic roles: a comprehensive literature review, Br. J. Nutr., 2019, 122, 131–140 CrossRef CAS.
  54. J. Purushe, D. E. Fouts, M. Morrison, B. A. White, R. I. Mackie, North American Consortium for Rumen Bacteria, P. M. Coutinho, B. Henrissat and K. E. Nelson, Comparative genome analysis of Prevotella ruminicola and Prevotella bryantii: insights into their environmental niche, Microb. Ecol., 2010, 60, 721–729 CrossRef.
  55. E. L. Emerson and P. J. Weimer, Fermentation of model hemicelluloses by Prevotella strains and Butyrivibrio fibrisolvens in pure culture and in ruminal enrichment cultures, Appl. Microbiol. Biotechnol., 2017, 101, 4269–4278 CrossRef CAS.
  56. C. C. Roy, C. L. Kien, L. Bouthillier and E. Levy, Short-Chain Fatty Acids: Ready for Prime Time?, Nutr. Clin. Pract., 2006, 21, 351–366 CrossRef.
  57. W. R. Russell, L. Hoyles, H. J. Flint and M. E. Dumas, Colonic bacterial metabolites and human health, Curr. Opin. Microbiol., 2013, 16, 246–254 CrossRef CAS.
  58. D. R. Donohoe, N. Garge, X. Zhang, W. Sun, T. M. O'Connell, M. K. Bunger and S. J. Bultman, The microbiome and butyrate regulate energy metabolism and autophagy in the mammalian colon, Cell Metab., 2011, 13, 517–526 CrossRef CAS.
  59. P. V. Chang, L. Hao, S. Offermanns and R. Medzhitov, The microbial metabolite butyrate regulates intestinal macrophage function via histone deacetylase inhibition, Proc. Natl. Acad. Sci. U. S. A., 2014, 111, 2247–2252 CrossRef CAS.
  60. J. Xu, X. Chen, S. Yu, Y. Su and W. Zhu, Effects of early intervention with sodium butyrate on gut microbiota and the expression of inflammatory cytokines in neonatal piglets, PLoS One, 2016, 11, e0162461 CrossRef.
  61. S. Vigors, J. V. O'Doherty, R. Rattigan, M. J. McDonnell, G. Rajauria and T. Sweeney, Effect of a laminarin rich macroalgal extract on the caecal and colonic microbiota in the post-weaned pig, Mar. Drugs, 2020, 18, 157 CrossRef CAS.
  62. E. Rodriguez, J. L. Arques, R. Rodriguez, M. Nunez and M. Medina, Reuterin production by lactobacilli isolated from pig faeces and evaluation of probiotic traits, Lett. Appl. Microbiol., 2003, 37, 259–263 CrossRef CAS.
  63. M. De Angelis, S. Siragusa, M. Berloco, L. Caputo, L. Settanni, G. Alfonsi, M. Amerio, A. Grandi, A. Ragni and M. Gobbetti, Selection of potential probiotic lactobacilli from pig feces to be used as additives in pelleted feeding, Res. Microbiol., 2006, 157, 792–801 CrossRef.
  64. O. Moroni, E. Kheadr, Y. Boutin, C. Lacroix and I. Fliss, Inactivation of adhesion and invasion of food-borne Listeria monocytogenes by bacteriocin-producing Bifidobacterium strains of human origin, Appl. Environ. Microbiol., 2006, 72, 6894–6901 CrossRef CAS.
  65. J. K. Kaushik, A. Kumar, R. K. Duary, A. K. Mohanty, S. Grover and V. K. Batish, Functional and probiotic attributes of an indigenous isolate of Lactobacillus plantarum, PLoS One, 2009, 4, e8099 CrossRef.
  66. V. Klose, K. Bayer, R. Bruckbeck, G. Schatzmayr and A. P. Loibner, In vitro antagonistic activities of animal intestinal strains against swine-associated pathogens, Vet. Microbiol., 2010, 144, 515–521 CrossRef.
  67. V. Klose, R. Bruckbeck, S. Henikl, G. Schatzmayr and A. P. Loibner, Identification and antimicrobial susceptibility of porcine bacteria that inhibit the growth of Brachyspira hyodysenteriae in vitro, J. Appl. Microbiol., 2010, 108, 1271–1280 CrossRef CAS.
  68. M. Bosch, M. Rodriguez, F. Garcia, E. Fernandez, M. C. Fuentes and J. Cune, Probiotic properties of Lactobacillus plantarum CECT 7315 and CECT 7316 isolated from faeces of healthy children, Lett. Appl. Microbiol., 2012, 54, 240–246 CrossRef CAS.
  69. S. A. Tanner, C. Chassard, A. Zihler Berner and C. Lacroix, Synergistic effects of Bifidobacterium thermophilum RBL67 and selected prebiotics on inhibition of Salmonella colonization in the swine proximal colon PolyFermS model, Gut Pathog., 2014, 6, 44 CrossRef.
  70. M. Gagnon, A. Vimont, A. Darveau, I. Fliss and J. Jean, Study of the ability of bifidobacteria of human origin to prevent and treat Rotavirus infection using colonic cell and mouse models, PLoS One, 2016, 11, e0164512 CrossRef.
  71. T. Lahteinen, E. Malinen, J. M. Koort, U. Mertaniemi-Hannus, T. Hankimo, N. Karikoski, S. Pakkanen, H. Laine, H. Sillanpaa, H. Soderholm and A. Palva, Probiotic properties of Lactobacillus isolates originating from porcine intestine and feces, Anaerobe, 2010, 16, 293–300 CrossRef.
  72. S. da Silva Sabo, M. Vitolo, J. M. D. Gonzalez and R. P. S. Oliveira, Overview of Lactobacillus plantarum as a promising bacteriocin producer among lactic acid bacteria, Food Res. Int., 2014, 64, 527–536 CrossRef CAS.
  73. A. D. Walsham, D. A. MacKenzie, V. Cook, S. Wemyss-Holden, C. L. Hews, N. Juge and S. Schuller, Lactobacillus reuteri inhibition of Enteropathogenic Escherichia coli adherence to human intestinal epithelium, Front. Microbiol., 2016, 7, 244 Search PubMed.
  74. M. Hasannejad Bibalan, M. Eshaghi, M. Rohani, M. Esghaei, D. Darban-Sarokhalil, M. R. Pourshafie and M. Talebi, Isolates of Lactobacillus plantarum and L. reuteri display greater antiproliferative and antipathogenic activity than other Lactobacillus isolates, J. Med. Microbiol., 2017, 66, 1416–1420 CrossRef.
  75. A. Zihler, M. Gagnon, C. Chassard and C. Lacroix, Protective effect of probiotics on Salmonella infectivity assessed with combined in vitro gut fermentation-cellular models, BMC Microbiol., 2011, 11, 264 CrossRef CAS.
  76. C. Hou, X. Zeng, F. Yang, H. Liu and S. Qiao, Study and use of the probiotic Lactobacillus reuteri in pigs: a review, J. Anim. Sci. Biotechnol., 2015, 6, 14 CrossRef.
  77. H. A. Seddik, F. Bendali, F. Gancel, I. Fliss, G. Spano and D. Drider, Lactobacillus plantarum and its probiotic and food potentialities, Probiotics Antimicrob. Proteins, 2017, 9, 111–122 CrossRef.
  78. Y. W. Liu, M. T. Liong and Y. C. Tsai, New perspectives of Lactobacillus plantarum as a probiotic: The gut-heart-brain axis, J. Microbiol., 2018, 56, 601–613 CrossRef.
  79. Q. Mu, V. J. Tavella and X. M. Luo, Role of Lactobacillus reuteri in human health and diseases, Front. Microbiol., 2018, 9, 757 CrossRef.
  80. H. Y. Keung, T. K. Li, L. T. Sham, M. K. Cheung, P. C. K. Cheung and H. S. Kwan, Mechanistic study of utilization of water-insoluble Saccharomyces cerevisiae glucans by Bifidobacterium breve strain JCM1192, Appl. Environ. Microbiol., 2017, 83, e03442–e03416 CrossRef CAS.
  81. S. Bonardi, Salmonella in the pork production chain and its impact on human health in the European Union, Epidemiol. Infect., 2017, 145, 1513–1526 CrossRef CAS.
  82. P. J. Quinn, B. K. Markey, F. C. Leonard, E. S. Fitzpatrick, S. Fanning and P. J. Hartigan, Veterinary microbiology and microbial disease, Wiley-Blackwell, Chichester, 2nd edn, 2011 Search PubMed.
  83. M. Rhouma, J. M. Fairbrother, F. Beaudry and A. Letellier, Post weaning diarrhea in pigs: risk factors and non-colistin-based control strategies, Acta Vet. Scand., 2017, 59, 31 CrossRef.
  84. M. U. Khan, M. Pirzadeh, C. Y. Forster, S. Shityakov and M. A. Shariati, Role of milk-derived antibacterial peptides in modern food biotechnology: Their synthesis, applications and future perspectives, Biomolecules, 2018, 8, 110 CrossRef.
  85. E. Stuyven, E. Cox, S. Vancaeneghem, S. Arnouts, P. Deprez and B. M. Goddeeris, Effect of beta-glucans on an ETEC infection in piglets, Vet. Immunol. Immunopathol., 2009, 128, 60–66 CrossRef CAS.
  86. J. Li, J. Xing, D. Li, X. Wang, L. Zhao, S. Lv and D. Huang, Effects of beta-glucan extracted from Saccharomyces cerevisiae on humoral and cellular immunity in weaned piglets, Arch. Anim. Nutr., 2005, 59, 303–312 CrossRef CAS.

Footnote

Electronic supplementary information (ESI) available. See DOI: 10.1039/d0fo02269a

This journal is © The Royal Society of Chemistry 2021
Click here to see how this site uses Cookies. View our privacy policy here.