Graphene oxide-coated porous titanium for pulp sealing: an antibacterial and dentino-inductive restorative material

Ningjia Sun , Shi Yin , Yuezhi Lu , Wenjie Zhang * and Xinquan Jiang *
Department of Prosthodontics, Shanghai Engineering Research Centre of Advanced Dental Technology and Materials, Shanghai Key Laboratory of Stomatology & Shanghai Research Institute of Stomatology, National Clinical Research Centre for Oral Diseases, Shanghai Ninth People's Hospital, College of Stomatology, Shanghai Jiao Tong University School of Medicine, No. 639 Zhizaoju Road, Shanghai 200011, China. E-mail: zhangwenjie586@126.com; xinquanj@aliyun.com; Fax: +86-21-63136856; Tel: +86-21-63135412

Received 13th March 2020 , Accepted 14th May 2020

First published on 19th May 2020


Pulp treatment techniques such as pulp capping, pulpotomy and pulp regeneration are all based on the principle of preserving vital pulp. However, specific dental restorative materials that can simultaneously protect pulp vitality and repair occlusal morphology have not been developed thus far. Traditional pulp capping materials cannot be used as dental restorative materials due to their long-term solubility and poor mechanical behavior. Titanium (Ti) is used extensively in dentistry and is regarded as a promising material for pulp sealing because of its favorable biocompatibility, processability and mechanical properties. Originally, we proposed the concept of “odontointegration”, which represents direct dentin-like mineralization contact between pulp and the surface of the pulp sealing material; herein, we report the fabrication of a novel antibacterial and dentino-inductive material via micro-arc oxidation (MAO), incorporating self-assembled graphene oxide (GO) for Ti surface modification. The hierarchical micro/nanoporous structure of the MAO coating provides a suitable microenvironment for odontogenic differentiation of human dental pulp stem cells, and GO loading contributes to antibacterial activity. Scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy and Raman spectroscopy were employed for structure and elemental analysis. In vitro studies, including cell adhesion, Live/Dead and CCK-8 assays, alkaline phosphatase activity and calcium deposition assay, real-time polymerase chain reaction, western blot analysis and immunofluorescence staining were used to examine cell adhesion, viability, proliferation, mineralization, and odontogenic differentiation ability. Antibacterial properties against Streptococcus mutans were analyzed by SEM, spread plate, Live/Dead and Alamar blue tests. The Ti–MAO–1.0 mg mL−1 GO group exhibited excellent cell adhesion, odontoblast differentiation, mineralization, and antibacterial ability, which are beneficial to odontointegration.


Introduction

Dental pulp is crucial for reparative dentin formation, tooth nutrition, sensing, and defense.1 Pulp treatment techniques such as direct pulp capping, pulpotomy and pulpectomy are performed depending on the severity of the pulp disease.2 In addition, pulp regeneration is an attractive technique for treating pathological or iatrogenic dental pulp defects caused by caries or pulpectomy, which could replace root canal therapy in the future.3 Researchers have achieved root pulp regeneration by transplanting human dental pulp stem cells (hDPSCs) in a pilot clinical study.4 Subsequently, there is a need for the application of appropriate restorative materials capable of simultaneously sealing the exposed pulp and repairing coronal hard tissue defects. Besides this, when more than half of the coronal structure is lost after cavity preparation for endodontic therapy, a post-core system is recommended to retain the definitive restoration.5 Ideally, the pulp sealing restorative materials that directly contact with pulp cells should possess good mechanical properties, enhance odontoblast differentiation and concomitantly inhibit bacterial colonization. We proposed the original concept of “odontointegration” in this research, which entails direct dentin mineralization connection between pulp tissue and the surface of coronal restoration. Dentin mineralization deposition at the contact surface and infection prevention ability are two salient indices of odontointegration (Scheme 1).
image file: d0tb00697a-s1.tif
Scheme 1 The micro-arc oxidation technique was used on the titanium to obtain a multilayer porous coating. Besides this, different concentrations of GO were coated on the NaOH and 3-APTES treated substrates. The modified titanium was used as an inlay or a post-core to cover the regenerated pulp for pulp sealing.

A growing body of evidence indicates the presence of resting progenitor or stem cells in the dental pulp. The hDPSCs originate from the cranial neural crest and are localized at the perivascular niche of the dental pulp.6 In endodontic dentistry, these cells are intended to activate and migrate in response to pulpal injury. Dentinogenesis can be regulated by odontoblast-like cells that originate from hDPSCs, which can replace necrotic odontoblasts and secrete a dentin-like structure.7 It has been reported that dentin originating from odontoblasts exhibits a dentinal tubular structure, whereas pulp-cell derived dentin has bone-like characteristics.8 The tunnel defects in osteodentin produced by pulp cells can induce cracking under biting force, which permits bacterial penetration. Therefore, it is crucial for pulp sealing materials to stimulate the odontogenic differentiation of dental pulp cells.

At present, various pulp capping materials, such as mineral trioxide aggregate (MTA) and calcium hydroxide have the effect of pulp sedation, however, they cannot be used directly as dental restorative materials in clinical practice due to their long-term solubility and poor mechanical behavior. Furthermore, the high alkalinity experienced during the curing process can lead to cytotoxicity, tissue necrosis, and internal resorption.9–12 In recent years, Ti and its alloys have been widely used in the dental field for porcelain restoration, oral implants, inlays, casting brackets and basal palates because of their satisfactory cytocompatibility and processability.13–16 Unlike pulp capping materials, Ti can be used as restorative material to repair dental defects with the advantage of being able to withstand occlusal forces and can thus prevent cracking due to its superior physical and mechanical properties.17 However, the dentin induction and antibacterial properties of Ti require further improvement.18,19 Bacterial infections caused by numerous microorganisms in the oral environment lead to restoration failures. In this study, we fabricated a novel antibacterial and dentin-inductive biomaterial utilized for pulp sealing, via the modification of Ti plate surfaces.

Micro-arc oxidation (MAO) is a conventional and effective technology for the production of ceramic coatings on the surfaces of basal metals.20 As previously described, the multilayer-porous structure of MAO-produced coatings not only increases the contact area between cells and the material in question, but also provides a suitable microenvironment for stem cell differentiation.21 However, the antibacterial properties of MAO coatings have remained unclear, requiring further investigation. Graphene oxide (GO), consisting of two-dimensional sheets bearing oxygen-containing groups, can contribute to antibacterial activity via the nanoknives effect and reactive oxygen species.22 The nanoknives effect, also called the action of sharp edges, plays an important role in the antimicrobial properties of GO by cutting through cell membrane, thereby inhibiting microbial growth.23 Therefore, we speculated whether the combination of an appropriate amount of GO on a MAO coating would possess both antibacterial and dentino-inductive characteristics. The objective of this work was to fabricate a novel titanium-based material that is beneficial for biomineralization and infection prevention, via the MAO process and self-assembled GO, to achieve odontointegration in pulp sealing. Previous reports have established that the bioactivity of GO varies according to different factors, and that GO cytotoxicity occurs in a dose-dependent manner.24 In this study, we examined the biological behavior of GO on the coating in the concentration range of 0.1 to 1.0 mg mL−1. We hope that this modified titanium-based material can be widely utilized for pulp sealing and dental restoration in clinical practice.

Materials and methods

Sample preparation

Pure titanium plates were processed into 20 mm × 20 mm × 2 mm samples and polished with 320, 800, and 1200 grit SiC sandpapers. The samples were cleaned with detergent, rinsed with alcohol, and dried. Then, they were placed in a MAO reaction container. The MAO solution comprised 0.1 mol L−1 calcium acetate monohydrate (Macklin, China) and 0.03 mol L−1 sodium dihydrogen phosphate (Macklin, China).25 The electrical parameters were 400 V, 50 Hz, and the duration was 10 min. Following the MAO process, samples were placed in 10 mol L−1 sodium hydroxide (NaOH) (Macklin, China) solution at 60 °C for 24 h. All samples were cleaned with deionized water until a pH of 7 was reached, and then immersed in a 5% anhydrous ethanol solution of 3-aminopropyl triethoxysilane (3-APTES) (Sigma-Aldrich, USA) for 2 h and washed with deionized water.26 Finally, solutions with a range of GO concentrations (0.1, 0.5 and 1.0 mg mL−1, to give products denoted as 0.1 GO, 0.5 GO, and 1.0 GO, respectively) (JCNO, China) were dropped onto the surfaces of each sample. GO sheets were immobilized on the substrate via electrostatic interactions with APTES (Schemes 1 and 2).27 Finally, the samples were dried in a freeze dryer overnight.
image file: d0tb00697a-s2.tif
Scheme 2 The process of connecting 3-APTES to MAO–Ti substrates.

Material characteristics

The surface morphology of the samples was observed by scanning electron microscopy (SEM, SEMS-3400N, Japan) and the surface molecular structure was analyzed by Raman spectroscopy (Thermo, USA). Additionally, the elemental composition of the coating was detected by energy-dispersive X-ray spectroscopy (EDS, EDAX, USA). The surface wettability of all samples was assessed using a contact angle instrument (Solon, China).

hDPSCs culture and characterization

After obtaining informed consent from each patient, orthodontic teeth or wisdom teeth extracted clinically were collected with the approval of the Ethics Committee of Shanghai Ninth People's Hospital Affiliated to Shanghai Jiao Tong University School of Medicine. Decayed teeth and contaminated pulp tissue were excluded. After soaking in phosphate-buffered saline (PBS), the teeth were dissected around their cervical section to expose the pulp tissue. The pulp tissue was isolated using sterile tweezers and minced into 1–2 mm3 pieces. Then, these were subjected to enzymatic digestion with 4 mg mL−1 dispase and 3 mg mL−1 collagenase type I in PBS for 1 h at 37 °C with vigorous shaking.28 The supernatant was removed after centrifugation and the remaining cells were cultured in alpha-modified Eagle's medium (alpha-MEM; Gibco, USA) containing 1% penicillin–streptomycin (Sigma, USA) and 10% fetal bovine serum (Gibco, USA) in a Petri dish at 5% CO2, 37 °C.29 The hDPSCs at passages 3 to 7 were used in this work. The cell surface antigens CD29, CD44, CD45 and CD73 were measured to identify the hDPSCs at passage 7 using a flow cytometry assay. Cells were fixed in 4% phosphate-buffered paraformaldehyde for 5 min and washed twice with PBS. After that, the cells were incubated with CD29-PE, CD44-PE, CD45-PE and CD73-PE antibodies for 30 min in a dark place and then centrifuged at 1000 rpm for 5 min. Cells were resuspended in 200 μL PBS. The results were analyzed using a FACSCalibur flow cytometer.27

Cell viability and proliferation experiment

The hDPSCs at a density of 1 × 106 cells per well were seeded in 6-well plates. After being cultured for 24 h, a Calcein-AM/propidium iodide (PI) double stain kit (Yeasen, China) was used to conduct the Live/Dead assay. The cells were observed using fluorescence microscopy (Olympus, Japan). Viable cells, exhibiting green fluorescence, were stained by Calcein-AM only, while dead cells that showed red fluorescence were stained exclusively by noncell permeable PI. The percentage of viable cells was calculated using ImageJ software (Rawak Software, Germany).30 A cell counting kit-8 (CCK-8) assay (Biosharp, China) was conducted to assess the proliferation of hDPSCs at days 1 and 7. At the relevant time points, the culture medium was replaced with the premixed solution, in which the volume ratio of alpha-MEM/CCK-8 was 10[thin space (1/6-em)]:[thin space (1/6-em)]1. After incubation at 37 °C for 1 h, 100 μL of solution was transferred from each group to a 96-well plate.31 The absorbance at 450 nm was measured using an enzyme labeling instrument (TECAN Spark, Switzerland).

Cell adhesion and extension

Cells at a density of 1 × 106 per well were seeded on various samples in 6-well plates and cultured for 4 h. Samples were rinsed using PBS twice to remove non-adherent cells. The remaining cells were fixed with 4% paraformaldehyde (Beyotime, China) for 30 min at 4 °C,32 and their nuclei were stained with DAPI (Invitrogen, USA) for 5 min. Photographs were taken using a fluorescence microscope (Olympus, Japan). Integrin β1 is an essential protein that mediates cell and extracellular matrix adhesion. Real-time polymerase chain reaction (RT-PCR) and immunofluorescence staining were used to detect the expression of integrin β1. The samples were seeded with 1 × 106 cells per well and cultured for 4 h; the cells were fixed with 4% paraformaldehyde and treated with 0.1% Triton X-100 (Beyotime, China) for 20 min. After being blocked with 10% goat serum (Beyotime, China) for 1 h at room temperature, the plates were incubated with rabbit anti-integrin β1 (Proteintech, USA) at 4 °C overnight. Then, the samples were immersed with the DyLight 488-conjugated anti-rabbit IgG antibody (Invitrogen, USA) for 1 h at 37 °C in the dark. TRITC-phalloidin (Yeasen, China) was used to stain their cytoskeletons for 30 min. Nuclei were stained with DAPI for 5 min. Relevant images were captured using a fluorescence microscope.

RNA isolation and real-time PCR analysis

To analyze the expression levels of odontogenic-related genes, hDPSCs, at a density of 1 × 106 cells per well, were seeded on all samples in 6-well plates and cultured for 14 days. For the RT-PCR analysis, the total RNA was extracted using a TRIzol reagent (Invitrogen, USA) according to the user guide. Firstly, all samples were removed into new 6-well plates and rinsed with PBS. Then, 0.4 mL of TRIzol reagent per well was added to the samples to lyse the cells, and the cells were removed with a cell scraper.75 The lysate was drawn up and down several times in a pipette to homogenize it. The RNA concentration and purity were measured using a Thermo Scientific NanoDrop™ 1000 ultraviolet-visible spectrophotometer (NanoDrop Technologies, Wilmington, DE).27 One microgram of total RNA was used as a template for the synthesis of cDNA using a PrimeScript 1st strand cDNA synthesis kit (TaKaRa, Japan). Then, RT-PCR was performed using a LightCycler 480 system.33 The ΔΔCT method was used to calculate the relative mRNA expression level of alkaline phosphatase (ALP), osteopontin (OPN), osteocalcin (OCN), dentin sialophosphoprotein (DSPP) and dentin matrix protein-1 (DMP-1). GAPDH, the housekeeping gene, was used to normalize all mRNA values. GraphPad Prism (GraphPad, USA) was used to analyze the data statistically. All involved gene primers were synthesized commercially (Shenggong Co., Ltd Shanghai, China) and the sequences are listed in Table 1.
Table 1 Primers for real-time polymerase chain reaction (RT-PCR)
Gene Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
GAPDH TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA
Integrin β1 CGCCGCGCGGAAAAGATG AAACACCAGCAGCCGTGTAA
ALP CCCGTGGCAACTCTATCTTTG GCCTGGTAGTTGTTGTGAGCATA
OCN AGGGCAGCGAGGTAGTGAAGA CTCCTGAAAGCCGATGTGGT
OPN CTGAGGAAAAGGAGACCCTTCC GGCTTCAGCACTCTGGTCAT
DSPP AGTGACAGCCAGAGCAAG CCTATCCCATTACCAAACT
DMP-1 TTATGGCACAGTCAGTTG GGTGATGTTTATGGGAGT


Immunofluorescence staining

We seeded hDPSCs at 1 × 106 cells per well for all samples in 6-well plates and cultured them in alpha-MEM for 14 days. The expressions of OCN and OPN were further detected using immunofluorescence staining. Cells were fixed in 4% paraformaldehyde for 20 min and treated with 0.1% Triton X-100 for 30 min. The cells were blocked with 10% goat serum for 1 h. Subsequently, they were incubated with primary antibodies against OPN (Abcam, USA) and OCN (Abcam, USA) overnight at 4 °C. Then, all samples were incubated with DyLight 488-conjugated anti-rabbit IgG antibodies for 1 h at room temperature. The cytoskeletons were stained with TRITC-phalloidin (Invitrogen, USA) for 1 h, and the nuclei were stained with DAPI for 5 min.34 The specimens were observed using a fluorescence microscope.

Alkaline phosphatase activity and calcium deposition assay

We seeded hDPSCs at 1 × 106 cells per well on all samples in 6-well plates and cultured them in alpha-MEM supplemented with 0.1 μM dexamethasone, 10 mM β-glycerol phosphate, 50 μM ascorbic acid and 10% fetal bovine serum for 14 days.35 For alkaline phosphatase (ALP) semiquantitative analysis, a bicinchoninic acid protein assay (Thermo Scientific, MA) was used to detect the total protein content by measuring the optical density (OD) at a wavelength of 630 nm. Then, ALP activity was assessed using an alkaline phosphatase assay kit (Beyotime, China) according to the manufacturer's instructions. The final ALP activity was presented as OD values per milligram of total protein at 405 nm.35 For the calcium deposition assay, cells were fixed with 4% paraformaldehyde and stained with the Alizarin red S (ARS) reagent (Beyotime, China) for 30 min. Immunofluorescence staining of ALP was likewise performed on the samples. Primary antibodies against ALP (Abcam, USA) and the DyLight 488-conjugated anti-rabbit IgG antibody (Invitrogen) were used. Nuclei were counterstained with DAPI. The specimens were observed by confocal laser scanning microscopy (Leica, Germany).

Western blot analysis

After culturing hDPSCs on all samples for 14 days, the cell matrix of three samples per group was harvested with 100 μL of RIPA lysis buffer per well (Beyotime, China). The total protein content was assessed using a Bio-Rad protein assay kit and then 20 μg of protein from each sample was separated using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by the transfer of the samples onto a polyvinylidene fluoride (PVDF) membrane (Millipore, Burlington, MA, USA).33 The membranes were blocked with TBST buffer containing 5% defatted milk for 2 h at room temperature and then incubated with rabbit polyclonal primary antibodies against the following: GAPDH (Bioss, China), DSPP (Bioss, China) and DMP-1 (Bioss, China) overnight at 4 °C. After washing three times with 0.5% PBST, the membranes were incubated with anti-rabbit secondary antibodies (Cell Signaling Technology, USA) for 1 h at room temperature. Finally, the protein bands were scanned using an enhanced chemiluminescence detection system (UVItec ALLIANCE 4.7 gel imaging system, UK).

Bacterial preparation

Streptococcus mutans (S. mutans) (UA159) was the strain used to assess the antibacterial activities of the Ti, MAO and 1.0 GO groups. S. mutans was cultivated in brain heart infusion (BHI) Broth (BD Difco, USA) and BHI agar (Sigma, USA). All samples were placed in 6-well plates and then incubated in 2 mL of bacteria-containing medium (1 × 106 CFU per mL) under standard anaerobic conditions.36

Morphological observations by SEM

In order to observe the morphology, the bacterial suspension (20 μL, 1 × 106 CFU per mL) was seeded on all samples. After culturing for 24 h at 37 °C, the samples were washed with PBS three times and fixed with 2.5% glutaraldehyde (Leagene, China) for 4 h and then dehydrated in a series of increasing ethanol (Macklin, China) concentrations: 30, 50, 75, 90, 95, and 100 v/v%, dried, and coated with gold.37 Finally, the images were recorded using SEM (S-4800, Hitachi, Japan).

Bacterial viability experiment

For Live/Dead assay, the bacteria on all substrates were incubated with SYTO9 and PI stained after being cultured for 24 h at 37 °C. The live bacteria appeared green and the dead ones appeared red. The plates were observed using a fluorescence microscope (Olympus, Japan).38

Bacterial spread plate test

After culturing for 24 h at 37 °C, the samples were rinsed three times with PBS. The adherent bacteria on the samples were collected by ultrasonic treatment (B3500S-MT, Branson Ultrasonics Co., China) for 5 min at a frequency of 50 Hz and then the bacterial suspensions were ten-fold serially diluted with PBS solution. Finally, 100 μL of dilute bacterial suspensions of each sample was plated onto BHI agar plates and cultured for another 24 h at 37 °C.39 Images of recultivated bacteria colonies were recorded and analyzed using ImageJ software.

Alamar blue bacterial viability test

The Alamar blue assay kit (Yeasen, China) was used to assess bacterial viability. After culturing for 24 h at 37 °C, 500 μL of 10% Alamar blue solution was added into each sample and incubated for 2 h at 37 °C. Then, 100 μL aliquot of each medium was transferred into 96-well plates, and the OD value, representing the fluorescent intensity (FI), was detected with an excitation wavelength at 570 nm and an emission wavelength at 600 nm.37 Finally, the antibacterial ratio was calculated according to the following equation, where FI (control) is the fluorescence intensity of the Ti group, and FI (experiment) is the fluorescence intensity of the MAO and 1.0 GO groups.
Antibacterial ratio (%) = (FI(control) − FI(experiment))/FI(control) × 100%

Intracellular reactive oxide species assay

The reactive oxide species (ROS) levels in bacteria cells were measured using a ROS assay kit (Abcam, UK) with 2′,7′-dichloro-dihydrofluorescein diacetate (DCFH-DA). DCFH-DA can be deacetylated with intracellular esterases into nonfluorescent 2′,7′-dichloro-dihydrofluorescein (DCFH), which can be oxidized using ROS into fluorescent 2′,7′-dichlorofluorescein (DCF). Briefly, after bacterial culturing for 24 h at 37 °C, the samples were washed and incubated in 2 mL of DCFH-DA (10 μM) diluted in PBS in the dark for 30 min. And then, 100 μL of each sample was transferred into 96-well plates and the FI was detected at 485 nm excitation and 535 nm emission wavelengths using a microplate reader (SpectraMax M2, Molecular Devices).40

Statistical analysis

All data from this study are expressed as the mean ± standard deviation and were analyzed using GraphPad Prism (GraphPad Software, USA). The statistical comparisons were performed via one-way ANOVA and SNK. The differences were considered statistically significant at P < 0.05.

Results

Material characteristics

As shown in Fig. 1a, the surface of Ti was relatively smooth, while a multilayer-porous structure was detected on MAO coating. In the 1.0 GO group, GO showed obvious fluctuation in wrinkles or edges and the porous structure of the MAO coating could be clearly seen. The contact angle decreased from 82.83° ± 1.53° on the Ti surface to 19.00° ± 3.97° in the 1.0 GO group (Fig. 1b and c). GO incorporation altered the contact angle on the surface of Ti and MAO appreciably, which is pertinent to the cell adhesion response. Elemental composition analysis results from EDS indicated that the MAO coating contained Ti, O, Ca, P, and C, and that the 1.0 GO samples contained a higher elemental proportion of C (Fig. 2a). The Raman spectrum of Ti, lacking a characteristic peak, appeared as irregular waves. Typical features of GO, a D band at 1333 cm−1 and a G band at 1594 cm−1, were detected, which indicated that GO was fixed on the surface (Fig. 2b).
image file: d0tb00697a-f1.tif
Fig. 1 Surface morphology and hydrophilicity tests. (a) SEM images of the Ti, MAO and 1.0 GO samples. (b) Water droplets on different surfaces at room temperature. (c) Statistical analysis of contact angles of the three groups (*: P < 0.05).

image file: d0tb00697a-f2.tif
Fig. 2 Sample characteristics. (a) EDS and elemental analysis of the Ti, MAO and 1.0 GO samples. (b) Raman spectroscopy results of the Ti, MAO and 1.0 GO groups.

hDPSCs culture and characterization

The primary hDPSCs emerged from the tissue blocks and presented a fibroblast-like spindle shape (Fig. S1, ESI). At passage 7, the stem cell surface markers were detected by flow cytometry. It was revealed that the cultured cells expressed high levels of the mesenchymal stem cell surface markers CD29, CD44 and CD73 (89.94%, 81.38% and 89.65%, respectively), while the marker of hematopoietic stem cells CD45 (0.02%) was hardly expressed (Fig. S2, ESI).

Cell adhesion and extension

The initial adhesion of hDPSCs was studied after the cells were cultured on the samples for 4 h. As shown in Fig. 3a, the expression level of integrin β1 protein in the 1.0 GO group was higher than that in the Ti control, which was consistent with the results of integrin β1 mRNA expression analysis (Fig. 3b). The cytoskeleton adhesion area, stained with TRITC-phalloidin (red), was determined to be 496.37 ± 33.78 μm2 per cell in the 1.0 GO group, which was nearly a three-fold increase compared to that of the Ti group (Fig. 3c). According to adherent cell nuclei staining, the highest number of cells adhered to the surfaces of the 1.0 GO samples (Fig. 3d and e). The above results suggested that the 1.0 GO group exhibited the highest adherent cell number, largest cell extension area and the highest expression of Integrin β1, indicating superior cell adhesion and extension ability.
image file: d0tb00697a-f3.tif
Fig. 3 Cell adhesion and extension assay. (a) Immunofluorescence staining for integrin β1 of hDPSCs that were cultured on all samples. (b) After culturing for 4 h, the relative gene expression of integrin β1 in all groups was observed. (c) The cell extension area was statistically calculated using ImageJ. (d) After culturing for 4 h, nuclei stained with DAPI were shown. (e) Statistical analysis of cell numbers according to DAPI staining using ImageJ (*: P < 0.05 compared with Ti; #: P < 0.05 compared with MAO; &: P < 0.05 compared with 0.1 GO; n = 3).

Cell viability and proliferation experiment

The cytoplasm of viable cells stained by Calcein-AM appeared green, and the nuclei of the dead cells stained by PI appeared red (Fig. 4a). All samples exhibited a high ratio of viable cells and the differences between the groups were not statistically different (Fig. 4b). A CCK-8 assay was performed after days 1 and 7 of cell culturing, to detect the proliferation activity of hDPSCs on the various samples. Compared with the Ti group, cells on the MAO and MAO–GO surfaces proliferated after 7 days of culturing (Fig. 4c).
image file: d0tb00697a-f4.tif
Fig. 4 Cell viability and proliferation experiment. (a) Live/Dead assay of all samples. Live cells appeared green and dead cells appeared red. (b) The viable cell ratio of the Live/Dead assay was calculated using ImageJ. (c) CCK-8 assay was performed after 1 and 7 days of cell culture and calculated using GraphPad Prism (*: P < 0.05 relative to the absorbance at day 1; #: P < 0.05 compared with Ti at day 7).

Cell differentiation

To investigate the hDPSC differentiation on a molecular level, the expression of odontogenic-related genes including ALP, OPN, OCN, DSPP, and DMP-1 were quantified using a RT-PCR assay. In general, all of the corresponding mRNAs presented an upward trend after culturing for 14 days, whilst a dramatic increase was observed in the 1.0 GO group. The expression patterns of the odontogenic OPN, DSPP, DMP-1 genes exhibited significant differences between the 1.0 GO and 0.5 GO coatings, whilst no statistically significant variation was found between the MAO and 0.1 GO groups (Fig. 5a and c–f). In order to further confirm the odontoblast differentiation activity of hDPSCs at protein levels, an ALP assay, a calcium deposition assay, western blot and immunofluorescence analyses were conducted. In a semiquantitative assay of ALP activity, the results were calculated by normalizing to protein contents. As shown in Fig. 5b, hDPSCs cultured on the 1.0 GO group displayed the highest ALP activity, nearly five times than that of the Ti group. This observation suggested that the ALP activity of hDPSCs on GO coatings was positively correlated with the GO content, with 1.0 GO exhibiting significantly higher activity compared to the activities of 0.1 GO and 0.5 GO. As shown in Fig. 7, more pronounced ARS areas were observed on the MAO and 1.0 GO groups than on Ti, which indicated increased calcium deposition. It is evident from the three-dimensional images that the calcium deposition layer was thickest on the 1.0 GO group, which was consistent with the immunofluorescence staining of ALP. Furthermore, the protein expressions of DSPP and DMP-1 detected by western blot were consisted with the PCR results (Fig. 5g). As shown in Fig. 6, the hDPSCs on the various samples elicited recognizable OPN and OCN positive staining after culturing for 14 days, however, the expression levels on the Ti and MAO groups were weak. In comparison, OPN and OCN exhibited higher expression on the 0.5 GO and 1.0 GO groups, and significantly enhanced expression was evident for the hDPSCs on the 1.0 GO group relative to the Ti, MAO, and 0.1 GO samples. In summary, these results suggest that superficial 1.0 mg mL−1 GO incorporation on the MAO coating is advantageous on odontogenic differentiation of hDPSCs when compared to the other groups.
image file: d0tb00697a-f5.tif
Fig. 5 (a) and (c–f) Real-time PCR detection of odontogenic genes of hDPSCs cultured on samples for 14 days with statistical analyses. (b) ALP semiquantitative analysis of all samples. (g) Western blot analysis of DSPP and DMP-1 proteins of all groups (*: P < 0.05 compared with Ti; #: P < 0.05 compared with MAO; &: P < 0.05 compared with 0.1 GO; ^: P < 0.05 compared with 0.5 GO; n = 3).

image file: d0tb00697a-f6.tif
Fig. 6 Immunofluorescence staining. (a) Expression of OPN protein (green) was detected by immunofluorescence staining. (b) Detection of OCN protein (green) using fluorescence microscopy. Red: actin cytoskeleton; blue: nuclei; yellow: merged color of green and red.

image file: d0tb00697a-f7.tif
Fig. 7 Calcium deposition assay. 3D images obtained from confocal laser scanning microscopy. After the hDPSCs were cultured for 14 days, ARS and immunofluorescence staining of ALP were co-performed on the Ti, MAO, and 1.0 GO groups. Red fluorescence represents calcium deposition. Green fluorescence shows the expression of ALP protein and the nuclei appear blue.

Bacterial morphological observation by SEM

The surface morphologies of S. mutans growth on various samples are presented in Fig. 8a. At a high magnification of 10 K×, it was evident that the bacterial growth was prolific on the Ti and MAO groups, exhibiting typical features of long-chained, spherical and intact morphology, whereas they were segmented without aggregation in the 1.0 GO group, with shrunken and deformed cell membranes (black arrows). Among the samples, the 1.0 GO group exhibited the lowest degree of bacterial growth, thereby demonstrating that 1.0 mg mL−1 GO deposited on the coating results in effective bacterial inhibition.
image file: d0tb00697a-f8.tif
Fig. 8 (a) SEM images of S. mutans morphologies on Ti, MAO and 1.0 GO. The black arrows indicate bacteria with damaged cell membranes. (b) Live/Dead assay of bacteria on the Ti, MAO and 1.0 GO substrates. Viable bacteria appear green and dead bacteria appear red. (c) Bacterial spread plate test. The white points represent bacterial colonies. (d) The number of bacteria recultivated colonies were statistically calculated using ImageJ (*: P < 0.05). (e) Alamar blue bacterial viability test. The antibacterial ratio was statistically calculated using ImageJ (*: P < 0.05). (f) Reactive oxide species assay. The fluorescence intensity in 1.0 GO group was highest than that of the Ti and MAO groups (*: P < 0.05).

Bacterial viability experiment

As shown in Fig. 8b, most of the S. mutans on Ti and MAO substrates were alive, while large amounts of bacteria on 1.0 GO were dead, as the green fluorescence intensities that represent viable bacteria decreased dramatically.

Bacterial spread plate test

The amount of viable S. mutans colonies cultured on agar plates was calculated using ImageJ software. The number of bacterial colonies on Ti and MAO was comparable, while they were significantly reduced on the 1.0 GO samples, with the differences being statistically significant (Fig. 8c and d). Bacterial colonies were nearly entirely absent on the 1.0 GO group, where the reduction ratio of bacteria was 93.25% ± 2.47%.

Alamar blue bacterial viability test

The antibacterial ratio was dramatically upregulated from 26.79% ± 3.04% in the Ti group to 90.81% ± 4.02% in the 1.0 GO group. Compared to the Ti and MAO groups, the 1.0 GO group exhibited the lowest bacterial viability and the difference was statistically significant. The MAO group displayed no significant antibacterial effect in contrast with that of Ti in this test (Fig. 8e).

Reactive oxide species assay

The 1.0 GO group exhibited the highest ROS level, while the MAO group showed no increase in the intensity of the fluorescence signal of DCF compared with the Ti group. These results indicated that samples of the 1.0 GO group were able to induce the production of ROS in bacteria (Fig. 8f).

Discussion

Dental pulp tissue contains nerves, blood vessels, and mesenchymal stem cells, which play an important role in the sensation and viability of teeth, recruitment of immunocompetent cells, and the development of permanent teeth.41 Therefore, vital pulp treatment techniques such as pulp capping and pulpotomy were widely used in clinical practice. Besides this, with regard to the treatment of pulp tissue defects, pulp tissue regeneration was considered to be a promising technique and is anticipated to replace root canal therapy.42 Subsequently, how to simultaneously protect pulp vitality and repair the dental defect after pulp therapies remains to be worked out. In order to further promote dentin mineralization and prevent infection, the dental restorative materials that are in contact with pulp tissue should possess excellent cytocompatibility, odontogenic inducibility, mechanical characteristics, and antibacterial properties.

In this study, we prepared a range of novel MAO–GO coatings on the surface of titanium by impregnating APTES-treated MAO plates with varying concentrations of GO dispersions.64 The application of 3-APTES can increase the interfacial adhesion between GO and modified substrates. On the one hand, the triethoxy (–OC2H5)3 groups could be hydrolyzed to generate trisilanol. After being treated with 10 mol L−1 NaOH solution, a large number of hydroxyl groups were retained on the substrates, which provide more attachment points for the silane hydroxyl groups of 3-APTES to form covalent bonds (Scheme 2).43 On the other hand, the –NH2 of 3-APTES can react rapidly with the hydroxyl groups of GO to form covalent bonds. The electrostatic self-assembly method has been widely implemented for the preparation of multilayer structures and has been shown to exhibit exceptional bonding strength.44 It has been reported that the surface properties of the coating, such as wettability, topography, and chemical composition contribute to cellular behavior, extracellular matrix deposition and differentiation microenvironment.45 MAO is a conventional and effective technique for the modification of titanium surfaces via the formation of an oxide ceramic coating.25 Previous research has shown that the MAO-generated coating bonds firmly with the basal metal, in addition to exhibiting a multilayer porous structure that increases the cell contact area, thereby promoting cell adhesion and proliferation;46,47 findings consistent with the results obtained in this study. Furthermore, the biological mineralization process of hDPSCs on MAO coatings is enhanced compared to that on an unaltered Ti surface, as evidenced in ARS, which may benefit odontointegration due to the sustained release of calcium and phosphorus ions from the MAO coating.48 However, it is worth noting that MAO-fabricated coatings did not present a significant difference in the odontoblast differentiation ability of hDPSCs compared to Ti, according to the analysis of the expression of specific markers in this study.

Due to the immobilization of GO on their surface, the MAO–GO coatings exhibited higher hydrophilicity (Fig. 1b), which was beneficial for the interaction between the sealing surface and the surrounding biological environment. GO nanosheets possess numerous oxygen-containing groups that serve as cell anchoring points, and thus support cell adhesion, proliferation, and influence cellular phenotype.49,61 Additionally, these functional groups (hydroxyl and carboxyl) can absorb small molecules leading to crystallization, and promote the spontaneous cellular secretion of the mineralized matrix.50,51 However, it should be noted that the bioactivities of GO-loaded coatings vary according to certain factors, such as GO content and experimental surroundings. For example, an excess of GO may be cytotoxic and inhibit cell viability.52 It was established from this research that hDPSCs cultured on the 1.0 GO group exhibited high cell viability and superior cell adhesion, which confirmed the cytocompatibility of 1.0 mg mL−1 of GO on the coating.

In the situation of dental pulp injury, progenitor cells in pulp tissue are capable of differentiating into new odontoblast-like cells that are responsible for the production of dentin-like/calcified tissue.53 It is essential for pulp sealing materials to induce odontogenic differentiation of dental pulp stem cells for the purpose of dentin synthesis. DSPP and DMP-1 are essential markers of odontogenic differentiation. DSPP is the most abundant non-collagenous protein in dentin and serves as a template for mineral nucleation and growth.54,55 It is a precursor protein that codes for dentin sialoprotein (DSP) and dentin phosphoprotein (DPP).56 DMP-1 is an extracellular matrix protein that is involved in the differentiation of hDPSCs to odontoblasts and has the capacity to induce heterogeneous nucleation of calcium-phosphate crystals to regulate crystal growth.57 Moreover, ALP and OPN play important roles in the formation of extracellular matrix and mineralization.58 OCN, expressed by odontoblasts, is considered as the most specific marker of dentinogenesis. Therefore, we selected these markers to evaluate the efficacy of the various samples for the promotion of odontoblastic differentiation. The RT-PCR results (Fig. 5) indicated that hDPSCs in the 1.0 GO group exhibited the highest expression of these specific markers, indicating up-regulated odontogenic differentiation, which was consistent with the results obtained from the analysis at protein level (Fig. 6). Moreover, the thickest mineralization layer (Fig. 7) on the surface of the 1.0 GO samples demonstrated that the coating could provide a bioactive surface for biological mineralization, which is of benefit for odontointegration. In summary, the odontogenic differentiation activity of hDPSCs was positively correlated with the GO content on the coatings in the concentration range of 0.1 to 1.0 mg mL−1.

Bacterial infection caused by abundant microbiota in the oral environment is a severe complication following pulp sealing, and will result in treatment failure. There are numerous pathways for microorganisms and bacterial products to intrude into the pulp, such as via cracks in the restorative material, a smear layer removal process, exposed dentin tubules, and contamination from saliva. Dental pulp cells will react to these antigens and trigger neurogenic inflammation.55 GO has attracted increasing attention in recent years, due to its antibacterial activity, which may occur principally via the mechanism of oxidative stress produced by ROS.59,60 Based on the results of cell experiments, we selected the concentration of 1.0 mg mL−1 GO in the concentration range of 0.1 to 1.0 mg mL−1 for the subsequent bacterial experiments. The SEM images (Fig. 8a) showed that the bacterial membrane had a shrunken shape, and the bacterial chain became separated into single units in the 1.0 GO group. In addition, most bacteria survived well on the Ti and MAO surfaces, while large amounts of bacteria on 1.0 GO were dead (Fig. 8b). According to the spread plate test (Fig. 8c), the 1.0 GO group effectively prevented S. mutans from proliferating, whereas the numbers of bacterial colonies on the MAO coating and Ti were comparable. We also investigated the ROS levels in bacteria incubated on the Ti, MAO, and 1.0 GO samples. The 1.0 GO group showed the highest ROS level that contributes to antibacterial activity. It has been reported that abundant oxygen-containing functional groups such as hydroxyl and carboxyl can facilitate the production of ROS and lead to ROS-dependent oxidative stress, which interferes with the bacterial metabolic activity and inactivates bacteria.62,63 Overall, with the addition of 1.0 mg mL−1 GO, the antibacterial ability of the MAO coating was significantly improved.

Finally, we would like to outline a prospective application of this novel pulp sealing material in clinical practice. In 1987, with the introduction of the concept of intraoral scanning, the first digital intraoral impression system named as CEREC 1 was brought to the clinic. Accurate intraoral scanners can take three-dimensional mathematical models directly from the oral cavity and there are other intraoral digital impression systems available in the current dental field, such as iTero, E4D and TRIOS.65 The use of the intraoral digital scanner would enable us to achieve an envisaged scheme by obtaining an accurate digital prosthesis model via a stress-free procedure, which avoids pulp irritation brought on by impression materials and is aseptic during the process.66,67 Pure Ti is ductile and easy to manufacture. Therefore, Ti protheses such as the inlay, onlay and post-core crown can be precisely produced by means of computer aided design and computer aided manufacturing (CAD/CAM) systems, which have been used in prosthetic restorations since 1980s.68,69 After collecting the digital model, the shape of the restorations can be designed by software and computer interaction, and then cutting equipment is able to complete the process of machining the titanium. For the sake of retention, dental adhesive could be employed to bond the side wall of the restorations. Previous research has proved that the bonding strength of various resin composites70 and polycarboxylate cements71 to Ti substrate is sufficient enough to meet the needs of clinical restoration. What is more, the application of glass ionomer cements (GICs) has been widespread as metal luting materials in the dental field since the 1980s.72 GICs have unique properties, including biocompatibility, antimicrobial potential and adhesive capability.73 The biocompatibility of GICs has already been reviewed many years ago.74 Therefore, initial stability can be achieved between the restoration and dental structure before the process of odontointegration. However, further clinical research is still required for a thorough evaluation of this novel material used for pulp sealing and post-core crowns.

Conclusion

In this study, a modified titanium-based material for pulp sealing with the ability of dentin-like mineralization and infection prevention was prepared via a MAO technique and the self-assembly of GO of varying content (0.1 mg mL−1, 0.5 mg mL−1 and 1.0 mg mL−1). The results indicated that the modified surface of Ti–MAO–1.0 mg mL−1 GO could dramatically up-regulate hDPSC adhesion, proliferation, odontogenic differentiation, and antibacterial activity. It is believed that the multi-layer porous structure of the MAO coating and the physical and chemical properties of GO contribute to effective odontointegration in pulp sealing. This study details a novel biomaterial capable of simultaneously sealing the regenerated pulp and repairing the occlusal morphology, rendering it potentially applicable in clinical practice.

Conflicts of interest

There are no conflicts to declare.

Acknowledgements

This work was jointly supported by the National Nature Science Foundation of China (No. 81921002), the National Natural Science Foundation of China (No. 81620108006, 81430012, 31700848), and the National Key Research and Development Program of China (2016YFC1102900).

Notes and references

  1. M. R. Byer, H. Suzuki and T. Maeda, Microsc. Res. Tech., 2010, 60, 503–515 CrossRef PubMed.
  2. V. S. Faugeron, A. M. Glenny, F. Courson, P. Durieux, M. M. Bolla and H. F. Chabouis, Pulp treatment for extensive decay in primary teeth, John Wiley & Sons, New Jersey, 2014 Search PubMed.
  3. M. Nakashima and A. Akamine, J. Endod., 2005, 31, 711–718,  DOI:10.1097/01.don.0000164138.49923.e5.
  4. M. Nakashima, K. Iohara, M. Murakami, H. Nakamura, Y. Sato and Y. Ariji, Stem Cell Res. Ther., 2017, 8, 61 CrossRef PubMed.
  5. A. M. E. Marchionattix, V. Valli, V. F. Wandscher, C. Monaco and P. Baldissara, Rev. Odontol. UNESP, 2017, 46, 232–237 CrossRef.
  6. A. Arthur, G. Rychkov, S. Shi, S. A. Koblar and S. Gronthos, Stem Cells, 2008, 26, 1787–1795 CrossRef CAS PubMed.
  7. I. About, M. J. Bottero, P. D. Denato, J. Camps, J. C. Franquin and T. A. Mitsiadis, Exp. Cell Res., 2000, 258, 33–41 CrossRef CAS PubMed.
  8. Y. Zhao, X. Yuan, B. Liu, U. S. Tulu and J. A. Helms, J. Dent. Res., 2018, 97, 1047–1054 CrossRef CAS PubMed.
  9. J. Camilleri, F. E. Montesin, S. Papaioannou, F. Mcdonald and T. R. Pitt Ford, Int. Endod. J., 2004, 37, 699–704 CrossRef CAS PubMed.
  10. C. Estrela, G. B. Sydney, L. L. Bammann and O. Felippe, Braz. Dent. J., 1995, 6, 85–90 CAS.
  11. M. Torabinejad, C. U. Hong, F. Mcdonald and T. R. Pitt Ford, J. Endod., 1995, 21, 349–353 CrossRef CAS PubMed.
  12. M. Song, B. Yu, S. Kim, M. Hayashi, C. Smith, S. Sohn, E. Kim, J. Lim, R. G. Stevenson and R. H. Kim, Dent. Clin. North Am., 2017, 61, 93–110 CrossRef PubMed.
  13. Q. Ye and G. He, Mater. Des., 2015, 83, 295–300 CrossRef CAS.
  14. F. Saeed, N. Muhammad, A. S. Khan, F. Sharif, A. Rahim, P. Ahmad and M. Irfan, Mater. Sci. Eng., C, 2020, 106, 110167 CrossRef CAS PubMed.
  15. M. Geetha, A. K. Singh, R. Asokamani and A. K. Gogia, Prog. Mater. Sci., 2009, 54, 397–425 CrossRef CAS.
  16. A. Barazanchi, K. C. Li, B. Al-Amleh, K. Lyons and J. N. Waddell, J. Prosthodont., 2016, 26, 156–163 CrossRef PubMed.
  17. H. J. Rack and J. I. Qazi, Mater. Sci. Eng., C, 2006, 26, 1269–1277 CrossRef CAS.
  18. X. Yao, X. Zhang, H. Wu, L. Tian, Y. Ma and B. Tang, Appl. Surf. Sci., 2014, 292, 944–947 CrossRef CAS.
  19. M. Fürst, G. Salvi, N. Lang and G. Persson, Clin. Oral. Implants Res., 2007, 18, 501–508 CrossRef PubMed.
  20. P. Zhang, X. J. Wang, Z. D. Lin, H. J. Lin, Z. G. Zhang, W. Li, X. F. Yang and J. Cui, Nanomaterials, 2017, 7, 343 CrossRef PubMed.
  21. Y. Wang, H. Yu, C. Chen and Z. Zhao, Mater. Des., 2015, 85, 640–652 CrossRef CAS.
  22. S. Panda, T. K. Rout, A. D. Prusty, P. M. Ajayan and S. Nayak, Adv. Mater., 2018, 30, 1702149 CrossRef PubMed.
  23. J. D. Mangadlao, C. M. Santos, M. J. L. Felipe, A. C. C. de Leon, D. F. Rodrigues and R. C. Advincula, Chem. Commun., 2015, 51, 2886 RSC.
  24. K. H. Liao, Y. S. Lin, C. W. Macosko and C. L. Haynes, ACS Appl. Mater. Interfaces, 2011, 3, 2607–2615 CrossRef CAS PubMed.
  25. W. Zhou, Y. Gan, Q. Li, W. Xi, O. Huang and T. Zhou, Artif. Cells, Nanomed., Biotechnol., 2019, 47, 290–299 CrossRef CAS PubMed.
  26. S. J. Chiong, P. S. Goha and A. F. Ismail, J. Nat. Gas Sci. Eng., 2017, 42, 190–202 CrossRef CAS.
  27. M. Zhang, F. Jiang, X. Zhang, S. Wang, Y. Jin, W. Zhang and X. Jiang, Stem Cells Transl. Med., 2017, 6, 2126–2134 CrossRef CAS PubMed.
  28. A. Arthur, G. Rychkov, S. Shi, S. A. Koblar and S. Gronthos, Stem Cells, 2008, 26, 1787–1795 CrossRef CAS PubMed.
  29. K. M. Ellis, D. C. O'Carroll, M. D. Lewis, G. Y. Rychkov and S. A. Koblar, Stem Cell Res. Ther., 2014, 5, 30 CrossRef PubMed.
  30. X. Wang, T. Lu, J. Wen, L. Xu, D. Zeng, Q. Wu, L. Cao, S. Lin, X. Liu and X. Jiang, Biomaterials, 2016, 83, 207–218 CrossRef CAS PubMed.
  31. J. Wu, A. Zheng, Y. Liu, D. Jiao, D. Zeng, X. Wang, L. Cao and X. Jiang, Int. J. Nanomed., 2019, 14, 733–751 CrossRef CAS PubMed.
  32. D. Khang, J. Lu, C. Yao, K. M. Haberstroh and T. J. Webster, Biomaterials, 2008, 29, 970–983 CrossRef CAS PubMed.
  33. L. Jiang, W. Zhang, L. Wei, Q. Zhou, G. Yang, N. Qian, Y. Tang, Y. Gao and X. Jiang, Biomaterials, 2018, 179, 15–28 CrossRef CAS PubMed.
  34. H. Cao, W. Zhang, F. Meng, J. Guo, D. Wang, S. Qian, X. Jiang, X. Liu and P. K. Chu, ACS Appl. Mater. Interfaces, 2017, 9, 5149–5157 CrossRef CAS PubMed.
  35. J. Wu, L. Cao, Y. Liu, A. Zheng, D. Jiao, D. Zeng, X. Wang, D. L. Kaplan and X. Jiang, ACS Appl. Mater. Interfaces, 2019, 11, 8878–8895 CrossRef CAS PubMed.
  36. H. Qin, H. Cao, Y. Zhao, C. Zhu, T. Cheng, Q. Wang, X. Peng, M. Cheng, J. Wang, G. Jin, Y. Jiang, X. Zhang, X. Liu and P. K. Chu, Biomaterials, 2014, 35, 9114–9125 CrossRef CAS PubMed.
  37. J. Qiu, L. Liu, H. Zhu and X. Liu, Bioact. Mater., 2018, 3, 341–346 CrossRef PubMed.
  38. L. Zhang, J. Zhang, F. Dai and Y. Han, Sci. Rep., 2017, 7, 13951 CrossRef PubMed.
  39. H. Tan, Z. Peng, Q. Li, X. Xu, S. Guo and T. Tang, Biomaterials, 2012, 33, 365–377 CrossRef CAS PubMed.
  40. D. D. Innocentia, M. Ramazzotti, E. Sarchielli, D. Monti, M. Chevanne, G. B. Vannelli and E. Barletta, Toxicology, 2019, 411, 110–121 CrossRef PubMed.
  41. G. Michel, The Dental Pulp, Springer, Berlin, 2014 Search PubMed.
  42. S. G. Kim, Dental pulp regeneration, John Wiley & Sons Inc., New Jersey, 2016 Search PubMed.
  43. B. Arkles, CHEMTECH, 1977, 7, 766–778 CAS.
  44. G. Decher, Science, 1997, 277, 1232–1237 CrossRef CAS.
  45. A. E. Nel, L. Madler, D. Velegol, T. Xia, E. M. V. Hoek, P. Somasundaran, F. Klaessig, V. Castranova and M. Thompson, Nat. Mater., 2009, 8, 543–557 CrossRef CAS PubMed.
  46. X. Qi, H. Shang, B. Ma, R. Zhang, L. Guo and B. Su, Materials, 2020, 13, 970 CrossRef PubMed.
  47. L. Zhao, S. Mei, P. K. Chu, Y. Zhang and Z. Wu, Biomaterials, 2010, 31, 5072–5082 CrossRef CAS PubMed.
  48. A. Dos Santos, J. R. Araujo, S. M. Landi, A. Kuznetsov, J. M. Granjeiro, L. Á. De Sena and C. A. Achete, J. Mater. Sci.: Mater. Med., 2014, 25, 1769–1780 CrossRef CAS PubMed.
  49. W. Zhang, G. Yang, X. Wang, L. Jiang, F. Jiang, G. Li, Z. Zhang and X. Jiang, Adv. Mater., 2017, 29, 1703795 CrossRef PubMed.
  50. R. Guazzo, C. Gardin, G. Bellin, L. Sbricoli, L. Ferroni, F. S. Ludovichetti, A. Piattelli, I. Antoniac, E. Bressan and B. Zavan, Nanomaterials, 2018, 8, 349 CrossRef PubMed.
  51. V. Rosa, H. Xie, N. Dubey, T. T. Madanagopal, S. S. Rajan, J. L. Morin, I. Islam and A. H. Castro Neto, Dent. Mater., 2016, 32, 1019–1025 CrossRef CAS PubMed.
  52. A. Pattammattel, P. Pande, D. Kuttappan, M. Puglia, A. K. Basu, M. A. Amalaradjou and C. V. Kumar, Langmuir, 2017, 33, 14184–14194 CrossRef CAS PubMed.
  53. A. A. Volponi, L. K. Zaugg, V. Neves, Y. Liu and P. T. Sharpe, Curr. Oral Health Rep., 2018, 5, 295–303 CrossRef PubMed.
  54. M. Goldberg, A. B. Kulkarni, M. Young and A. Boskey, Front. Biosci., 2011, 3, 711–735 CrossRef PubMed.
  55. P. D. Potdar and Y. D. Jethmalani, World J. Stem Cells, 2015, 7, 839–851 CrossRef PubMed.
  56. Y. Chen, Y. Zhang, A. Ramachandran and A. George, J. Dent. Res., 2015, 95, 302–310 CrossRef PubMed.
  57. B. L. Foster, M. Ao, C. R. Salmon, M. B. Chavez, T. N. Kolli, A. B. Tran, E. Y. Chu, K. R. Kantovitz, M. Yadav, S. Narisawa, J. L. Millán, F. H. Nociti Jr and M. J. Somerman, Bone, 2018, 107, 196–207 CrossRef CAS PubMed.
  58. X. Jiang, J. Zhao, S. Wang, X. Sun, X. Zhang, J. Chen, D. L. Kaplan and Z. Zhang, Biomaterials, 2009, 30, 4522–4532 CrossRef CAS PubMed.
  59. M. Li, P. Xiong, F. Yan, S. Li, C. Ren, Z. Yin, A. Li, H. Li, X. Ji, Y. Zheng and Y. Cheng, Bioact. Mater., 2018, 3, 1–18 CrossRef PubMed.
  60. S. Liu, T. H. Zeng, M. Hofmann, E. Burcombe, J. Wei, R. Jiang, J. Kong and Y. Chen, ACS Nano, 2011, 5, 6971–6980 CrossRef CAS PubMed.
  61. W. C. Lee, C. H. Y. X. Lim, H. Shi, L. A. L. Tang, Y. Wang, C. Lim and K. P. Loh, ACS Nano, 2011, 5, 7334–7341 CrossRef CAS PubMed.
  62. X. F. Zou, L. Zhang, Z. J. Wang and Y. Luo, J. Am. Chem. Soc., 2016, 138, 2064–2077 CrossRef CAS PubMed.
  63. Y. L. F. Musico, C. M. Santos, M. L. P. Dalida and D. F. Rodrigues, ACS Sustainable Chem. Eng., 2014, 2, 1559–1565 CrossRef CAS.
  64. C. Zhao, X. Lu, C. Zanden and J. Liu, Biomed. Mater., 2015, 10, 015019 CrossRef PubMed.
  65. T. S. Su and J. Sun, J. Prosthodont. Res., 2015, 59, 236–242 CrossRef PubMed.
  66. S. J. Lee and G. O. Gallucci, Clin. Oral. Implants Res., 2012, 24, 111–115 CrossRef PubMed.
  67. S. Logozzo, E. M. Zanetti, G. Franceschini, A. Kilpela and A. Mäkynen, Opt. Laser Eng., 2014, 54, 203–221 CrossRef.
  68. F. Duret, J. L. Blouin and B. Duret, J. Am. Dent. Assoc., 1988, 117, 715–720 CrossRef CAS PubMed.
  69. F. Beuer, J. Schweiger and D. Edelhoff, Br. Dent. J., 2008, 204, 505–511 CrossRef CAS PubMed.
  70. C. A. Fernandesa, J. C. Ribeiroa, B. S. Larsonb, E. A. Bonfanteb, N. R. Silvab, M. Suzukic, V. P. Thompsonb and P. G. Coelho, Dent. Mater., 2009, 25, 655–661 CrossRef PubMed.
  71. C. Wadhwani and K. H. Chung, J. Prosthet. Dent., 2015, 114, 660–665 CrossRef CAS PubMed.
  72. C. Charles, Biomaterials, 1998, 19, 589–591 CrossRef CAS PubMed.
  73. G. C. Rene, S. V. R. Jose, C. B. Rosalía, S. Hiroshi and M. L. R. Alberto, J. Appl. Oral Sci., 2015, 23, 321–328 CrossRef PubMed.
  74. J. W. Nicholson, J. H. Braybrook and E. A. Wasson, J. Biomater. Sci., Polym. Ed., 1991, 2, 277–285 CrossRef CAS PubMed.
  75. A. B. Hummon, S. R. Lim, M. J. Difilippantonio and T. Ried, Biotechniques, 2007, 42, 467–472 CrossRef CAS PubMed.

Footnotes

Electronic supplementary information (ESI) available. See DOI: 10.1039/d0tb00697a
N. Sun and S. Yin contributed equally to this work.

This journal is © The Royal Society of Chemistry 2020