A hand-held device for rapid single tube detection of hepatitis-C virus

Naqeebullah Jogezai and Muhammad Imran Shabbir *
Department of Bioinformatics and Biotechnology, Faculty of Basic & Applied Sciences, International Islamic University, Sector H-10, Islamabad, Pakistan. Tel: +92 51 9019417 Tel: +92 323 7577258E-mail: imran.shabbir@iiu.edu.pk

Received 10th April 2018 , Accepted 15th July 2018

First published on 16th July 2018


Hepatitis C virus (HCV) is a major threat to public health being the leading cause of chronic liver disease with 92 to 149 million people affected worldwide. A rapid and accurate diagnosis is a key to prevent viral transmission and the management of disease progression. Here we describe a hand-held device for rapid detection of HCV infection called as STALLION (Single Tube Analysis using LAMP, LED and ION-sensing). A custom detection probe was designed to dip into a PCR tube. The probe comprises an ion sensitive field effect transistor (ISFET), a micro-capillary based Ag/AgCl reference electrode and a temperature sensor. In vitro replication of HCV genomic RNA was performed by reverse transcription loop-mediated isothermal amplification (RT-LAMP) and detected in real-time by ISFET bio-sensing of released H+ ions. Incubation at 60 °C was provided by a novel low-cost concept based on heat dissipated from power LED(s). With this system, HCV positive samples with 101, 102, 103 copies per ml were detected in as less as 30, 18 and 13 minutes respectively compared to no-template control (NTC). The detection limit was comparable to those of available methods such as nested PCR. No significant false positive signal was observed for HCV negative samples. The results can be viewed on an accompanying LCD screen or alternatively can be transferred to a computer or smart phone. The STALLION system provides analysis in a conventional PCR tube format avoiding any complex fluidics or instrumentation requirements. Such a system will be particularly useful for rapid and reliable clinical diagnosis of HCV RNA by users with no prior expertise and provide the basis for point-of-care (POC) testing in limited resource settings especially for developing countries.


1. Introduction

Hepatitis C virus (HCV) is a major public health threat as one of the leading causes of chronic liver disease, affecting over a million people worldwide. A rapid and accurate diagnosis is key to preventing viral transmission and management of disease progression. Hepatitis C virus (HCV) is a small (55–65 nm) enveloped virus of the family Flaviviridae.1 HCV has a positive sense single-stranded RNA genome and is classified as a group IV type virus. The genome consists of a single open reading frame that spans ∼9600 nucleotides.2 HCV has seven major genotypes (1–7) and about 80 subtypes.3–5 HCV infection is a major cause of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma.1 Therapeutic options are improving, but are still limited, and no vaccine is available to prevent new infections.6,7 Serological testing (for anti-HCV antibodies in blood) indicates anywhere from 92 to 149 million people are affected. However, based on positivity for HCV RNA, approximately 62–79 million individuals are affected with HCV infection. There is a considerable variation in HCV prevalence across the globe. A small percentage of global HCV infection is found in western countries, however, approximately half of the total HCV infection is accounted from China, Pakistan, India, Egypt and Russia.8,9

A rapid and accurate diagnosis of HCV is important for the prevention of viral transmission and management of disease progression. Liver biopsy cannot normally be prescribed due to its invasive methodology. Immunoassays, in the form of lateral flow strip tests are commercially available and are commonly performed to detect HCV derived antigens or antibodies as initial screening tests.10 Such commercially available diagnostic tests employing single-use kits represent significant monetary costs for hospitals and private clinics.11 Further, testing for circulating HCV by genomic sequence amplification is considered the most reliable method for the confirmation of serological results and also serves as an indicator for the effectiveness of antiviral therapy.6,12,13 These tests including reverse transcriptase PCR,14 nucleic-acid-sequence-based amplification,15 branched-chain DNA assay,16 transcription-mediated amplification17 and in-house real-time PCR18 have been developed for the detection of HCV RNA. These assays, whether qualitative or quantitative, are relatively time-consuming, labor-intensive, and dependent on specialized and expensive equipment. There is a need for the development of sensitive, simple, cost-effective, and rapid diagnostic techniques for HCV detection.

In this study, we developed a hand-held device that provides a simple, cost-effective, real-time detection of HCV RNA. This system employs an ISFET (ion sensitive field effect transistor), LAMP (loop mediated amplification) and a power LED (light emitting diode) to amplify and analyze the nucleic acid in a single tube; hence it was named as STALLION (Single Tube Analysis using LAMP, LED and ION-sensing). The device uses Reverse Transcription Loop mediated isothermal amplification (RT-LAMP) to convert viral RNA to cDNA and simultaneously amplify the cDNA. Isothermal incubation at 60 °C is achieved by a novel concept using power LED based heating. The amplification of cDNA is detected in real-time by a label-free method of sensing H+ ions released during nucleic acid replication with an ISFET sensor (Fig. 1 and 2). Based on comparisons using clinical specimens, the sensitivity of STALLION was found comparable to that of benchtop conventional nested-PCR.28 Therefore, STALLION could potentially serve as a valuable diagnostic tool for laboratories, hospitals and POC in low-resource settings.


image file: c8ay00802g-f1.tif
Fig. 1 Stallion device and its components. (A) Hand-held top view of the stallion device with an LCD, microcontroller, battery and two detection probes inserted into the PCR tubes held in place between the pair of power LEDs for heat incubation, (B) side view of the stallion device, (C) separate components of the detection probe including an ISFET sensor, microcapillary based Ag/AgCl reference electrode (RE) and thermistor (t °C) coated with a non-conducting material, (D) assembled detection probe through the cap of the PCR tube containing an ISFET, RE and t °c, (E) LED heating unit described along with a scale of Pakistani coin of five rupees, (F) detection probe placed inside the PCR tube and aluminum foil for wrapping around the tube, (G) aluminum foil fixed in between the heating unit LEDs, and (H) working assembly of the heating unit with aluminum foil around the PCR tube while containing the LAMP mix and detection probe inside the tube.

image file: c8ay00802g-f2.tif
Fig. 2 Schematic representation of the STALLION system. (A) Block diagram of integrated working of the STALLION system. (B) Working principle of ISFET based detection of nucleic acid synthesis. (C) STALLION system on a printed circuit board comprising the control electronics, detection probe and LED based heating unit (left to right). The single tube reaction can be prepared by (1) taking viral RNA with the RT-LAMP mix, (2) wrapping aluminum foil around the tapered part of the tube and (3) inserting the tube into the LED based heating area. (D) Complete STALLION setup while working including (4) insertion of the detection probe into the tube and (5) data retrieval via the on-board LCD or USB connected to a computer or smart phone.

2. Experimental

2.1. Ethics statement and clinical samples

This study was approved by the Ethical Review Committee (ERC) of Department of Bioinformatics and Biotechnology, International Islamic University, Islamabad, Pakistan and conducted according to the principles expressed in the Declaration of Helsinki. Informed verbal consent from all the participants was taken before the study. No minor was included in the study. Consent was not waived by ERC. A total of thirty HCV positive samples were obtained from patients who were clinically diagnosed with HCV infection and confirmed with nested PCR analysis. As a control, fifteen confirmed negative clinical samples were also used. Blood samples were collected through venipuncture in VACUETTE® blood collection tubes (Greiner Bio-One International, GMBH) containing heparin as an anti-coagulant. Serum was separated from the collected blood samples for RNA extraction.

2.2. Viral RNA extraction

Viral RNA extraction was performed using the QIAamp viral mini kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. A Laboratory HCV standard panel made with the Cobas Amplicor HCV Monitor Test (Roche Diagnostic Systems, Pleasanton, CA, USA) was used to make dilutions of the HCV positive samples according to the required copy number. A ten-fold dilution series of HCV viral RNA was made from extracted samples including 101, 102 and 103 copies per ml. Samples were tested against a negative control without template (no template control = NTC) prepared from HCV-negative plasma samples. Another negative control without template and primers (no template and primer control = NTPC) was also tested.

2.3. Primer design for the RT-LAMP reaction

Sequence-specific primers from the 5′ UTR region (216 bp) ranging from 99–314 bp of HCV genome (GenBank accession no. AY051292) were designed using Primer Explorer V4 software (http:/primerexplorer.jp/lamp). This LAMP primer set includes a forward outer primer (F3), backward outer primer (B3), forward inner primer (FIP) and backward inner primer (BIP). Two additional loop primers including a forward loop primer (FLP) and backward loop primer (BLP) were incorporated to accelerate the amplification reaction.19 A T-linker with four nucleotides (TTTT) was used for FIP and BIP for increased flexibility as indicated in bold letters (Table 1).
Table 1 Primer set from the 5′-UTR of the HCV genome for the RNA RT-LAMP reaction
Oligo name Oligo type Length (position) Sequence direction (5′ → 3′)
F3 Forward outer 17 (99–115) AGTGTCGTGCAGCCTCC
B3 Backward outer 19 (296–314) GCACTCGCAAGCACCCTAT
FIP Forward inner primer (F1c + TTTT + F2) 42 (F1c: 166–185; F2: 129–146) CGGTCGTCCTGGCAATTCCGTTTTCCGGGAGAGCCATAGTGG
BIP Backward inner primer (B1c + TTTT + B2) 44 (B1c: 198–219; B2: 261–283) TTGGATCAACCCGCTCAATGCCTTTTCCTTTCGCGACCCAACAC
FLP Forward loop primer 17 (147–163) CTCACCGGTTCCGCAGA
BLP Backward loop primer 19 (234–252) TGCCCCCGCAAGACTGCTA


2.4. Designing of the STALLION device

The STALLION device (Fig. 1A and B) consists of three major components including a detection probe, heating unit and control electronics (Fig. 1 and 2).
2.4.1. Detection probe. The detection probe is a dip-type probe designed for insertion in a 200 μl PCR tube. The probe comprises an ISFET sensor, a reference electrode, and a temperature sensor (Fig. 1C and D). The n-channel ISFET was obtained from Winsense Corporation, Thailand. The microcapillary-based Ag/AgCl reference electrode (RE) was custom designed to fit into the PCR tube along with the other sensors. A microcapillary of known internal diameter of approximately 200 μm was used for the RE (Sigma-Aldrich Corporation, St. Louis, MO, USA). The tip of the microcapillary was filled with 3.3 mol L−1 agar gel. A very thin round silver (Ag) wire of 30 gauge (0.01 inch) was used for the fabrication of the reference electrode. An approximately 1 cm length (measured from the tip) of the Ag wire was coated with silver chloride (AgCl). The Ag/AgCl wire was inserted into the microcapillary which was then filled with 3.3 mol L−1 of KCl solution. For temperature measurements and thermal control, a 10 KΩ NTeC (negative temperature coefficient) thermistor was used after coating its wires with an electrically insulating material.
2.4.2. Heating unit. Power LEDs (light-emitting diodes) are used to heat the PCR reaction tubes to the required incubation temperature. Two power LEDs (1 watt each) were fixed in a slightly inclined position and the negative terminals of both LEDs are joined with a wire in a ring shape to hold the PCR tube (Fig. 1E). For efficient heat distribution, the PCR tube can be wrapped with aluminum foil before insertion between the LEDs (Fig. 1F). Alternatively, the heating unit can be designed with fixed aluminum or thin tin foil between the LEDs (Fig. 1G). For proof-of-concept, the heating unit was designed to hold only two PCR tubes to accommodate a sample and control for testing (Fig. 1H).
2.4.3. Instrumentation. Arduino nano (Version 3.0) is an open-source Atmel ATmega328 processor based microcontroller board. The analog inputs of Arduino nano were used for ISFETs (through ISFET amplifier) and thermistors whereas power LEDs were controlled by digital outputs through relay switches. The ISFET amplifier circuit configuration keeps a constant drain current and voltage providing an output voltage linearly dependent on the pH level of the solution under tests (Fig. 1A and 2A). ISFET detects released H+ ions during the in vitro replication of nucleic acid at the incubation temperature (Fig. 2B). The microcontroller was programmed with the help of Arduino IDE (Integrated Development Environment) (https://www.arduino.cc/). An LCD is digitally controlled by the microcontroller and displays the results in real time (Fig. 1A and 2C and D). Real-time data were also transferred to a computer through a universal serial bus (USB) and displayed in a computer using PLX-DAQ plugin (Parallax Inc., Rocklin, CA, USA) for Microsoft Excel (Microsoft Corporation, Redmond, WA, USA) (Fig. S1). Alternatively, the data can also be transferred to a smart phone using any Arduino based data plotter application (Fig. 2D).

2.5. Reaction in a single tube

The final optimized reaction mix contained 50 mM KCl, 5 mM MgSO4, 5 mM (NH4)2SO4, 1 mg ml−1 BSA, 0.4 M betaine (Sigma-Aldrich, Dorset, UK), 4 mM KOH, 1.4 mM dNTPs, 8U of Bst DNA polymerase large fragment (New England Biolabs), LAMP primers (1.6 μM each of FIP and BIP, 0.2 μM each of F3 and B3, and 0.4 μM each of loop-F and loop-B), 2.25U of AMV (Avian Myeloblastosis Virus) reverse transcriptase (Life Technologies) and 10 μl template (HCV RNA), with the final reaction volume adjusted to 75 μl with H2O. The RT-LAMP reaction conditions for one-step reverse transcription and DNA amplification were set at heating incubation at 60 °C for 60 minutes, with a reading taken every second. Different steps in setting up a single tube reaction are depicted in Fig. 2C and D. A schematic view of the location, sequences, priming sites and amplification orientations of HCV RT-LAMP primers in the target region is shown in Fig. 3. After completion of the reaction, the detection probes were treated with DNAZap™ (Invitrogen by Life Technologies, Carlsbad, CA, USA) capable of degrading both RNA and DNA followed by rinsing with distilled water. This treatment renders the detection probe clean and usable for testing further samples.
image file: c8ay00802g-f3.tif
Fig. 3 Schematic representation of the location and sequences of HCV RT-LAMP primers. (A) Location and sequence of the HCV RT-LAMP target and priming sites and (B) annealing positions and amplification orientations of the RT-LAMP primers on the selected 216-BP target sequence of the HCV genome.

3. Results and discussion

3.1. Designing of the STALLION device

Laboratory equipment for genetic studies including nucleic acid based diagnostics is well established and reliable. However, in several real-world situations, such equipment can be considered as impractical when there is a need for diagnostic testing at remote settings. We developed a hand held system for rapid molecular detection of HCV infection called as STALLION (Single Tube Analysis using LAMP, LED and ION-sensing). The STALLION device is comprised of a detection probe, power LED based heating unit and control electronics. The detection probe was designed to dip into the PCR tube comprising an ISFET, an Ag/AgCl reference electrode (RE) and a temperature sensor. HCV genomic RNA in a single PCR tube was reverse transcribed and the resulting cDNA was amplified by loop-mediated isothermal amplification (RT-LAMP) performed at 60 °C. Heat incubation was provided by a very low cost novel concept using dissipated heat from the power LED. The device was powered by a 9 volt battery.

LAMP is a very rapid, accurate and reliable nucleic acid testing method.20 This method uses a DNA polymerase with strand–displacement activity, along with two outer primers (F3, B3) and two inner primers (FIP, BIP) to facilitate an auto-cycling process. Using forward and backward loop primers (FLP and BLP) further accelerates and enhances the sensitivity of the LAMP assay.21 To detect RNA, reverse transcription (RT) is included along with isothermal DNA amplification and known as RT-LAMP. A number of RNA viruses have been reported to be successfully detected with RT-LAMP including mumps virus,22 West Nile virus,23 and HIV-1[thin space (1/6-em)]24 as well as hepatitis viruses including hepatitis A virus,25 hepatitis B virus,26 hepatitis C virus27,28 and hepatitis E virus.29 Despite the practical advantages of the LAMP technique, the detection technologies for LAMP amplicons are mainly based on fluorescence,18 electrophoresis,30,31 turbidity of magnesium pyrophosphate,32 and resistance of metal ions33,34 as well as electrochemical detection of an electro-active reagent.35,36 All of these require accurate detection through bulky and costly laboratory-based instruments. Recently, some reports described semiconductor-based sensing using an ISFET for the detection of DNA amplification by the LAMP method;37–39 however, there is no single tube-based method with hand-held and portable instrumentation. The STALLION system provides analysis in a conventional PCR tube format avoiding any complex fluidics or instrumentation requirements.

3.2. Working of the sensing probe

In our device, the ISFET in the detection probe effectively works as a bio-sensing element for the detection of in vitro replication of viral nucleic acid by directly measuring the released hydrogen ions during the nucleic acid polymerization process. The sensor used here is an n-type ISFET with an Si3N4 (silicon nitride) insulating gate and operates as a MOSFET at a constant drain-to-source voltage Vds of 0.3 V and drain-to-source current Ids of 30 μA. The output voltage or ISFET potential (in mV) is measured by finding the change in reference electrode voltage Vref to maintain fixed drain current Id. The ISFET potential shows a linear relation with pH of the solution under tests with a sensitivity of 45–53 mV per pH unit (Fig. 4A) against a stable RE. A glass microcapillary based Ag/AgCl reference electrode was designed in order to fit into the PCR tube along with the other sensors. The electrode exhibited a constant electrode potential and excellent stability for 7.5 days in test solutions from pH 5.5 to 9. However, for long-term performance, the RE can be designed with a more stable porous material (e.g., VYCORE frit). The ISFET potential (mV) drops with a drop in pH (increase in H+ ions) (Fig. 4A), and therefore as the DNA is synthesized more and more (during RT-LAMP reaction), the observed mV will drop from its starting value (Fig. 4B and C). According to the specifications of the ISFET manufacturer (Winsense Corporation, Thailand), since the charge carriers of the n-channel ISFET are electrons, more +ve charge (H+) on the gate allows applying less gate voltage to turn on the ISFET. Therefore, the lower the pH, more positive ions (H+) interact with the gate, and less gate voltage is needed to turn on the ISFET at the pre-set current. On the other hand, if the ISFET is of the p-type channel, it will have positive charge carriers (i.e., holes), with the opposite trend of voltage vs. pH. A 10 KΩ NTeC (negative temperature coefficient) thermistor is used for temperature measurements and thermal control (Fig. 1C and D).
image file: c8ay00802g-f4.tif
Fig. 4 Different measurements made with the STALLION device. (A) Relationship between the gate output potential of control and sample ISFETs at different pH, (B) normalized ISFET real time amplification curves representing no amplification in the negative control (NTPC), some amplification in the negative control (NTC) and strong amplification in the positive sample, (C) normalized ISFET real time amplification curves for LAMP amplification of NTPC, NTC, 101, 103 and 105 copies per ml sample, (D) general trend of pH change with respect to time during LAMP amplification, and (E) general trend of ISFET potential change (ΔmV) with respect to time during LAMP amplification. Dissected line shows the ΔmV cutoff for positive samples compared to NTC. (F) Representative images of real time results as displayed on the LCD screen for the sample (SAMP) and NTPC (Cont) taken at ∼2.5 minutes (02::32) and ∼30 minutes (30::13) time with second line displaying the result status (+ve or −ve) at the current stage based on the potential difference (ΔmV) observed (displayed in the third line) and fourth line displaying the current temperature in °C in the PCR tube, (G) potential difference observed in different control and sample types in the first 30 and then from 30–60 minutes. Dissected line shows the ΔmV cutoff for positive samples compared to NTC, (H) thermal performance of LEDs as a comparison of achieved temperature measured using the thermistor versus temperature set point with and without the use of aluminum (Al) foil around the PCR tube, and (I) normalized effect of LED light on the performance of the ISFET sensor. NTPC = no template and primer control, NTC = no template control, and DR = detection range of mV in 30 and 30–60 minutes.

3.3. Enhanced H+ ion detection conditions

In any typical DNA amplification reaction, due to buffered conditions, all released protons are consumed and no noticeable change in pH can be observed. We performed all RT-LAMP reactions under low buffering conditions so that changes in pH can be readily detected by the ISFET sensor without compromising the amplification efficiency and specificity of the reaction. This was achieved by removing potential buffering compounds (Tris–HCl) along with minimizing the electrolyte (NH4+) concentration as much as possible. Several other reports describe the use of low buffering conditions to make H+ ion detection possible.37–39

3.4. Changes in pH during RT-LAMP in different time zones

Typically, the reaction pH before amplification (at 0 min) is around 8.8. After 60 minutes, a change in pH typically from approximately 2.5 to 3.0 units can be observed. The trend in the change in ISFET potential (mV) (Fig. 4B and C) and the corresponding change in pH (ΔpH) (Fig. 4D) is shown here for three time frames of the real-time curve, ranging from time 0 to 60 minutes. First, a quick drop in mV is observed due to the increase in temperature from ambient temperature to the required incubation temperature of 60 °C within the first 1–2 minutes (Fig. 4B and C), which leads to a change in more than one pH unit (Fig. 4D). The ISFET has a temperature coefficient of 1.29 mV °C−1 (pH = 10), 1.84 mV °C−1 (pH = 7) and 2.15 mV °C−1 (pH = 4) (http://www.winsense.co.th/item/item_image/winsense_isfet_ph_sensor_wips_datasheet.pdf). The RT-LAMP reaction typically operates between pH 9 and 6. During our RT-LAMP reaction, the ISFET temperature co-efficient was observed to be 1.73 mV °C−1 during this phase, starting from the initial pH of 8.8 of the RT-LAMP solution with a rate of change of 0.0325 pH units per °C. This change can be observed for no template and primer control (NTPC), and no template control (NTC) as well as for the positive sample (Fig. 4D). Second, after reaching the incubation temperature, the LAMP reaction starts and a consistent drop in mV can be observed, most commonly for up to 30 minutes of the reaction in the HCV RNA positive sample. This corresponds to approximately 40–80 mV or higher depending upon the starting concentration of viral RNA (Fig. 4B, C and G). No significant change was observed in NTPC; however, approximately 31 mV change can be observed in NTC, which could be surprising for a non-technical user (Fig. 4B, C, E–G). Although RT-LAMP is highly specific in recognizing a template sequence, even without template, it can still result in substantial background or non-template amplification that depends on primer design and reaction conditions.40,41 LAMP primers can form dimers and other secondary structures which can provide spurious DNA replication. Third, a small change in mV occurs from 30–60 minutes in NTPC; however the positive sample may yield a 45 to 55 mV change, or more, depending on the initial amount of viral RNA (Fig. 4B, C, E–G).

3.5. Real-time analysis

As temperature increases, there is an increase in the dissociation of the solution (electrolytes) depending upon composition and buffering, so there will be a corresponding decrease in pH (https://chem.libretexts.org/Core/Physical_and_Theoretical_Chemistry/Acids_and_Bases/Acids_and_Bases_in_Aqueous_Solutions/The_pH_Scale/Temperature_Dependence_of_the_pH_of_pure_Water). Compensation for temperature can be done to rule out the temperature effects. However, temperature compensation is not done in the present work. The change in mV in reaching incubation temperature is not considered for interpreting results (Fig. 4E). Instead, the results are based on changes in ISFET potential (ΔmV) calculated by subtracting the minimum ISFET potential (mVmin) at the incubation temperature (60 °C) from the maximum ISFET potential (mVmax) at incubation temperature at any given time.
ΔmV = mVmax − mVmin

Typical real-time images from the LCD screen of the STALLION device are presented after reaching the incubation temperature (60 °C) and after 30 minutes for a random positive sample along with NTC in Fig. 4F. At 60 minutes, the average ΔmV values observed for control(s) NTPC and NTC were less than 10 mV and 40 mV, respectively, and the HCV positive dilution series of 101, 102 and 103 copies per ml was approximately 83 mV, 94 mV and 98 mV, respectively. For a positive sample, ΔmV may vary from 0 to 80 mV or higher in the first 30 minutes, and from 40 to 100 or higher from 30–60 minutes depending upon the initial copy number in the sample, measured with respect to NTC in the defined detection range (DR) and respective time frames (Fig. 4G). The cut-off value for the positive test was set to 40 mV against NTC and the results on the LCD for a positive sample are displayed from −ve to +ve, after crossing this cut-off value (Fig. 4F). HCV positive samples with as low as 10 copies per ml can be detected within 30–35 minutes time. Higher than 100 copies per ml can be detected within 10–20 minutes of the reaction (Fig. 4E). Viral RNA of hepatitis C was detected in all 30 tested-positive samples and was absent in the 15 negative-tested samples. The results from the STALLION device can be viewed in real-time on an LCD screen (Fig. 1A and 4F) or alternatively can be transferred to a computer through Microsoft Excel using PLX-DAQ plug-in (Fig. S1). Data can also be transferred to a smart phone by using any Arduino based data plotter application (e.g., Arduinodroid).

3.6. Power LED as the heating source

Two power LEDs of 1 Watt each were used as a heating source. To estimate the heating performance, the LED was tested for maintaining the temperature at 65 °C for one hour (Fig. S2) at thirty different occasions and no problem was observed. Also different colored LEDs were tested and no observable difference was there in the heating performance. The average heating rate was found to be 0.58 °C per second. Without using a heat-sink, the life and performance of such types of LEDs will be seriously degraded. In the STALLION system, this LED dissipated heat is distributed to the LAMP reaction mix in the PCR tube quickly and evenly using aluminum foil which in turn acts as a heat spreader and sink for the LED and protects it from damage (Fig. 1F–H). Without aluminum foil, the set temperature cannot be achieved due to relatively uneven heat distribution around the tube (Fig. 1H). Using thermal paste between the LED heating area and aluminum foil further stabilizes the heating process. Further, both LEDs turn on and off alternatively after one another, thus avoiding long term turning on one LED which also ensures their long term use. The aluminum foil also protects the reaction mix from LED light as the ISFET is sensitive to light. LED light exposure can considerably affect the ISFET performance (Winsense Corporation, Thailand); however, no significant change was observed in ISFET potential when using aluminum foil around the reaction tube (Fig. 4I). In order to avoid manual labor related to aluminum foil, alternatively, a fixed aluminum or thin tin foil assembly on LEDs can also be made (Fig. 1G).

3.7. Cost breakdown

STALLION devices use cheap and easily available components yet provide rapid and reliable results. Main components (with their prices) include ISFET sensors ($50 each), an ISFET amplifier ($40), a microcontroller ($6), low current solid-state relay switches in an integrated circuit form ($10), an LCD screen ($4), 1 W power LEDs (<$1), a temperature sensor (<$1), and a 9 V battery ($1) and the assembling cost is $7. The RNA extraction cost was estimated to be $1.2 whereas the cost of the RT-LAMP reaction mix (including primers, enzymes, dNTPs and other reagents) for a single reaction was $1.0. In total, the proof of the concept of the STALLION device was prepared with approximately $170 which is considerably cheaper than the instruments available in the market. A STALLION device with eight PCR tube capacities will cost around $470. By comparison, using a conventional quantitative thermal cycler instrument (priced at $20[thin space (1/6-em)]000–30[thin space (1/6-em)]000) is very costly and not well suited for the low-resource developing world.

3.8. Scalability

The STALLION system provides a complete system to perform RT-LAMP (from RNA source) or LAMP (from DNA source), and easy scalability for performing other isothermal nucleic acid amplification tests using specific primer sets and standardization accordingly. The device is presented in open form (Fig. 1A and B) displaying its different components. For this device, RNA was extracted using a QIAamp viral mini kit (Qiagen, Hilden, Germany), however to comply with point-of-care settings, RNA isolation can be performed as described elsewhere.42 The current setup of the STALLION detection probe can be used with 75 μl reaction volume as well. Further design improvement of the detection probe using the micro-fabricated temperature sensor and reference electrode can reduce the required reaction volume. The dip type probe ISFET sensor system can also be made disposable using the detachable extended gate ISFET sensor. Also as proof of concept, the STALLION device is capable of performing two test reactions in real-time (Fig. 1B and G), however, for a full scale commercial device, it can be extended further to perform more reactions as required.

3.9. Sensitivity and specificity

For specificity testing of HCV LAMP primers, previously confirmed HCV positive and negative samples along with negative controls were used. Primers were also tested for nonspecific amplification in other viruses including HIV and HBV and no amplification was observed.

For sensitivity testing, serial dilutions of 101, 102 and 103 copies per ml made from a sample with a predetermined copy number (103 copies per ml) were tested along with negative controls using the STALLION system. All three dilutions with 101, 102 and 103 copies per ml were amplified and the sensitivity was comparable to that of nested PCR. A few reports describe the sensitivity by amplification of a single copy of nucleic acid template by self-digitization and then reverse transcription or LAMP amplification.43,44

3.10. Detection interference studies

The RT-LAMP assay on the STALLION device was further analyzed for its ability to specifically detect HCV in the presence of non-target nucleic acids. HCV-RNA was tested in the presence of human immuno-deficiency virus (HIV) and hepatitis B virus (HBV) nucleic acids. Real-time ISFET potential(s) recorded against the background of HIV and HBV nucleic acids showed no inhibition in amplification of HCV RNA. No significant change in ISFET potential was observed in non-templated negative control NTC, and two of the templated negative controls HIV-RNA and HBV-DNA. However, very significant changes in ISFET potential(s) were observed in two mixed-templated reactions (HCV + HIV and HCV + HBV) comparable to only the HCV templated reaction (Fig. S3).

4. Conclusion

Current implementations of RT-LAMP require the use of expensive and bulky equipment including opto-electrical detection systems and temperature control instruments, as well as different fluorescent dye labeling or intercalation of redox active molecules. Alternatively, several other ways have been demonstrated using microfluidic platforms, but their readiness for near-term point-of-care diagnostics applications is not established. We have demonstrated a PCR tube based RT-LAMP assay using an in-house developed STALLION system which eliminated the need for all of the above providing a simple detection scheme based on monitoring the pH changes during the reaction. The device reported here provides rapid amplification, simple operation, cost-effective, label-free and real-time detection. Such a system will be particularly useful for fast and reliable clinical diagnosis of HCV RNA with minimal training in resource-limited settings, especially for developing countries. The LCD screen and hand-held size make it suitable for use as a field deployable point-of-care device for the detection of HCV viral RNA. Further this device can be adapted to detect other viruses, bacteria or virtually any RNA/DNA target which could be amplified by LAMP.

Conflicts of interest

There are no conflicts to declare.

Acknowledgements

We are grateful to the patients and healthy individuals for their participation in this study. We are thankful to Dr Haim H. Bau and Dr Changchun Liu from the University of Pennsylvania, Philadelphia, USA for their helpful suggestions and Dr Michael G Mauk from Drexel University, Philadelphia, USA for editing this manuscript and valuable input. The study was supported by the Higher Education Commission, Islamabad, Pakistan; Research Project No. HEC/R&D/PAK-US/2017/783 approved under the PAK-US Science & Technology Cooperation Program, Phase-VII. This research work is a part of the PhD thesis of Mr Naqeebullah.

References

  1. V. Brass, D. Moradpour and H. E. Blum, Int. J. Med. Sci., 2006, 3, 29 CrossRef PubMed.
  2. N. Kato, Microb. Comp. Genom., 2000, 5, 129–151 CrossRef PubMed.
  3. M. Backmund, K. Meyer, M. Von Zielonka and D. Eichenlaub, Hepatology, 2001, 34, 188–193 CrossRef PubMed.
  4. C. Kuiken and P. Simmonds, Hepatitis C: Methods and Protocols, 2009, pp. 33–53 Search PubMed.
  5. J. M. Gottwein, T. K. Scheel, T. B. Jensen, J. B. Lademann, J. C. Prentoe, M. L. Knudsen, A. M. Hoegh and J. Bukh, Hepatology, 2009, 49, 364–377 CrossRef PubMed.
  6. D. B. Strader, T. Wright, D. L. Thomas and L. B. Seeff, Hepatology, 2004, 39, 1147–1171 CrossRef PubMed.
  7. G. T. Strickland, S. S. El-Kamary, P. Klenerman and A. Nicosia, Lancet Infect. Dis., 2008, 8, 379–386 CrossRef PubMed.
  8. E. Gower, C. Estes, S. Blach, K. Razavi-Shearer and H. Razavi, J. Hepatol., 2014, 61, S45–S57 CrossRef PubMed.
  9. M. P. Manns, M. Buti, E. Gane, J.-M. Pawlotsky, H. Razavi, N. Terrault and Z. Younossi, Nat. Rev. Dis. Primers, 2017, 3, 17006 CrossRef PubMed.
  10. M. Heiat, R. Ranjbar and S. M. Alavian, Hepat. Mon., 2014, 14 Search PubMed.
  11. J. M. Pawlotsky, Hepatology, 2002, 36, S65–S73 Search PubMed.
  12. S. Chevaliez and J.-M. Pawlotsky, Int. J. Med. Sci., 2006, 3, 35 CrossRef PubMed.
  13. T. Wong and S. S. Lee, Can. Med. Assoc. J., 2006, 174, 649–659 CrossRef PubMed.
  14. I. Gonzalez-Perez, A. Vina-Rodriguez, A. A. Cayarga, I. G. de la Rosa and Y. J. G. González, Anal. Biochem., 2003, 315, 281–284 CrossRef PubMed.
  15. A. Guichón, H. Chiparelli, A. Martınez, C. Rodrıguez, A. Trento, J. C. Russi and G. Carballal, J. Clin. Virol., 2004, 29, 84–91 CrossRef.
  16. C. Sarrazin, B. C. Gärtner, D. Sizmann, R. Babiel, U. Mihm, W. P. Hofmann, M. von Wagner and S. Zeuzem, J. Clin. Microbiol., 2006, 44, 729–737 CrossRef PubMed.
  17. Y. Wei, C. Yang, B. Wei, J. Huang, L. Wang, S. Meng, R. Zhang and J. Li, J. Clin. Microbiol., 2008, 46, 1734–1740 CrossRef PubMed.
  18. H. D. J. Daniel, G. M. Chandy and P. Abraham, Diagn. Microbiol. Infect. Dis., 2008, 61, 415–420 CrossRef PubMed.
  19. V. Lakshmi, M. Neeraja, V. Lavanya, E. Priyanka and S. Sharma, J. Emerg. Dis. Virol., 2016, 2 DOI:10.16966/2473-1846.111.
  20. T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino and T. Hase, Nucleic Acids Res., 2000, 28, e63 CrossRef PubMed.
  21. K. Nagamine, T. Hase and T. Notomi, Mol. Cell. Probes, 2002, 16, 223–229 CrossRef PubMed.
  22. N. Yoshida, M. Fujino, A. Miyata, T. Nagai, M. Kamada, H. Sakiyama, T. Ihara, T. Kumagai, T. Okafuji and T. Okafuji, J. Med. Virol., 2008, 80, 517–523 CrossRef PubMed.
  23. M. Parida, G. Posadas, S. Inoue, F. Hasebe and K. Morita, J. Clin. Microbiol., 2004, 42, 257–263 CrossRef PubMed.
  24. K. A. Curtis, D. L. Rudolph and S. M. Owen, J. Med. Virol., 2009, 81, 966–972 CrossRef PubMed.
  25. F. Qiu, M. Z. Guo, J. Y. Ding, Y. Yi, Z. Y. Jia, Q. D. Su and S. L. Bi, Chin. J. Exp. Clin. Virol., 2012, 26, 483–485 Search PubMed.
  26. D.-C. Nyan, L. E. Ulitzky, N. Cehan, P. Williamson, V. Winkelman, M. Rios and D. R. Taylor, Clin. Infect. Dis., 2014, 59, 16–23 CrossRef PubMed.
  27. J. Yang, M.-X. Fang, J. Li, G.-Q. Lou, H.-J. Lu and N.-P. Wu, Arch. Virol., 2011, 156, 1387–1396 CrossRef PubMed.
  28. M. Kargar, A. Askari, A. Doosti and S. Ghorbani-Dalini, Indian J. Virol., 2012, 23, 18–23 CrossRef PubMed.
  29. X. Lan, B. Yang, B. Y. Li, X. P. Yin, X. R. Li and J. X. Liu, J. Clin. Microbiol., 2009, 47, 2304–2306 CrossRef PubMed.
  30. H. Mukhopadhyay, S. Amsaveni, S. Matta, P. Antony, J. Thanislass and R. Pillai, Lett. Appl. Microbiol., 2012, 55, 202–209 CrossRef PubMed.
  31. N. Tomita, Y. Mori, H. Kanda and T. Notomi, Nat. Protoc., 2008, 3, 877 CrossRef PubMed.
  32. S. Nagai and S. Itakura, Mar. Genomics, 2012, 7, 43–49 CrossRef PubMed.
  33. D. Jiang, G. Xiang, J. Wu, C. Liu, F. Liu and X. Pu, Int. J. Electrochem. Sci., 2012, 7, 5273–5285 Search PubMed.
  34. J. K. Wong, S. P. Yip and T. M. Lee, Small, 2014, 10, 1495–1499 CrossRef PubMed.
  35. K. Hsieh, A. S. Patterson, B. S. Ferguson, K. W. Plaxco and H. T. Soh, Angew. Chem., 2012, 124, 4980–4984 CrossRef.
  36. M. U. Ahmed, S. Nahar, M. Safavieh and M. Zourob, Analyst, 2013, 138, 907–915 RSC.
  37. C. Toumazou, L. M. Shepherd, S. C. Reed, G. I. Chen, A. Patel, D. M. Garner, C.-J. A. Wang, C.-P. Ou, K. Amin-Desai and P. Athanasiou, Nat. Methods, 2013, 10, 641–646 CrossRef PubMed.
  38. B. Veigas, R. Branquinho, J. V. Pinto, P. J. Wojcik, R. Martins, E. Fortunato and P. V. Baptista, Biosens. Bioelectron., 2014, 52, 50–55 CrossRef PubMed.
  39. R. Gurrala, Z. Lang, L. Shepherd, D. Davidson, E. Harrison, M. McClure, S. Kaye, C. Toumazou and G. Cooke, Sci. Rep., 2016, 6, 36000 CrossRef PubMed.
  40. Y. Kimura, M. J. de Hoon, S. Aoki, Y. Ishizu, Y. Kawai, Y. Kogo, C. O. Daub, A. Lezhava, E. Arner and Y. Hayashizaki, Nucleic Acids Res., 2011, 39, e59 CrossRef PubMed.
  41. N. A. Tanner, Y. Zhang and T. C. Evans Jr, BioTechniques, 2015, 58, 59–68 CrossRef PubMed.
  42. X. Shi, C.-H. Chen, W. Gao, S. Chao and D. R. Meldrum, Lab Chip, 2015, 4, 1059–1065 RSC.
  43. A. M. Thompson, A. Gansen, A. L. Paguirigan, J. E. Kreutz, J. P. Radich and D. T. Chiu, Anal. Chem., 2014, 86, 12308–12314 CrossRef PubMed.
  44. A. Gansen, I. K. Dimov, L. P. Lee and D. T. Chiu, Lab Chip, 2012, 12, 2247–2254 RSC.

Footnote

Electronic supplementary information (ESI) available. See DOI: 10.1039/c8ay00802g

This journal is © The Royal Society of Chemistry 2018