Open Access Article
Rosario
Médici
,
Hanna
Stammes
,
Stender
Kwakernaak
,
Linda G.
Otten
and
Ulf
Hanefeld
*
Biokatalyse, Afdeling Biotechnologie, Technische Universiteit Delft, van der Maasweg 9, 2629 HZ Delft, The Netherlands. E-mail: U.Hanefeld@tudelft.nl; Tel: +31 15 2789304
First published on 22nd February 2017
α-Hydroxy ketones and vicinal diols constitute well-known building blocks in organic synthesis. Here we describe one enzyme that enables the enantioselective synthesis of both building blocks starting from diketones. The enzyme 2,3-butanediol dehydrogenase (BudC) from S. marcescens CECT 977 belongs to the NADH-dependent metal-independent short-chain dehydrogenases/reductases family (SDR) and catalyses the selective asymmetric reductions of prochiral α-diketones to the corresponding α-hydroxy ketones and diols. BudC is highly active towards structurally diverse diketones in combination with nicotinamide cofactor regeneration systems. Aliphatic diketones, cyclic diketones and alkyl phenyl diketones are well accepted, whereas their derivatives possessing two bulky groups are not converted. In the reverse reaction vicinal diols are preferred over other substrates with hydroxy/keto groups in non-vicinal positions.
![]() | ||
| Scheme 1 Summary of enzymatic methods applied for the synthesis of α-hydroxy ketones and vicinal diols, employing oxidoreductases,7,12–14 lyases,15,16 hydrolases17 and epoxide hydrolases.18 Double reduction of α-diketones is achieved by a few oxidoreductases19–22 and enzymatic cascade strategies involving two enzymatic steps.8,23,24 | ||
Acetoin reductases/2,3-butanediol dehydrogenases (EC 1.1.1.4 and 1.1.1.76) constitute a less explored group of enzymes. They belong to the family of NADH-dependent metal-independent short-chain dehydrogenases/reductases and are responsible for the accumulation of 2,3-butanediols in high titers (>100 g L−1) during the cultivations of species such as Klebsiella, Enterobacter, Serratia and Bacillus.9 In general, 2,3-butanediol is not produced as a single isomer, but as a mixture of meso-2,3-butanediol with (S,S)-butanediol (L-(+)-form) or (R,R)-2,3-butanediol (D-(−)-form). Microorganisms that do not produce the meso diol, generate optically enriched (R,R)-butanediol. The variations in optical purity might be due to a single unselective enzyme or due to mixtures of selective enzymes. In particular, the Bacillus stearothermophilus10 enzyme (2S,3S)-2,3-butanediol dehydrogenase (BDH, EC 1.1.1.76) gave excellent enantioselectivities for a range of substrates towards the S,S-diols. R,R-Diols could be obtained employing for instance Saccharomyces cerevisiae BDH.11 This indicates that more enzymes with similarly high specificities for other substrates and isomers including the meso isomer should be available. The oxidation of the meso isomer would be of particular interest. In principle, this enzymatic transformation could afford enantio-enriched α-hydroxy ketones with up to 100% yield rather than the 50% obtained through a kinetic resolution approach.
Here we describe the investigation of meso-2,3-butanediol dehydrogenase (BudC) from Serratia marcescens CECT 977, including its stereoselectivity and substrate range.
BudC catalyses the reduction of rac-acetoin preferably at weakly acidic pH 5.0 rather than neutral pH (975 U mg−1vs. 250 U mg−1). However, kinetic parameters at pH 5.0 were difficult to determine, yielding inconsistent data due to the low stability of the enzyme at this pH (t1/2: 2.5 h, Fig. 1).
In line with these observations, only kinetic parameters at pH 7.0 were determined (Table 1, ESI‡ Fig. S4, A–D). In the reductive reaction diacetyl is the preferred substrate of BudC over acetoin, while only meso-2,3-butanediol oxidation was catalysed by the enzyme under the conditions assessed. Despite its protein sequence identity with the enzyme from S. marcescens H30, the specific activities obtained in our study with BudC were significant higher than those reported earlier (up to 4.5-fold at pH 5.0)25 under identical reaction conditions.
| Substrate | V max (U mg−1) | K m (mM) | k cat (s−1) | k cat/Km (M−1 s−1) |
|---|---|---|---|---|
| a Reaction conditions: 0.16 mM/0.32 mM NADH/NAD+, 0.27 nM BudC, substrate concentration 100 μM to 150 mM in potassium phosphate buffer (50 mM, pH 7.0) at 37 °C. Turnover numbers (kcat) are expressed per monomer of BudC. b Oxidation reaction. c Reduction reaction. | ||||
| meso-2,3-BDOb | 140.7 ± 5.2 | 6.9 ± 1 | 66.6 | 9.6 × 103 |
| Diacetylc | 412 ± 11.0 | 1.7 ± 0.2 | 195.0 | 1.1 × 105 |
| (±)-Acetoinc | 250.8 ± 3.1 | 3.1 ± 0.3 | 118.7 | 3.8 × 104 |
| (2S,3S)-2,3-BDOb | — | — | — | — |
| (2R,3R)-2,3-BDOb | — | — | — | — |
Consistent with the previous results, nicotinamide cofactor regeneration strategies are essential to achieve significant product yields. Ethanol, 2-propanol, and acetone were tested as co-substrates for substrate-coupled cofactor regeneration. However, none of them was accepted by BudC (Table 2). An enzyme-coupled approach was accomplished employing formate dehydrogenase and glucose dehydrogenase (both as crude cell extracts) to recycle NADH, and NADH oxidase (as crude cell extracts) to regenerate NAD+. With these systems at hand, both the BudC catalysed oxidation and reduction could be investigated.
| Compound | U mg−1 |
|---|---|
| a Reaction conditions: 50 mM substrate, 0.16 mM/0.32 mM NADH/NAD+, 0.27 nM BudC in potassium phosphate buffer (50 mM, pH 7.0) at 37 °C. Experiments were performed in triplicate and the data are presented as means with standard deviations. b n.d.: not detected. | |
| 1a 2,3-pentanedione | 249.2 ± 11.4 |
| 1b 2,3-hexanedione | 220.5 ± 12.6 |
| 1c 3,4-hexanedione | 88.5 ± 2.1 |
| 1d 2,3-heptanedione | 19.4.6 ± 0.7 |
| 1e 1-phenyl-1,2-propanedione | 23.4 ± 3.4 |
| 1f 1,2-cyclohexanedione | 6.2 ± 0.5 |
| R-Benzoin | n.d.b |
| rac-Benzoin | n.d. |
| Benzil | n.d. |
| Acetone | n.d. |
| 2,4-Pentanediol | <1.0 |
| 1,3-Butanediol | <1.0 |
| Ethanol | n.d. |
| 2-Propanol | n.d. |
Whereas BudC was S-selective for the reduction of diacetyl yielding (S,S)-2,3-butanediol ((S,S)-2,3-BDO), rac-acetoin was reduced to both meso-2,3-BDO and (S,S)-2,3-BDO. Here (R)-acetoin was the preferred substrate and 15% (S)-acetoin remained unconverted after 24 h. Thus, BudC showed a stereo-preference consistent with meso-2,3-butanediol dehydrogenases with respect to acetoin.
In the oxidation reaction meso-2,3-BDO led to a complex product mixture. Starting with the initial formation of (R)-acetoin BudC catalysed its racemization within 24 h, concomitant with oxidation and reduction reactions, yielded small amounts of (2S,3S)-2,3-BDO as a side product.
In agreement with the kinetic measurements (Table 1), (2S,3S)-2,3-BDO was poorly converted to (S)-acetoin (<5% yield). No measurable amounts of diacetyl were detected.
Overall, BudC is S-selective for the reduction reaction of diacetyl to (2S,3S)-2,3-BDO but displays a preference for (R)-acetoin as a substrate for the second reduction step, which is also reduced with S-selectivity. In the reverse oxidation reaction meso-2,3-BDO was converted under the tested conditions, while the other diols and acetoin are poor substrates for the oxidation reaction (Scheme 2).
In the oxidation reaction non-vicinal diols such as 2,4-pentanediol and 1,3-butanediol were no substrates of BudC. These results are in agreement with those previously reported by Zhang et al.25 indicating that vicinal diols (1,2-, 2,3- or 3,4) are required for catalysis.
Reaction products were isolated by column chromatography and characterised by 1H and 13C NMR, optical rotation, and by comparison with the products obtained under the same conditions with a well characterised commercial enzyme ADH-380 (Evoxx, Düsseldorf, Germany), which is known to yield the corresponding S-stereoisomers. Moreover, ADH-380 catalysed reactions were used as positive control.26 Slight differences in reaction yields and stereoselectivities were observed depending on the regeneration system employed (crude extracts of formate or glucose dehydrogenase).
2,3-Pentanedione (1a) was reduced to the diol (2S,3S)-4a in good yield and selectivity after 1 h. After 24 h the yield was improved further but a slight loss of selectivity was observed (Table 3, entry 1–2, ESI‡ Fig. S7 and S11). The results are in line with those for diacetyl (Scheme 2).
| Entry | Substrate | Conc. [mM] | Enzyme | Reg. syst. | 2 [%] | eeb [%] | 3 [%] | ee [%] | 4 [%] | de [%] | ee [%] | Time (h) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ND stands for not determined. a Reaction conditions: the corresponding diketone (1a–1f, 10 or 50 mM) was added to 50 mM potassium phosphate buffer pH 7.0 with the nicotinamide cofactor (0.16 mM), BudC (2 U ml−1) and regeneration system (FDH or GDH, 2 U mL−1). b Yields, ees and des were determined by chiral GC analysis (when possible). c Small peaks could not be assigned due to missing standards, therefore it was impossible to distinguish between ee and de. | ||||||||||||
| 1 | 1a | 10 | BudC | FDH | — | — | — | — | 71 | (2S,3S) | 96c | 1 |
| 2 | 1a | 10 | BudC | FDH | — | — | — | — | 90 | (2S,3S) | 94c | 24 |
| 3 | 1a | 10 | ADH-380 | FDH | — | — | — | — | 92 | 99 (2S,3S) | >99 | 24 |
| 4 | 1b | 10 | BudC | FDH | <5 | ND | 80 | 99 | <5 | ND | — | 24 |
| 5 | 1b | 50 | BudC | GDH | — | — | 90 | 96 | <5 | ND | — | 48 |
| 6 | 1c | 10 | BudC | FDH | 15 | 80 (S) | — | — | 79 | (2S,3S) | 92c | 24 |
| 7 | 1c | 50 | BudC | GDH | 92 | 93 (S) | — | — | <5 | ND | — | 1 |
| 8 | 1c | 10 | ADH-380 | FDH | — | — | — | — | 99 | 99 (2S,3S) | 99 | 24 |
| 9 | 1d | 10 | BudC | FDH | 31 | 91 (S) | 57 | 99 (ND) | <5 | ND | — | 24 |
| 10 | 1d | 10 | BudC | GDH | 46 | 97 (S) | 40 | 99 (ND) | <5 | ND | 24 | |
| 11 | 1d | 50 | BudC | GDH | 20 | 89 (S) | 68 | 99 (ND) | <5 | ND | 48 | |
| 12 | 1d | 10 | ADH-380 | FDH | 29 | 99 (S) | — | — | 65 | (2S,3R) | 94c | 24 |
| 13 | 1d | 10 | ADH-380 | GDH | <5 | ND | — | — | 95 | 99 (2S,3R) | 99 | 24 |
| 14 | 1e | 10 | BudC | FDH | 25 | 85 (S) | 55 | 89 (S) | 9 | 59 (1S,2S) | 99 | 2 |
| 15 | 1e | 10 | BudC | FDH | 15 | 85 (S) | 40 | 83 (S) | 30 | 5 (1S,2S) | 99 | 24 |
| 16 | 1e | 10 | ADH-380 | FDH | <5 | ND | 65 | 99 (S) | 36 | 69 (1S,2S) | 99 | 24 |
| 17 | 1f | 10 | BudC | FDH | — | — | — | — | 66 | 67 (1S,2S) | 99 (1S,2S) | 2 |
| 18 | 1f | 10 | BudC | FDH | — | — | — | — | 66 | 67 (1S,2S) | 99 | 24 |
| 19 | 1f | 10 | ADH-380 | FDH | — | — | — | — | 81 | 99 (1S,2S) | 99 | 24 |
2,3-Hexanedione (1b) was also rapidly reduced to the corresponding α-hydroxy ketone, with (S)-3-hydroxy-2-hexanone (3b) as the main reaction product (80% yield, 99% ee, Table 3, entry 4), while 2,3-hexanediol was produced only in low yields. High yields of 3b were also achieved at semi-preparative scale with a minor loss of enantioselectivity (Table 3, entry 5, ESI‡ Fig. S8 and S12). It should be noted that the less accessible 3-ketogroup was selectively reduced and the reaction almost stopped completely after a single reduction. The second reduction step was much slower, allowing to selective production of the acyloin.
A modified reaction profile was observed with 2,3-heptanedione (1d). A mixture of 2-hydroxy-3-heptanone (2d) and 3-hydroxy-2-heptanone (3d) was produced, the latter again as the main reaction product (Table 3, entries 9–10). As with 1b the less accessible 3-ketogroup was thus reduced preferably. Despite extensive efforts, the regio-isomers could not be separated by column chromatography; therefore the absolute stereochemistry of 3d could not be determined (ESI‡ Fig. S10 and S15–S17). Based on the other results it can tentatively be assigned as (S). (2S,3R)-2,3-Heptanediol (4d) was obtained in low yields (<5%). Neither longer reaction times nor fresh pulses of the enzyme improved the yield of the diol.
In contrast to other dehydrogenases (i.e., ADH-A from Rhodococcus ruber or ADH-T from Thermoanaerobacter sp.),19,20 where the extension of α-diketone alkyl chain (n = 1 to n = 3) increased the selectivity of the enzymes, a lower regio-selectivity was observed in case of budC, indicating its preference for small substrates.
The reduction of 3,4-hexanedione (1c) proceeded with the same stereoselectivity as for diacetyl, (S)-acetoin and 1a yielding (3S,4S)-3,4-hexanediol (4c) (79% yield, 92% stereoselectivity). When higher substrate concentrations were employed and the reaction time shortened (Table 3, entries 7), (S)-4-hydroxy-3-hexanone (2c) was produced with excellent yields (92%) and stereoselectivity (93% ee). This supports the stereochemical assignment of 3d (ESI‡ Fig. S8, S13 and S14).
1-Phenyl-1,2-propanedione reduction yielded (S)-2-hydroxy-1-phenylpropan-1-one (3e) as the main product (55% yield, 89% ee), (S)-1-hydroxy-1-phenylpropan-2-one (2e, 25% yield, 85% ee) and (S,S)-1-phenyl-1,2-propanediol (4e) (9% yield, 99% ee, 59% de) (Table 3, entry 14, ESI‡ Fig. S6). Longer incubation times increased the yield of 4e up to 30%, but reduced the stereoselectivity (Table 3, entry 15). While the S-selectivity was maintained BudC surprisingly cannot differentiate between a methyl and a phenyl-group.
1,2-Cyclohexanedione was completely reduced to (S,S)-1,2-cyclohexanediol (4f) in good yields (66%) and with excellent ee (99%) although poorer de (67%), as cis-1,2-cyclohexanediol was also detected as a reaction product. It could not be distinguished whether the low de was due to poor selectivity in the first or second reduction step.
Docking different substrates and products did not result in good binding poses. This is probably due to the small nature of the substrates. This was confirmed by the fact that docking these small compounds into the crystal structure of the KpBDH also did not result in proper binding modes. Furthermore, the loop just outside the binding pocket is probably moving upon binding of the substrate which cannot be mimicked by the docking in silico.
Normally the reduction of the proximal keto group results in the S-enantiomer of the corresponding α-hydroxy ketone. The pro-R NADH hydride transfer from NADH to the re-face of diketones yields (S)-hydroxy ketones, indicating that the enzyme obeys canonical Prelog addition (Fig. 3). Small diketones are most probably fixed at the correct distance to NADH with hydrogen bonds, similar to KpBDH. Since the active site easily can accommodate larger substrates, the larger and more aliphatic penta-, hexa- and heptadione can bind into the active site in an alternative orientation. In this way the 3-keto group may be positioned properly towards the NADH, resulting in the respective 3S-hydroxyketone. Reduced affinity of this alternative binding mode can explain the decreased activity for the larger substrates.
![]() | ||
| Fig. 3 Homology model of BudC based on meso-2,3-butanediol dehydrogenase from K. pneumoniae (1GEG). The substrate diacetyl (blue sticks) was modelled based on the co-crystalised beta-mercaptoethanol in 1GEG. Tyr155 and Ser138 (yellow) are both hydrogen bonded to the proximal keto-group. The Tyr donates a hydride to the oxygen of the substrate, while the pro-R hydride from NADH (orange) transfers to the carbon, resulting in the S-configuration of the hydroxyl group. | ||
By varying reaction conditions, single or double reductions as well as oxidations could be achieved in one step. This makes this enzyme an outstanding biocatalyst for the synthesis of different chiral compounds from prochiral diketones and diols.
Serratia marcescens CECT 977 was supplied by the Spanish Type Culture Collection (CECT, University of Valencia, Spain) and as DNA source for budC cloning. pGEMT-easy (Promega, Promega Benelux B.V., Leiden, The Netherlands) was used as cloning vector and pET-28a (Merck Millipore, Amsterdam, The Netherlands) as expression vector.
Bacteria were routinely grown at 37 °C in liquid Luria-Bertani broth medium (NaCl, 5 g L−1; tryptone, 10 g L−1; yeast extract, 5 g L−1) containing 100 μg ml−1 ampicillin or 50 μg ml−1 kanamycin when required.
The budC gene was PCR amplified from S. marcescens CECT 977 genomic DNA using the forward 5′- GGAATTCCATATGCGTTTTGACAATAAAGTCGTGGTTATC -3′ (NdeI site in bold) and reverse primer 5′- CGCTCGAGTTAGACGATCTTCGGTTGGCCGTCCGA-3′ (XhoI site in bold). The PCR was performed using Accuprime Pfx DNA polymerase (Thermo Fisher Scientific) with the following conditions: 0.1 μg of chromosomal DNA, 0.3 μM of each primer, 5 μl of 10× PFx reaction mix and 2.5 units of Pfx DNA polymerase in a final volume of 50 μl. A hot start of 2 minutes at 95 °C was followed by 30 cycles of denaturation (15 s at 95 °C), annealing (30 s at 56 °C), and extension (1 min at 68 °C). The PCR product was first purified using a Gel purification kit (Qiagen, Venlo, The Netherlands), followed by an A-tailing procedure with Taq DNA polymerase (Qiagen).
BudC gene was ligated into pGEM® T-Easy vector system (Promega, Leiden, The Netherlands), and the resulting plasmids were produced in E. coli DH5α. The resulting constructs were confirmed by DNA sequencing, restricted with NdeI and XhoI, and the coding gene was ligated into the corresponding sites of pET-28a vector (Merck Millipore, Amsterdam, The Netherlands), introducing a (His)6-tag at the N-terminus of budC gene product.
Recombinant expression of budC was performed using E. coli BL21 star (DE3) cells transformed with pET-28a-budC in autoinduction media (ZYM-5052)31 supplemented with 100 μg ml−1 of kanamycin at 22 °C and 150 rpm during 24 h. Cells were harvested by centrifugation at 12
500 × g for 15 minutes at 4 °C, washed twice with potassium phosphate buffer (50 mM, pH 7.0), re-centrifuged stored at −80 °C until further use.
500 × g and 4 °C for 45 min. CFE was filtered through 0.45 μm filter and applied onto a 5 ml Ni-NTA HisTrap HP column (GE Healthcare Life Sciences, Eindhoven, The Netherlands) previously equilibrated with binding buffer. An imidazole gradient was then applied (20 mM–500 mM imidazole, 3 ml min−1, 60 minutes) and BudC was eluted with about 350 mM of imidazole.
Enzyme fractions were analysed by SDS-PAGE (12% Bis-Tris gels, Bio-Rad, Munich, Germany). Fractions containing BudC were combined, concentrated by centrifugation using an Amicon filter (10 kDa, Merck Millipore) and applied onto a PD-10 desalting column (Thermo Fischer Scientific) previously equilibrated with 50 mM potassium phosphate, pH 7.0. Enzyme aliquots were frozen in liquid nitrogen and stored at −80 °C. Protein concentration was determined by the bicinchoninic acid assay (Interchim Uptima BC assay, Interchim, Montluçon France) using bovine serum albumin (Bio-Rad, Veenendaal, The Netherlands) as standard.
Specific activities were measured in potassium phosphate buffer (50 mM, pH 7.0, 1 ml) in presence of 50 mM of substrate and 0.16 mM NADH or 0.32 mM NAD+. DMSO (5% (v/v)) was added as a co-solvent to improve the solubility of benzil and benzoin. Reactions were started by addition of the enzyme solution and measured for 3 min. Activities of the CFE was determined using E. coli BL21 (DE3) star pET28(a)-buC or E. coli BL21 (DE3) star pET28(a) as negative control.
Kinetics parameters were investigated using 0.27 nM enzyme in presence of varying substrate (0.01–200 mM) or nicotinamide cofactor concentrations (12.5 μM to 5 mM) at 37 °C. Data were fitted to the Michaelis–Menten equation (non-linear regression, SigmaPlot 8.0) to estimates of Km and kcat.
Reactions were incubated at 37 °C and 600 rpm during 24 h. Aliquots (1 ml) were taken at different reaction times, centrifuged at 13
000 rpm for 2 minutes and supernatants were first saturated with a NaCl saturated solution (0.1 ml) followed by extraction with ethyl acetate (containing isoamyl alcohol as internal standard) (0.5 mL × 2). The combined organic layer was dried over Na2SO4 and analysed with chiral GC with respect to yield, chemoselectivity and ee (see ESI‡).
Aliphatic α-hydroxy ketones and diol standards were obtained carrying out the reduction reactions at 50 ml scale. The reaction mixture contained 50 mM substrate (200 mg 2,3-pentanedione, 285 mg 2,3-hexanedione, 285 mg 3,4-hexanedione, 320 mg 2,3-heptanedione), 7.1 mg NADH, 1.5 g glucose-1-monohydrate, 0.75 g calcium carbonate, 2 mg glucose dehydrogenase and 2 mg ADH-380 (Evoxx) or 1.4 mg of BudC in potassium phosphate buffer (50 mM, pH 7.0). Reaction vessels were incubated at 37 °C and 100 rpm during 24 or 48 h. α-Hydroxy ketones and diols were purified by column chromatography as detailed in ESI‡ (sections 3 and 4), characterised by their optical rotation, 1H and 13C NMR spectra and compared with authentic standards or literature data when available (see ESI‡ Fig. S6 to S11).
Docking was done in the Yasara program with 100 docking runs using VINA and a minimum ligand RMSD of 1.5 Å. All residues were fixed except the important residues lining the active site, namely Ser138, Val139, Trp146, Tyr151, Lys155, Trp192 and the nicotinamide part of NADH. All docked compounds were visually inspected to determine the most probable catalytically active position. This binding mode was minimised with the NOVA force field to improve binding interactions with the protein.
Footnotes |
| † Dedicated to W. R. “Fred” Hagen on the occasion of his retirement. |
| ‡ Electronic supplementary information (ESI) available: Chemicals, strains and plasmids, analytical methods; and additional figures. See DOI: 10.1039/c7cy00169j |
| This journal is © The Royal Society of Chemistry 2017 |