Norbornene derived nanocarrier reduces isoniazid mediated liver toxicity: assessment in HepG2 cell line and zebrafish model

Abstract

The aim of this study was to investigate the protective effect of the stimuli-responsive norbornene-based nanocarrier complex of isoniazid, compared to pure isoniazid, on liver cells, by in vivo and in vitro methods. Hepatic damage induced in a zebrafish model by isoniazid resulted in significant alterations in liver histology, gene expression of drug metabolizing genes, reduced glutathione (GSH) levels, and DNA damage. An increased level of intracellular reactive oxygen species (ROS) was detected in HepG2 cells on exposure to isoniazid. Interestingly, the isoniazid conjugated nanocarrier exhibited a more protective effect on liver cells compared to isoniazid. A significant reduction in the cyp2p6 gene, elevation in GSH levels, reduced DNA damage, and a normal histological tissue pattern was observed in liver tissues exposed to the isoniazid conjugated nanocarrier. Also, the isoniazid conjugated nanocarrier showed negligible ROS generation and in vitro cytotoxicity in HepG2 cells. These encouraging results may prompt further research in the advance of norbornene-based nano systems in nanotherapeutics and biomedical applications.

---

Introduction

Biomedical polymers are gaining importance due to their non-toxic, non-immunogenic, water soluble, and biodegradable nature.^1,2 Recently there has been an increase in norbornene-based polymeric systems designed for drug delivery. These polymers are of great interest in industrial and academic research due to their potential applications in drug delivery and biomaterials. Ring-opening metathesis polymerization (ROMP) is the method usually preferred for polymer synthesis because of its high functional group tolerance, excellent control of molecular weight, and ability to provide a narrow polydispersity index (PDI).³ The ROMP technique is used to develop biocompatible polymeric systems, such as functionalizing norbornene moieties with a variable number of ethylene glycol/ethylene oxide units. Due to their general biocompatibility, such materials are intensively explored for their applications in the field of medical diagnostics, drug delivery and tissue engineering.⁴ Notably, ROMP polymers containing polynorbornene backbones have been demonstrated to be non-toxic in a variety of systems including mammalian cell lines.^5–9 Cationic polynorbornene derivatives, designed for antibacterial activity showed selectivity in inhibition of bacterial growth over mammalian cells.¹⁰ As research into applications involving the interaction of biological systems with ROMP generated polymers grows, one needs to be assured of the toxicity and in vivo interactions in the clinical use of these materials. However, there is little detailed in vivo toxicity research reported on these systems and hence in the current study, we have examined the effects of a norbornene derived polymeric nanocarrier, by in vitro and in vivo assays.

Isoniazid (INH), rifampicin (RIF), pyrazinamide (PYZ), and ethambutol (ETM) are the commonly used first-line drugs against TB (tuberculosis). Isoniazid, one of the primarily used first-line TB drugs, proven to induce liver toxicity even when given at the recommended doses.^11–14 The nano-carrier used in the present study is a norbornene derived isoniazid copolymer (INH-CP), with high drug content as well as controlled release in a systematic manner. The hydrophobic core of this nano carrier consists isoniazid and retinol, to overcome its side effects on eye due to usage of the drug. To achieve the controlled as well as sustained drug release, the drugs are linked to the polymer backbone through acyl hydrazine linker.¹⁵ It also has a hydrophilic polyethylene glycol (PEG) containing shell structure that plays important role in biocompatibility and prolonged circulation. In the previous report, this newly designed nano carrier has been examined for its sustained release, cellular uptake and specific delivery using A549 cells (lung cancer cell lines).¹⁶ In our other unpublished report on comparative study on the anti-mycobacterial activity of the nano drug system (INH-CP) and INH at different concentrations against H37Rv strain of Mycobacterium tuberculosis, we have identified the minimum inhibitory concentrations of isoniazid and INH-CP (ESI ST1†). However, biosafety of this norbornene derived isoniazid copolymer, remains unknown on liver cells, at in vitro and in vivo.

At this context in the present study, a preliminary in vitro investigation was conducted to study the effect of isoniazid and norbornene derived isoniazid copolymer on the viability of human HepG2 cells and the underlying reactive oxygen species generation (ROS) involved in the oxidative damage to the cells. To assess the in vivo biotoxicity of the norbornene-based nanocarrier, zebra fish model was used, with the hope of providing preliminary biosafety profile and hepatoprotective ability of the nano system. Zebra fish is proven to be cheap, quick and facile preclinical model to assess the toxicity of nanomaterials.¹⁷ Although a lower order vertebrate, zebra fish (Danio rerio), have similar molecular and cellular processes that can accurately model human physiology. Though zebra fish liver architecture is different to the mammalian liver; the main physiological processes remain similar, histological patterns of injury comparable to mammals and the liver injury biomarkers can be quantified in the zebra fish circulation.¹⁸

Zebra fish metabolize drugs using similar pathways as humans; they possess a wide range of cytochrome P450 enzymes enabling metabolic reactions including hydroxylation, conjugation, oxidation, demethylation and de-ethylation.¹⁹ Cytochrome P450 (CYP450) superfamily are the phase I metabolizing enzymes primarily present in drug-eliminating organs, including the liver, kidney and intestinal tract. They are often responsible for many idiosyncratic hepatotoxicity due to the formation of reactive metabolites of the drug.²⁰ In the anti-tubercular treatment, the CYP2E1 gene has been reported to be associated with INH-induced hepatitis.^21,22 In isoniazid metabolic pathway INH is either undergo hydrolysis (amidase mediated) or acetylation (NAT2 mediated) to form products such as hydrazine (hepatotoxic) and acetyl isoniazid (non toxic) respectively (Fig. S1†). Due to involvement of CYP2E1 hydrazine gets converted to toxic metabolites such as acetyldiazene, ketene and acetylonium ions. The above metabolites are further detoxicified and excreted from the body by the involvement of Glutathione S-transferases (GST) and glutathione (GSH).^23,24

Cytochrome P4503A (CYP3A) is the major drug-metabolizing enzyme in the human liver and is responsible for the clearance of many commonly used drugs. Isoniazid treatment when combined with other tubercular drug, rifampicin is expected to increase hepatotoxicity by inducing CYP3A metabolic activity (Li et al. 1997 (ref. 25)). Hence CYP3A level was assessed in the present study. Most drugs that induce levels of CYP3A are thought to do so primarily via PXR activation.²⁶ Pregnane X Receptor (PXR) is a nuclear receptor regulating transcription of many drug metabolizing enzymes. Human PXR is involved in regulation of most xenobiotics toxicity through CYP3A4-mediated hepatic metabolism in the presence of PXR ligand. Isoniazid is also a ligand for PXR receptor. A report from Li et al. 2013,²⁷ has proved that risk of hepatotoxicity is higher in co treatment of RIF and INH via pregnane X receptor-mediated pathway. Overall the hepatotoxicity of the anti-tubercular drugs is because of their metabolites from phase I metabolism.²⁴ To our advantage the PXR and CYP3A genes of zebra fish have been shown to be conserved.^28,29 Though there is no direct CYP2E1 ortholog, zebra fish Cyp2p6 is 43% identical and represent the closest CYP2E1 homologs to the human protein.³⁰ Therefore, the effect of INH and INH-CP on gene expression of PXR, CYP3A, and CYP2E1 genes has been analyzed in the current work.

Oxidative stress is known to be the important factor in the progression of Anti-Tuberculosis Drugs (ATD) mediated Drug-Induced Liver Injury (DILI). Schwab and Tuschl, 2003,³¹ have demonstrated that INH could produce apoptosis in HepG2 cells even at millimolar concentrations and Slater et al., 1995 (ref. 32) has reported that one of the most reproducible inducers of cell apoptosis is mild oxidative stress. And the findings of S. Bhadauria et al., 2010 (ref. 33) has confirmed an increase in ROS generation in HepG2 cells on isoniazid exposure. Therefore, the current study attempts to identify the level of ROS production in INH and INH-CP treatment on HepG2 cells. Increased oxidative stress and raised levels of reactive oxygen species (ROS) due to the generation of reactive ATD metabolites are closely associated with decreased glutathione levels. GSH reacts to a broad selection of ROS creating GSSG (glutathione disulfide).³⁴ GSH is a tripeptide(γ-glutamylcysteinyl glycine), a major antioxidant, which is a co-substrate to glutathione transferases in the detoxification of xenobiotics.³⁵ Measuring GSH levels in the cells is one way to analyze oxidative stress. GSH measurement is also widely used to evaluate the toxicity of different nano particles (NPs).³⁶ Studies have reported INH-induced formation of toxic metabolites leads to depletion of GSH stores and subsequent hepatotoxicity.³⁷

DNA damage by oxidative stress is the other major cause for DILI by of anti-tuberculosis drugs.³⁸

Isoniazid induces DNA damage by generation of hydroxyl free radicals (˙OH) in the presence of metal ions.³⁹ There is also a report on unscheduled DNA synthesis and chromosomal abberations in cell lines on exposure to isoniazid.⁴⁰ Moreover, cytochrome P450 2E1-mediated drug metabolism is responsible for reactive oxygen species generation, leading to DNA strand breaks.⁴¹ The single cell gel electrophoresis assay (SCGE), also known as comet assay is a simple, rapid, cheap, and sensitive method to detect DNA damage.⁴²

The aim of the current research work was to assess the effect of norbornene derived isoniazid copolymer in: (a) hepatocellular carcinoma (HepG2) cell line, (b) to evaluate DILI in zebra fish model by visual assessment, quantification of the total glutathione level (tGSH), scoring histopathology, gene expression analysis and DNA damage. As per our knowledge this is first report of this kind for evaluating liver toxicity of the stimuli-responsive norbornene derived polymeric nanocarrier.

Materials and methods

Chemicals

Reduced glutathione (GSH), 5,5-dithiobis, 2-nitrobinzoic acid (DTNB), β-nicotinamideadenine dinucleotide 2′-phosphate reduced tetrasodium salt (NADPH), ethidium bromide (EtBr), 5-sulfosalicylic acid dihydrate (SSA), Normal Melting Agarose (NMA), Low Melting Point Agarose (LMPA), isoniazid and rifampicin (Hi Media, India). Glutathione reductase (GR) purchased from Sigma-Aldrich Co, St. Louis, USA.

Cell culture

Hepatocellular carcinoma (HepG2) cell line was obtained from NCCS, Pune, India. Dulbecco's Modified Eagle's Medium with HAMS F-12 mixture, thiazolyl tetrazolium bromide (MTT), trypsin, ethylenediaminetetraacetic acid, sodium bicarbonate, penicillin and streptomycin were purchased from Sigma-Aldrich. Fetal bovine serum (FBS) and phosphate buffered saline (10×) were purchased from Gibco, Invitrogen Life Technologies.

Preparation of stimuli-responsive nano carrier nano systems

Norbornene derived isoniazid copolymer (INH-CP) system was synthesized and characterized at Polymer Research Centre, Department of Chemical Sciences, Indian Institute of Science Education and Research Kolkata (IISER K), India and was characterized and reported earlier (Shunmugam et al.¹⁶). The nano carrier synthesis scheme is given in Fig. 1.

Fig. 1 Schematic representation of INH-CP synthesis.¹⁶

In vitro cytotoxicity evaluation

Culture of hepatocellular carcinoma (HepG2) cell line. HepG2 cells were grown in DMEM containing 10% FBS, 10 000 IU mL⁻¹ penicillin and 10 000 μg mL⁻¹ streptomycin in a 25 cm²-culture flask in a CO₂ incubator at 37 °C and 5% CO₂ under controlled humidified atmosphere. Once the cells reached ∼90% confluency, they were trypsinized using trypsin (0.05%) – EDTA (0.54 mM) solution, washed thoroughly with media and subcultured into a 75 cm² culture flask for expansion. This process was repeated twice till the cells attained a consistent growth phase. Once after the cells attained consistent growth phase, they were trypsinized at 80% confluency and then utilized for the assay.

Assessment of cytotoxicity by MTT assay. Cell viability assay was carried out using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) as described by Mosmann,⁴³ with minor modifications. The cells were trypsinized when they were at 80% confluence and seeded in a 96-well plate at the density of 12 × 10³ cells per well. The cells were incubated in a CO₂ incubator at 37 °C and 5% CO₂ undercontrolled humidified atmosphere overnight to allow them to attach to the plate. After overnight incubation, the cells were exposed to different concentrations (0, 10, 30, 100, 300 and 1000 μg mL⁻¹) as per the literature³³ of INH and INH-CP, respectively for 48 h. At the end of 48 h, 50 μL of MTT (5 mg mL⁻¹ stock) was added to the cells and further incubated for three h at 37 °C. At the end of incubation period, the contents of the plate were discarded by simple decantation, and the plates were dried overnight at room temperature. The purple-colored formazon crystals formed were dissolved in 100 μL of dimethyl sulfoxide by shaking at 400 rpm for 15 min at room temperature in a thermo shaker (Thermofisher Scientific). The intensity of the colour developed was absorbed in 570 nm in a multimode microplate reader (MultiSkan Go, ThermoFisher Scientific). The growth percentage inhibition and 50% growth inhibition (GI₅₀) values were calculated using a pre-programmed MS-Excel template. The percentage inhibition of each compound was calculated using the formula: % inhibition = (mean absorbance of treated cells/mean absorbance of control) × 100.

Assessment of ROS generation. The cells were trypsinized when they were at 80% confluence and seeded in a 96-well plate at the density of 1 × 10⁴ cells per well. The cells were incubated overnight in a CO₂ incubator at 37 °C and 5% CO₂ under controlled humidified atmosphere to allow them to attach to the plate. The cells were then utilized for ROS assay by the method as previously described.⁴⁴ After overnight incubation, the cells were exposed to different concentrations of INH and INH-CP for 48 h. At the end of 48 h, the media was removed, cells were added with 100 μL of 10 μM 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) solution and further incubated for 20 minutes at 37 °C in a humidified 5% CO₂ atmosphere. After the 20 minute incubation period, the extracellular DCFH-DA containing media was removed, 200 μL of phosphate buffered saline (PBS) was added, and fluorescence was monitored and measured in a multimode microplate reader using fluorescence mode at 480 and 530 nm for excitation and emission, respectively.

In vivo toxicity evaluation

Acute toxicity study using zebra fish model. Wild-type zebra fish (Danio rerio) were purchased from a Beryl Aqua, Fish farm, Chennai, India. Before experimentation fish were acclimated at a density of 50 fish per tank (50 litres) for two weeks in an aquarium at 28 °C ± 1 °C with a 14 : 10 light/dark cycle and were fed twice daily with (1% fish weight per day) dry flake diet (Taiyo Flakes, Taiyo Feed Mill Pvt Ltd, India) and Artemia (Beryl Aqua, Fish farm, Chennai, India).

All the procedures were conducted by reference to the guidelines of OECD 203 (OECD 203, 1992).⁴⁵ After acclimatization, fish (weight 0.43 ± 0.07 g) were randomly selected and divided into the exposed and control group. Test concentrations for LC₅₀ were fixed at 25, 50, 75, 100, 125 and 150 mg L⁻¹ for INH and INH-CP, in triplicates. Test suspensions were prepared and dispensed using magnetic stirrer for 20 minutes. The control was kept under the same condition without the addition of test samples. Animals were checked twice daily for any mortality and behavioral changes at an interval of 24, 48, 72 and 96 hours. Abnormalities in behavior such as loss of equilibrium, swimming behavior, respiratory function and pigmentation were recorded daily. The LC₅₀ dose was calculated by using the software, Statistical Product and Service Solution 23.0 (SPSS, USA). All the animal experiments were conducted according to the procedures of Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA) as instructed by Institutional Animal ethical guidelines, SRM University.

Histopathology. To investigate the effects of INH and INH-CP, liver tissues of zebra fish were collected after 96 h acute toxicity study, fixed in 4% paraformaldehyde, and processed sequentially in ethanol, xylene and paraffin. Tissues were then embedded in paraffin wax, sectioned (5 μm), and mounted on slides.⁴⁶ The sections were subsequently stained with hematoxylin and eosin. Histological images were obtained using a histological microscope (Leica, Germany).

Total glutathione (GSH) levels. The total GSH levels were assayed as described by Irfan Rahman⁴⁷ for sub lethal dose of INH and INH-CP. The liver tissues were homogenized in 0.6% sulfosalicylic acid solution and centrifuged at 8000g for 10 min at 4 °C. The homogenate (10 μL) was mixed with 20 μL of 4.8 mM of NADPH, 5 μL of 20 mM DTNB, 20 μL of GR (20 IU mL⁻¹) and 0.945 mL of KPE (0.1 M potassium phosphate buffer with 5 mM EDTA disodium salt) and recorded the absorbance at 412 nm for 1 minute. The rate was compared with a standard curve of GSH in KPE buffer.

Gene expression analysis. At the end of the exposure to INH and INH-CP, total RNA was isolated from pools of 4–5 dissected livers using TRIzol reagent (SRL, India). The ratio of absorbance (260/280 nm), as well as the banding pattern on a 1% agarose gel, was used to verify the quality of the RNA in each sample. Total RNA isolated was reverse transcribed into cDNA using a cDNA synthesis kit (Prime Script™ 1st Strand cDNA Synthesis Kit, Takara Bio, USA) as per the manufacturer's protocol.

Real-time quantitative PCR was performed on a Light Cycler 96 Real-Time PCR system with SYBR Green Master Mix (Takara Bio, USA). The 20 μL qRT PCR mix consisted of 2 μL of cDNA, 10 μL SYBR Green Master Mix, 1 μL of forward/reverse primers (10 mM) and 7 μL of nuclease free water. A real-time PCR assay was conducted using the following PCR protocol: denaturation for 35 s at 95 °C, followed by 40 cycles of 5 s at 95 °C, and 1 min at 60 °C. The transcript of the housekeeping gene β-actin was used to standardize the results by eliminating variations in mRNA and cDNA quantity and quality, and each mRNA level is expressed as its ratio with the corresponding β-actin mRNA level.

Primer sequences and their annealing temperatures and amplification efficiencies are listed in Table 1.

Table 1 Primer sequences used for real-time PCR (qPCR)

Gene name	Forward primer	Reverse primer	Annealing temperature	Reference
β-Actin	GAC CTG ACT GAC TAC CTC	ATA CCG CAA GAT TCC ATA C	55.4 °C	52
cyp2p6	ACTGAGACCACCTCCACCAC	CATTGGTGTAGGGCATGTTG	62 °C	24
CYP3A	TTGAGGAGCGGTGGTGAGCATTAG	TGGAGAGAGTGAACTTCGGATTCG	61.7 °C	52
PXR	ATGCGGCGACAAATCTACTGGC	TGTGAAGTGTGGCAGAGAGGTG	60.5 °C	52

---

Comet assay. The comet assay was performed according to the Tice et al. 2000 (ref. 48) with modification. Normal slides were dipped in 1% NMA agarose gel in MilliQ water. About 10 μL of liver cells was added in the second gel layer (90 μL of 0.5% LMP agarose gel in PBS), which was covered by a third agarose layer (90 μl of 0.5% LMPA). The slides were kept in the refrigerator for 10 min. After solidification, the slides were immersed in cold lysis solution (2.5 M NaCl, 100 mM EDTA, 10 mM Tris–base, pH 10, with 10% DMSO and 1% Triton X-100 added fresh) for 2 hour at 4 °C. The slides were placed in electrophoresis chamber containing a fresh and cold buffer (300 mM NaOH, 1 mM EDTA, pH 13) for 20 min. The electrophoresis was done at 25 V and 300 mA for 20 min at 4 °C. At the end of the electrophoresis, the slides were neutralized with 0.4 M Tris, then stained with 100 μL ethidium bromide (20 μg mL⁻¹) for 10 min, rinsed with distilled water and kept in a moist chamber at 4 °C. For analysis, images from a Carl Zeiss AX10 microscope (magnification ×300) were captured with an air-cooled camera.

The cells that had undergone DNA damage appeared as comets, with a tail of fragmented and decondensed DNA, while the control cells had a rounder and condensed nucleus. The migration of the DNA is a function of the number of breaks and the tail length.⁴⁹ Three measures of DNA damage: DNA percentage in tail, tail moment and Olive moment,⁵⁰ was calculated using Open comet image analysis software. The % DNA in comet tail is the relative fluorescence intensity (DNA concentration) in the tail, and it is computed as the total comet tail intensity (I_t) divided by the total comet intensity (I_C), multiplied by 100.^51,52 % DNA_t = I_t/I_C × 100.

The tail moment was introduced by Olive et al., 1990 (ref. 53) and which is calculated by multiplying tail length and fluorescence intensity of the tail. Tail migration length is the distance from the middle of nucleoid core of the comet to the end of the tail, generally presented in microns (μm). Migration length is expected to be proportional to the level of DNA single stranded breaks (SSB) and alkali-labile site (ALS), and inversely proportional to the extent of DNA cross-linking.⁴⁸ In our study, we have used the percentage of DNA in the tail as a measure of DNA damage.

Statistical analysis. Statistical calculations were carried out with the Statistical Product and Service Solution 23.0 (SPSS) and Graph Pad Prism 5 software programs. All values were presented as the mean ± SD. The data were statistically analyzed using analysis of variance (ANOVA), and a P-value of less than 0.05 was considered as statistically significant.

Results

In vitro cytotoxicity assays

Effect of INH and INH-CP on HepG2 cell viability. Cytotoxic effects of INH and INH-CP in HepG2 cells were assessed by performing MTT assay. The GI₅₀ value calculated as found to be 207 μg mL⁻¹ for INH and >1000 μg mL⁻¹ for INH-CP. At the highest tested concentration (1000 μg mL⁻¹) of INH and INH-CP, for 48 hours, the percentage of cell viability was 22% and 66% respectively. The graphical representation of the result data in Fig. 2 and microscopic pictures of morphological assessment of the compounds on HepG2 cells are given in ESI (Fig. S2).†

Fig. 2 Cytotoxic Effect of INH and INH-CP in HepG2 cells. Cells were treated by dose-dependent manner for 48 h. The ratios of cell viability was measured by MTT assay. The values of graph represent mean ± S.D of three independent experiments, P < 0.05.

Evaluation of the oxidative stress. The level of ROS generation in HepG2 cells exposed to INH and INH-CP for 48 h, was evaluated by measuring DCFDA cleavage into fluorescent DCFH. The concentrations for oxidative stress evaluation were fixed above and below GI₅₀ value on HepG2 cells (100, 300 and 1000 μg mL⁻¹). The control group showed low fluorescence emission when compared to INH and INH-CP treated groups of fish. When HepG2 cells were exposed to isoniazid, significant (p < 0.001) ROS generation was observed at all test concentrations. However, INH-CP treated group of cells exhibited low fluorescence emission, where the increase in ROS was not significant (Fig. 3).

Fig. 3 Reactive oxygen species (ROS) in INH and INH-CP exposure. Values are mean ± SD; symbols indicate statistical significance of p < 0.0001 (***) from control.

In vivo assessment of INH and INH-CP effect in adult zebra fish

Acute toxicity evaluation. Mortality in the animals for isoniazid was dose- and time-related. Behavioral changes were higher at the end of the exposure, like hyper excitability, rapid movement, followed by reduction in swimming and laid on one side or still at the bottom of the tank before death (ESI ST2†). No mortality or behavioral changes were observed in INH-CP exposure even up to a dose of 150 mg L⁻¹ for seven days, as in the control group.

Exposure to >100 mg L⁻¹ of isoniazid caused 100% mortality within 72 hours. The effect of exposure duration on INH toxicity was also examined. It was observed that toxic responses were more severe following longer exposure. Hence mortality in INH treatment was both dose- and time-dependent. The concentrations causing 10%, 50% and 90% of mortality (LC₁₀, LC₅₀ and LC₉₀, respectively) in the toxicity experiments and their corresponding 95% confidence intervals (CI) were calculated by Probit analysis using SPSS (version 23.0). The calculated LC₁₀, LC₅₀ and LC₉₀ values are given in Table 2. However, no mortalities or morphological abnormalities in was observed in INH-CP treatment even up to a concentration of 150 mg L⁻¹ and a period of 7 days exposure. The sub-lethal dose of 50 mg L⁻¹ for isoniazid, was used for examining the changes in gene expression and GSH levels.

Table 2 Calculated lethal concentrations (mg L⁻¹) with their 95% Confidence Intervals (CI) for isoniazid on zebrafish after 48, 72 and 96 h of exposure

Time (hours)	LC10 (95% CI)	LC50 (95% CI)	LC90 (95% CI)
48	86.802 (23.47–102.24)	109.694 (68.84–118.09)	138.623 (129.123–213.22)
72	71.986 (54.094–80.903)	86.407 (74.531–93.469)	103.719 (96.140–115.34)
96	50.779 (36.552–58.813)	64.836 (54.545–71.483)	82.783 (75.45–93.730)

---

The cumulative mortality data plotted against log of dose concentration is given in Fig. 4. Using the statistical analysis, it was found that 96 h LC₅₀ for INH and INH-CP system were significantly different (p < 0.05).

Fig. 4 Dose and time dependent effects of INH on adult zebrafish Danio rerio. Percentage mortality was assessed in adult zebrafish exposed to different concentrations of INH. The values represent the mean ± SD for three replicates. Statistically significant differences of p < 0.0001, by two-way ANOVA.

Histopathological features of liver by INH-CP system and isoniazid. In H&E stained slides of healthy untreated zebra fish liver, hepatocytes were normal, arranged in sheets, individual cells were large, round to polygonal with distinct border, abundantly clear to eosinophilic (pink colored) cytoplasm central round nucleus with coarsely granular chromatin inconspicuous nucleoli and observed hematopoiesis (Fig. 5A and B). The livers of isoniazid exposed zebra fish at concentration of 75 mg L⁻¹ for 96 hours revealed vacuolation, cells with loss of distinct cell border in the focal area and inflammation (Fig. 5C and D). While histological examinations/of the INH-CP treated liver of zebra fish at a concentration of 150 mg L⁻¹ for 7 days revealed slight vacuolation and cells with distinct cell border and cellular integrity (Fig. 5 E and F).

Fig. 5 Histopathology of adult zebrafish liver sections stained with hematoxylin and eosin. (A and B) Liver histology of control group, hepatocytes (h), nuclei (nu) and (s) sinusoids, (e) erythrocyte. (C and D) 96 hour, 75 mg L⁻¹ isoniazid exposure group, (v) vacuolar degeneration, (n) neutrophil, (d) membrane disintegration. (E and F) 150 mg L⁻¹ INH-CP, 7 days' exposure group, slight vacuolation, distinct cell membrane.

Changes in total GSH levels. Hepatic total GSH levels decrease by 40% (319.4 ± 2.7 nmoles per liver) when compared to control (498.8 ± 7.34 nmoles per liver) in zebrafish treated with 50 mg L⁻¹ of isoniazid for 96 h indicate that the antioxidant defence system is overwhelmed by ROS (Reactive Oxygen Species). Treatment with 150 mg L⁻¹ of INH-CP for 96 h, showed 18% (627.9 ± 3.7 nmoles per liver) induced level compared to controls, which can be a response to prevent oxidative stress (Fig. 6).

Fig. 6 Concentration of total glutathione (GSH). In zebrafish liver samples exposed to 50 mg L⁻¹ INH (96 h) and 150 mg L⁻¹ INH-CP (7 days). Data represent mean concentrations from n = 3. Comparisons significant at p < 0.0001 are indicated with *** (versus control) and # (INH versus INH-CP treated groups). Statistic significant differences were detected with one-way ANOVA, Tukey's multiple comparison test.

Effect of INH and INH complexed nanocarrier on mRNA expression. A significant increase in PXR (23 folds), CYP3A (8.28 folds) and cyp2p6 (17.59 folds) transcription was observed in liver of INH-exposed fishes when compared to control (untreated, normal) animals. INH-CP treated, resulted in an increase in PXR (19 folds). The target CYP genes such as CYP3A and cyp2p6, which are involved in the metabolism of xenobiotics and INH were induced 8.6 fold, and 9.4 fold respectively in INH-CP treated fish. Our data indicate a decreasing trend of cyp2p6 gene expression when INH is encapsulated in the norbornene-based stimuli-responsive nanocarrier system (Fig. 7). The gene expression between INH and INH-CP treatment calculated had a significant P value of <0.001.

Fig. 7 Quantitative real time PCR. Expression-analysis of PXR, CYP3A and cyp2p6 genes in the zebrafish liver. Gene expression levels represent the relative mRNA expression compared to the control. Values are presented as the mean ± SD.

Comet test. DNA damage of isoniazid and INH-CP on zebra fish liver cells were assessed by comet assay. The minimum to median proportion of tail DNA of control cells ranged between 4.3% and 8.23%. Isoniazid treated cells showed a median damage of 40% DNA in tail. Whereas tail DNA in INH-CP (150 mg L⁻¹) of 7 days' exposure showed a maximum of 26.35% (Fig. 8a and b).

Fig. 8 (a) Percentage of tail DNA in liver cells of zebrafish after 96 hour exposure to 75 mg L⁻¹ of isoniazid and 7 days' exposure to 150 mg L⁻¹ of INH-CP. Data are given as means within box plots. **p < 0.001 for significant differences from controls and *p < 0.05 (ANOVA-Tukey's multiple comparison test). (b) Comet images of (A) control, (B) damaged DNA in (75 mg L⁻¹) isoniazid.

Discussion

The present study provides an overview of effects of isoniazid, and the norbornene derived isoniazid copolymer (INH-CP) system on HepG2 cell line and adult zebra fish model. The various endpoints measured in the animal model study are 96 h LC₅₀ value and behavioral changes, histopathological examination of liver, GSH levels, changes in gene expression of drug metabolizing genes (CYP3A, cyp2p6 and PXR) and DNA damage by Comet assay.

Behavioral changes during the treatment increased with dose and duration of exposure. On initial exposure to different concentrations of INH there were no behavioral alterations but at the end of the exposure, fish exhibited characteristic avoidance behavior by rapid and erratic swimming with jerky movements and hyperexcitability. Such abnormal behavior and altered movements may be associated with enzymatic and ionic disturbances in blood and tissues.^54,55 Finally, the fish were found dead at the bottom of the tank; the control fish remained alive and active throughout the experimental period. Therefore, toxic effects of the standard drug (INH) was evidently different from the norbornene based nanocarrier complexed INH drug. Acute toxicity experiments show that INH toxicity was dose dependent, similar results have been reported in zebra fish embryos by Zhang Yun., et al., 2015.⁵⁶ Of the two samples tested, isoniazid and INH-CP, the median lethal concentration for 96 h studies of isoniazid, was found to be 64.83 mg L⁻¹.

Histopathological evaluation of zebra fish liver after treatment with INH and INH-CP was conducted. Histological findings in the INH treatment (75 mg L⁻¹) for 96 h indicate that in the adult zebra fish liver, hepatocytes cell membranes were disintegrated. The cytoplasm of the hepatocytes was moderately glycogen like – vacuolation, and also observed inflammation in the tissue. These findings indicate the INH treatment caused destructive effect in the liver tissue of zebra fish.⁵⁵ Lipid accumulation with cell membrane rupture indicates deleterious effect.⁵⁵ However, the isoniazid encapsulated treatment, at a dose of 150 mg for 7 days, the liver tissues did not show any adverse changes, like disintegration of cells or vacuolation in the structure of the hepatic tissue, ensuring protective effect of isoniazid when complexed in the norbornene-based system.

Measuring the level of total GSH (non-enzymatic antioxidant) is an important biomarker to study antioxidant defense system in animals. A change in tGSH level is thought to be an adaptive response of cells against oxidative stress.⁵⁷ A depletion of the antioxidant enzyme has been observed in INH treatment of 50 mg L⁻¹ for 96 hours. INH complexed in norbornene-based nano carrier, at a dose of (150 mg L⁻¹) showed an increase in the level of the antioxidant enzyme (GSH), which can be for reducing the oxidative damage.⁵⁷ However, a decrease in the GSH level during INH treatment represent severe oxidative stress and which in turn indicates the antioxidant defence system is overwhelmed by ROS.^58,59

CYP2E1 has been reported for isoniazid toxicity in human hepatocytes and rats.^60,61 CYP2E1 is involved in the metabolism of INH, resulting in hepatotoxic intermediates.^62,63 Therefore, increase in cyp2p6 (homolog of CYP2E1) expression in INH exposure, is a sign of oxidative stress. The INH complexed norbornene-based nano carrier treatment resulted in decrease in the cyp2p6 gene expression, exhibiting control over the production of toxic metabolites from INH. But there was no difference in CYP 3A mRNA expression in INH and INH-CP treatments. The induction of PXR gene in INH-CP treatment indicate, it might be an inducer of the pregnane X receptor (PXR) gene. Our data also supports the previous findings that zebra fish homologs of the mammalian drug metabolizing genes (PXR, CYP3A and CYP2E1) are expressed in the zebra fish liver and suggest possible involvement of genes in metabolizing INH-CP system in zebra fish.^29,30

Comet assay is a rapid, sensitive and economic technique for the detection of single strand breaks, hence suggested as a good nonspecific biomarker of genotoxicity in aquatic species.⁶⁴

Comet assay was performed to evaluate the potential genetic damage to the hepatocytes of zebra fish on exposure to the drugs. Liver cells subjected to INH show extremely significant increase in % tail DNA compared to healthy untreated zebra fish liver cells DNA, indicate DNA damage. The percentage DNA in tail is directly proportional to the amount of damaged DNA,⁶⁵ and similar results were reported earlier for isoniazid.^66,67 However interestingly in the present study administration of INH complexed in norbornene-based nanocarrier showed significant reduction of DNA damage, suggesting a protective role of the norbornene-based nano carrier on liver cells. This is the first report on the protective effect of this isoniazid complexed norbornene-based nanocarrier on liver cells.

Conclusion

The in vitro and in vivo investigations reveal that the newly designed stimuli-responsive norbornene derived isoniazid copolymer reduces the toxic effects of INH and provides protection against the drug-induced liver toxicity. In vitro cytotoxicity assays in HepG2 cells showed that norbornene derived isoniazid copolymer had no toxicity up to 1000 μg mL⁻¹. However, isoniazid showed 78% mortality at the same concentration. The acute in vivo toxicity studies using zebra fish model reveal that even at a higher concentration norbornene derived isoniazid copolymer, exhibit no mortality compared to isoniazid, and also observed no significant morphological or behavioral changes in zebra fish. Histopathology of INH-CP treated zebra fish liver tissues showed almost normal architecture even after treatment duration of 7 days. The findings from QPCR of PXR, CYP3A, cyp2p6 genes, total glutathione level (non-enzymatic markers of oxidative stress) and ROS production mediated DNA damage by comet assay, indicate the hepatoprotective and non-toxic nature of INH-CP system compared to INH. The present study on zebra fish model and Hep G2 cells, is the first report of the protective effect of norbornene derived isoniazid copolymer isoniazid on liver cells.

Acknowledgements

We wish to thank the Department of Biotechnology, SRM University for the financial support of this project. One of the authors, Anju would like to thank Dr Winkin Santhosh (Assistant Professor, Nandanam Arts College, Chennai), Dr Kanchana Mala, SRM Medical Research, Mr Faizal Nizam, (Division of Fisheries Biotechnology & Molecular Biology, Faculty of Science and Humanities, SRM University), Dr M. R. Ganesh, (ISISM, SRM University), Dr G. Shivashekar and Dr Srinarthana (Department of Pathology, SRM Medical College and Research Centre), Dr Bhaskar (Department of Chemistry, SRM University) and Dr A. Subbarayan and Mr Nilkanth for their support in statistical analysis. We would also like to thank Mrs Mekala, Mrs Gayathri and Mr Balaji, DTP section, SRM University.

References

1. A. Godwin, K. Bolina, M. Clochard, E. Dinand, S. Rankin, S. Simic and S. Brocchini, J. Pharm. Pharmacol., 2001, 53, 1175–1184.
2. M. Kovar, L. Kovar, V. Subr, T. Etrych, K. Ulbrich, T. Mrkvan, J. Loucka and B. Rihova, J. Controlled Release, 2004, 99, 301–314.
3. P. R. Patel, R. C. Kiser, Y. Y. Lu, E. Fong, W. C. Ho, D. A. Tirrell and R. H. Grubbs, Biomacromolecules, 2012, 13(8), 2546–2553.
4. A. Leitgeb, J. Wappel and C. Slugovc, Polymer, 2010, 51, 2927–2946.
5. Handbook of Metathesis, ed. R. H. Grubbs, Wiley-VCH, Weinheim, 2003, vol. 3, p. 26, Trnka TM.
6. R. H. Grubbs, Acc. Chem. Res., 2001, 34, 18–29.
7. J. E. Gestwicki, L. E. Strong, C. W. Cairo, F. J. Boehm and L. L. Kiessling, Chem. Biol., 2002, 9, 163–169.
8. E. M. Kolonko, J. K. Pontrello, S. L. Mangold and L. L. Kiessling, J. Am. Chem. Soc., 2009, 131, 7327–7333.
9. K. Lienkamp, A. E. Madkour, A. Musante, C. F. Nelson, K. Nusslein and G. N. Tew, J. Am. Chem. Soc., 2008, 130, 9836–9843.
10. M. F. Ilker, G. N. Tew and E. B. Coughlin, in Antiterrorism and Homeland Defense, ed. J. Reynolds et al., ACS Symposium Series, American Chemical Society, Washington, DC, 2007, p. 175.
11. A. Tostmann, M. J. Boeree, R. E. Aarnoutse, W. C. de Lange, A. J. van der Ven and R. Dekhuijzen, J. Gastroenterol. Hepatol., 2008, 23, 192–202.
12. D. S. Askgaard, T. Wilcke and M. Dssing, Thorax, 1995, 50, 213–214.
13. A. Tostmann, et al., Int. J. Antimicrob. Agents, 2008, 31, 577–580.
14. M. Singh, P. Sasi, G. Rai, V. H. Gupta, D. Amarapurkar and P. P. Wangikar, Medicinal Chemistry Research, 2011, 20(9), 1611–1615.
15. D. L. Chen, G. Y. Wang, B. Xu and K. S. Hu, J. Photochem. Photobiol., B, 2002, 66, 188.
16. S. R. Mane, V. N. Rao, K. Chatterjee, H. Dinda, S. Nag, A. Kishore, J. D. Sarma and R. Shunmugam, J. Mater. Chem., 2012, 22, 19639–19642.
17. V. E. Fako and D. Y. Furgeson, Adv. Drug Delivery Rev., 2009, 61, 478–486.
18. G. J. Lieschke and P. D. Currie, Nat. Rev. Genet., 2007, 8, 353–367.
19. A. D. B. Vliegenthart, C. S. Tucker, J. D. Pozo and J. W. Dear, Br. J. Clin. Pharmacol., 2014, 78(6), 1217–1227.
20. D. R. Nelson, L. Koymans, T. Kamataki, J. J. Stegeman, R. Feyereisen, D. J. Waxman, M. R. Waterman, O. Gotoh, M. J. Coon, R. W. Estabrook, I. C. Gunsalus and D. W. Nebert, Pharmacogenetics, 1996, 6(1), 1–42.
21. J. Watanabe, S. Hayashi and K. Kawajiri, J. Biochem., 1994, 116(2), 321–326.
22. S. Hayashi, J. Watanabe and K. Kawajiri, J. Biochem., 1991, 110(4), 559–565.
23. T. Sotsuka, Y. Sasaki, S. Hirai, F. Yamagishi and K. Ueno, In Vivo, 2011, 25, 803–812.
24. P. Das Roy, M. Majumder and B. Roy, Pharmacogenomics, 2008, 9(3), 311–321.
25. A. P. Li, M. K. Reith, A. Rasmussen, J. C. Gorski, S. D. Hall, L. Xu, D. L. Kaminskiand and L. K. Cheng, Chem.-Biol. Interact., 1997, 107(1–2), 17–30.
26. J. M. Lehmann, D. D. McKee, M. A. Watson, T. M. Willson, J. T. Moore and S. A. Kliewer, J. Clin. Invest., 1998, 102, 1016–1023.
27. F. Li, J. Lu, J. Cheng, L. Wang, T. Matsubara, I. L. Csanaky, C. D. Klaassen, F. J. Gonzalez and X. Ma, Nat. Med., 2013, 19(4), 418–420.
28. A. C. Bainy, A. Kubota, J. V. Goldstone, R. Lille-Langøy, S. I. Karchner, M. C. Celander, A. Goksøyr and J. J. Stegeman, Aquat. Toxicol., 2013, 142, 447–457.
29. T. Bresolin, M. de Freitas Rebelo and A. Celso Dias Bainy, Comp. Biochem. Physiol., Part C: Toxicol. Pharmacol., 2005, 140(3–4), 403–407.
30. O. Tsedensodnom, A. M. Vacaru, D. L. Howarth, C. Yin and K. C. Sadler, Dis. Models & Mech., 2013, 6, 1213–1226.
31. C. E. Schwab and H. Tuschl, Hum. Exp. Toxicol., 2003, 22, 607–615.
32. A. F. Slater, C. Stefan, I. Nobel, D. J. van den Dobbelsteen and S. Orrenius, Toxicol. Lett., 1995, 82, 149–153.
33. S. Bhadauria, R. Mishra, R. Kanchan, C. Tripathi, A. Srivastava, A. Tiwari and S. Sharma, Toxicol. Mech. Methods, 2010, 20(5), 242–251.
34. S. J. Stohs and D. Bagchi, Free Radical Biol. Med., 1995, 18, 321–336.
35. A. N. Glazer and E. L. Smith, in The Enzymes ed. P. D. Boyer, Academic Press, New York, third edn, 1971, vol. 3, p. 502.
36. C. Harris and J. M. Hansen, Methods Mol. Biol., 2012, 889, 325.
37. J. S. Crippin, Am. J. Gastroenterol., 1993, 88(4), 590–592.
38. B. Sangameswaran, S. K. Baljeet, S. Arpita, K. Ilango and P. D. Govind, Continental Journal of Pharmaceutical Sciences, 2012, 6, 30–35.
39. K. Ito, K. Yamamoto and S. Kawanishi, Biochemistry, 1992, 31(46), 11606–11613.
40. R. F. Whiting, L. Wei and H. F. Stich, Mutat. Res., Fundam. Mol. Mech. Mutagen., 1979, 62(3), 505–515.
41. A. A. Caro and A. I. Cederbaum, Annu. Rev. Pharmacol. Toxicol., 2004, 44, 27–42.
42. R. R. Tice, E. Agurell, D. Anderson, B. Burlinson, A. Hartmann and H. Kobayashi, et al., Environ. Mol. Mutagen., 2008, 35, 206–221.
43. T. Mosmann, J. Immunol. Methods, 1983, 65(1–2), 55–63.
44. Z. Mostafavi-Pour, F. Khademi, F. Zal, A. R. Sardarian and F. Amini, Hepatitis Mon., 2013, 13(8), 11447.
45. OECD, Fish acute toxicity test, Organization for economic cooperation and development, Paris, 1992.
46. A. G. E. Pearse, in Histochemistry. Theoretical and Applied, Analytical technology, Churchill-Livingstone, Edinburgh, London, 4th edn, 1985, vol. 2, p. 441.
47. I. Rahman, A. Kode and S. K. Biswas, Nat. Protoc., 2006, 1, 3159.
48. R. R. Tice, E. Agurell, D. Anderson, B. Burlinson, A. Hartmann, H. Kobayashi, Y. Miyamae, E. Rojas, J. C. Ryu and Y. F. Sasaki, Environ. Mol. Mutagen., 2000, 35, 206–221.
49. N. P. Singh, M. T. McCoy, R. R Tice and E. L. Schneider, Exp. Cell Res., 1998, 175, 184–191.
50. T. S. Kumaravel and A. N. Jha, Mutat. Res., 2006, 605, 7–16.
51. CometScore Tutorial, http://AutoComet.com, accessed May 2016.
52. A. Schnurstein and T. Braunbeck, Ecotoxicol. Environ. Saf., 2001, 49, 187–196.
53. P. L. Olive, J. P. Banath and R. E. Durand, Radiat. Res., 1990, 122, 86–94.
54. A. Larsson, B. E. Bengtsson and C. Haux, Aquat. Toxicol., 1981, 1(1), 19–35.
55. J. C. Wolf, W. A. Baumgartner, V. S. Blazer, A. C. Camus, J. A. Engelhardt, J. W. Fournie, S. Frasca Jr, D. B. Groman, M. L. Kent, L. H. Khoo, J. M. Law, E. D. Lombardini, C. R. Fehlert, H. E. Segner, S. A. Smith, J. M. Spitsbergen, K. Weber and M. J. Wolfe, Toxicol. Pathol., 2015, 43, 297–325.
56. Z. Yun, W. Yuan, C. W. Yun, S. Chen, W. Xi min, H. Qiuxia, H. Li wen, W. Xue, H. Jian and L. Kechun, Shandong Sci., 2015, 28(5), 14–21.
57. J. M. Zodrow, J. J. Stegeman and R. L. Tanguaya, Aquat. Toxicol., 2004, 66, 25–38.
58. A. Dubey, M. Goswami, K. Yadav and D. Chaudhary, PLoS One, 2015, 10(5), e0127493.
59. E. Oberdörster, Environ. Health Perspect., 2004, 112, 1058–1062.
60. J. Yue, R. X. Peng, J. Yang, R. Kong and J. Liu, Acta Pharmacol. Sin., 2004, 25, 699–704.
61. J. Yue and R. Peng, Br. J. Pharmacol., 2009, 157, 331–333.
62. D. E. Ryan, L. Ramanathan, S. Iida, P. E. Thomas, M. Haniu, J. E. Shively, C. S. Lieber and W. Levin, J. Biol. Chem., 1985, 260(10), 6385–6393.
63. Y. S. Huang, H. D. Chern, W. J. Su, J. C. Wu, S. C. Chang, C. H. Chiang, F. Y. Chang and S. D. Lee, Hepatology, 2003, 37(4), 924–930.
64. C. L. Mitchelmore and J. K. Chipman, Mutat. Res., 1998, 399, 135–147.
65. A. R. Collins, M. Dobson, G. Dusinska, G. Kennedy and R. Stetina, Mutat. Res., 1997, 375, 183–193.
66. S. K. Jatav, A. Kulshrestha, A. Zacharia, N. Singh, G. Tejovathi, P. S. Bisen and G. B. Prasad, J. Evidence-Based Complementary Altern. Med., 2014, 19(3), 189–194.
67. M. Sankar, J. Rajkumar and J. Devi, Pak. J. Pharm. Sci., 2015, 28(3), 983–990.

---

Footnote

† Electronic supplementary information (ESI) available. See DOI: 10.1039/c6ra23557c

---