Dietary chitosan oligosaccharide supplementation improves foetal survival and reproductive performance in multiparous sows

Abstract

Chitosan oligosaccharide (COS), a partially hydrolysed product of chitosan, has various important biological activities. In the present study, we explored the effects of dietary COS supplementation on the reproductive performance and gene expression of certain biochemical markers in the placenta and foetus of sows. Fifty-two Yorkshire multiparous sows were randomly allocated into two groups after mating (n = 26) and fed either with a corn–soybean basal diet (CON) or the basal diet supplemented with 100 mg kg⁻¹ COS (COS). We show that COS supplementation significantly enhanced (P < 0.05) the foetal survival rate and size (crown-to-rump length) after 35 days of gestation. COS supplementation also significantly elevated (P < 0.05) the number of viable piglets born per litter and the average weights for piglets born alive. Interestingly, COS supplementation not only elevated (P < 0.05) serum leptin and immunoglobulin (IgG, IgA, and IgM) concentrations but also increased (P < 0.05) the total antioxidant capacity (T-AOC) at 35 days of gestation. Moreover, the serum leptin and IgG concentrations were higher (P < 0.05) in COS than in the CON group at 85 days of gestation. Importantly, dietary COS supplementation not only up-regulated (P < 0.05) the expression levels of leptin and VEGFA in the placenta but also elevated (P < 0.05) the expression of critical foetal development-related genes (STAT3, TGF-β, and FGFR2) in the foetus at 35 days of gestation. Collectively, these results furthered our understanding of the mechanisms underlying the beneficial effects of COS on foetal development and reproductive performance in pregnant sows.

---

Introduction

In recent years, various feed additives, such as antibiotics, have been widely used in the livestock industry as growth promoters and therapeutic medicines to decrease animal susceptibility to diverse infectious diseases.¹ However, continuous use of these agents not only leads to drug resistance but also increases the risk of drug residue in livestock products.² Therefore, the development of “green” or safe feed additives has attracted considerable research interest.^3,4 Among green feed additives, oligosaccharides possess important physicochemical and physiological properties that can benefit animal health.^5–7 Most importantly, oligosaccharides are renewable, non-toxic, biocompatible, and biodegradable.^8,9 Hence, oligosaccharides (e.g., manno oligosaccharide, fructo oligosaccharides, and COSs) may be potential alternatives to antibiotics for use in livestock industry.

COS is a natural alkaline polymer of glucosamine with a number of bioactive groups (e.g., amino and hydroxyl) similar to other plant polysaccharides.^10–12 COS can be efficiently derived by chemical and enzymatic hydrolysis of poly-chitosan¹³ and has a low molecular weight, good solubility, and low viscosity.¹⁴ COS exhibits a wide variety of biological activities, including immune system enhancement,^15,16 antimicrobial activity,^17,18 and protection against pathogenic infections.¹⁹ Due to its beneficial effects, COS can be used as a pro-health feed supplement for animals as well as an alternative to feed antibiotics.²⁰ In particular, several studies have shown that dietary supplementation with COS could improve growth performance and apparent digestibility²¹ while enhancing animal health.^22,23 Additionally, COS is a very promising compound for use as a natural antioxidant in animals.²⁴

It is well known that sow diet and health during gestation are important for foetal survival and sow reproductive performance. For instance, some functional oligosaccharides have been used to improve the pregnant animal reproductive performance, such as fructo oligosaccharides and COSs.²⁵ Nonetheless, the relationship between the duration of COS supplementation and foetal survival and maternal performance remains largely unknown.

This study mainly aimed to investigate the effects of dietary COS supplementation on performance and foetal survival and development in multiparous sows during gestation. We evaluated changes in reproductive performance, variations in gene expression levels in the placenta and foetus, and alterations in serum parameters of multiparous sows after COS supplementation. Our results may offer a theoretical basis for developing functional carbohydrates, such as COS, as a green feed additive for the livestock industry.

Materials and methods

Preparation and composition of COS

COS preparation and composition analysis was completed by the Dalian Institute of Chemical Physics, Chinese Academy of Sciences (Dalian, China). The COS used in this study was a natural chitosan product obtained by enzymolysis using an enzyme mixture that included cellulase, alpha amylase, and proteinase. The enzymolysis product was a mixture of several oligosaccharides with a degree of deacetylation over 95% and an average molecular weight ≤ 1000 Da. The COS weight percentages were 3.7%, 16.1%, 28.8%, 37.2% and 14.2%, with a degree of polymerization of 2–6 in the oligomixture. The COSs each had an active amino group, which contributes to their many biological activities.

Animals and experimental design

Fifty-two multiparous sows (Yorkshire; high-prolificacy gilts introduced to China from Canada) whose parity was from 3 to 4 were selected from a commercial pig farm (Leshan, China) and transported to Sichuan Agricultural University (Chengdu, China). The sows were individually housed in gestation crates (1.5 × 2.0 m) in a pregnancy room. The ambient temperature in the pregnancy room was maintained between 15 and 18 °C.

All sows were determined to be in the oestrous stage and were then inseminated twice with unfrozen semen via artificial insemination 3–5 days after weaning. From day 1 of mating, the sows were randomly allotted to one of two treatments (26 sows/treatment) to ensure that each group had a same number of sows with similar parity. The treatment groups were as follows: (1) control diet without supplementation (CON); (2) control diet with COS added at a concentration of 100 mg kg⁻¹ (COS). One week before the expected farrowing date, the sows were transferred from the pregnancy room to the farrowing room in individual farrowing crates (2.0 × 2.5 m). The ambient temperature in the farrowing room was maintained between 18 and 20 °C.

Diets and feeding management

The diets were formulated to meet or exceed the nutrient requirements recommended by the National Research Council (NRC) (2012),²⁶ and their compositions are shown in Table 1. The trial was divided into two periods, early (days 1 to 35 of gestation) and late pregnancy (day 36 of gestation to parturition). On days 1 to 35 of gestation, all sows were restricted to 2.2 kg per day of the early pregnancy diet. Starting on day 36 of gestation, all sows received the late pregnancy diet amount of 2.8 kg per day. Pregnant sows were given ad libitum access to water and fed their respective diets two times per day at 08.00 and 18.00 h throughout the experiment.

Table 1 Composition and calculated nutrient content of the basal diet

Ingredient (%)	Early pregnancy	Late pregnancy
	Days 1 to 35 of gestation	Day 36 of gestation to parturition
a The premix provided the following per kg of diets: 11 023 IU of VA, 1653.45 IU of VD3, 44.09 IU of VE, 4.4 mg of menadione, 4 μg of VB12, 9.9 mg of riboflavin, 33 mg of pantothenic acid, 55.1 mg of niacin, 551.0 mg of choline, 0.22 mg of biotin, 1.7 mg of folic acid, 15.2 mg of pyridoxine, 165.3 mg of Zn, 39.7 mg of Mn, 165.3 mg of Fe, 16.5 mg of Cu, 3.0 mg of I, and 3.0 mg of Se.
Corn	61.35	65.30
Soybean meal (crude protein 44.2%)	13.20	19.25
Wheat bran	18.80	6.75
Fish meal	1.50	3.00
Mono-calcium phosphate	1.50	1.70
Limestone	0.95	1.00
Salt	0.50	0.60
Lysine HCl	0.20	0.40
Vitamin–mineral premix^a	2.00	2.00
Calculated composition
Digestive energy (MJ kg^−1)	12.55	13.10
Crude protein	14.51	16.89
Lysine	0.61	1.08
Calcium	0.95	1.09
Total phosphorus	0.81	0.84
Available phosphorus	0.53	0.61

---

Sample collection and parturition record

Prior to the morning feeding on gestation day 35, six sows that were of the average body weight in each group were chosen, and blood samples were obtained by anterior vena cava puncture into a 10 mL tube. Briefly, the tubes were centrifuged at 3000 × g for 15 min to obtain serum. The isolated serum samples were stored at −20 °C until biochemical analysis. After blood sampling, twelve sows were anesthetized by lethal injections of sodium pentobarbital (200 mg kg⁻¹ BW) and the abdomen was immediately opened to remove the uterus and ovaries, which were weighed. The foetus, placenta and corpora lutea were collected and stored at −80 °C for further analysis. The ovulation rates (the numbers of corpora lutea) and the number of foetuses per litter (total foetuses, alive foetuses, viable foetuses and mummies) were counted. Additionally, crown-to-rump length and foetus weights were recorded as previously described.²⁷

Prior to the morning feeding on gestation day 85, blood samples from each group (six sows) were collected and stored as described above. To calculated birth weights of the piglets born alive per litter and the average weight for the live piglets, the individual piglet body weights were recorded at parturition. After all of the placentae were expelled, the number of piglets per litter (including total born, born alive, born viable, stillborn and mummified) were recorded.

Biochemical analysis of serum

Analyses of cytokines and immunoglobulins. The concentrations of inflammatory factors, such as interleukin 1 (IL-1) and tumour necrosis factor-α (TNF-α), and immunoglobulins (IgA, IgG, and IgM) in the serum samples were analysed using commercially available porcine specific ELISA kits (R&D Systems, Minneapolis, MN, USA) according to the manufacturer's instructions. Inflammatory factor and immunoglobulin concentrations were presented as picogram per millilitre (pg mL⁻¹) and microgram per millilitre (μg mL⁻¹) of serum, respectively.

Measurement of antioxidant-related index. To evaluate the balance between pro-oxidants and antioxidants in the blood, the antioxidant-related serum indexes, such as malondialdehyde (MDA), superoxide dismutase (SOD), total antioxidant capacity (T-AOC), and glutathione peroxidase (GSH-Px), were determined. All corresponding detection kits used in this study were supplied by the Nanjing Institute of Jiancheng Biological Engineering (Nanjing, China). MDA content was analysed according to the protocol described by Livingstone et al.²⁸ via the thiobarbituric acid reaction. MDA content was detected at 532 nm, and the results are presented as nanomoles per millilitre (nm mL⁻¹) of serum. SOD activity was measured according to the methods of Cao et al.²⁹ and one unit (U) of this enzyme was defined as the quantity of enzyme required to produce 50% inhibition of nitric ion production. T-AOC was measured using the colorimetric technique according to the method described by Miller et al.³⁰ All antioxidants can reduce Fe³⁺ to Fe²⁺, and the latter develops coloured and stable chelates when combined with phenanthroline. The serum T-AOC is expressed as units per millilitre (U mL⁻¹) of serum. GSH-Px activity was determined as described by Beulter³¹ via quantifying the rate of H₂O₂-induced oxidation of GSH to oxidized glutathione (GSSG). A yellow product with absorbance at 412 nm is formed as GSH reacts with dithiobisnitrobenzoic acid. Serum GSH-Px activity is expressed as U mL⁻¹ of serum where one U of GSH-Px is defined as the amount of enzyme that decreases 1 mmol L⁻¹ GSH within 1 min per millilitre of serum.

Assay of leptin and reproductive hormones. Progesterone, leptin, estradiol, and luteinizing hormone concentrations were measured using commercial kits supplied by the Beijing North Institute of Biological Technology (Beijing, China). The minimum detection limit was 0.6 ng mL⁻¹, 0.2 ng mL⁻¹, 1.0 pg mL⁻¹, and 5.0 mIU mL⁻¹ for progesterone, leptin, estradiol, and luteinizing hormone, respectively. The intra-assay coefficients of variation (CV) were 8.2%, 7.8%, 5.4%, and 5.7% for progesterone, leptin, estradiol, and luteinizing hormone, respectively. Moreover, the inter-assay CV was 9.2%, 10.5%, 9.4%, and 11.2% for progesterone, leptin, estradiol, and luteinizing hormone, respectively.

Quantitative real-time PCR

Placental and foetal total RNA isolation, cDNA synthesis and quantitative real-time PCR analysis were conducted as previously described.³² The primers used for quantitative real-time PCR analysis were commercially synthesized by Invitrogen (Shanghai, China) and are listed in Table 2. GAPDH (glyceraldehyde-3-phosphate dehydrogenase) expression was used as the reference gene to normalize mRNA expression of target genes, and the relative quantification of gene expression among the treatment groups was analysed using the 2^−ΔΔCt method.³³

Table 2 Primers used for quantitative real-time PCR

Items	Accession no.	Primer name and sequence (5′–3′)	Annealing temperature (°C)
a STAT3, signal transducer and activator of transcription 3.b VEGFA, vascular endothelial growth factor A.c TGF-β, transforming growth factor β.d FGFR2, fibroblast growth factor receptor 2.e RBP4, retinol binding protein 4.f PGR, progesterone receptor.g GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
STAT3^a	HM462247.1	ST-F, CGCCACTTTGGTGTTTCATAA	60.0
		ST-R, TGCTTGATTCTTCGCAGGTT
VEGFA^b	AF318502.1	VE-F, CAACGACGAAGGTCTGGAGTG	60.0
		VE-R, GCCCACAGGGATTTTCTTGC
TGF-β^c	NM214198.1	TG-F, TAGAGGGTTTTCGCCTCAGTG	60.0
		TG-R, CGCAGCAGTTCTTCTCCGT
FGFR2^d	NM001099924.1	FG-F, TGGCTCAGAGGATTTTGTCAGT	57.0
		FG-R, CGGATGGAACCACGCTTT
Leptin	AF102856.1	Le-F, GAGTCCAGGATGACACCAAAAC	60.0
		Le-R, ATGGAGCCCAGGGATGAAG
RBP4^e	NM214057.1	RB-F, GAGGACCCTGCCAAGTTCAA	60.0
		RB-R, CGATTTGCCATCACAGTAACCAT
PGR^f	GQ903679.1	PG-F, GACAACACCAAACCCGACAC	60.0
		PG-R, GATCTCCATCCTAGTCCAAATACC
GAPDH^g	NM001206359.1	G-F: ATGGTGAAGGTCGGAGTGAAC	60.0
		G-R: CTCGCTCCTGGAAGATGGT

---

Statistical analysis

Data were analysed by T-test using the statistical program SAS (version 9.0; SAS Inst., Inc., Cary, NC, USA) except for the foetal survival rate. The foetal survival rate data were analyse using chi-square test within SAS. Each sow and her litter was considered as an experimental unit. The results are expressed as the mean values with their standard errors (except the foetal survival rate). Probability values less than 0.05 were considered statistically significant.

Results

Reproductive performance

Uterine weight, ovary weight, total litter weight, and ovulation rate on day 35 of pregnancy did not differ (P > 0.05) between the two sow treatment groups (Table 3). Supplementing sows with COS resulted in a higher foetal survival rate (P < 0.05) on day 35 of pregnancy compared with the litters from control sows. In contrast to the litters from the CON group, the crown-to-rump length observably increased (P < 0.05) by 8.62% after 35 days of COS supplementation. In addition, there were no significant differences (P > 0.05) in the number of foetuses (total foetuses, alive foetuses, viable foetuses, and mummies) per litter on day 35 of pregnancy among the two treatments.

Table 3 Reproductive performance of sows fed diets supplemented with chitosan oligosaccharide between days 1 to 35 of gestation^c

Items	Treatments		P-Value
	CON	COS
a P < 0.05 versus the CON group.b P < 0.10 versus the CON group. CON, a corn–soybean basal diet; COS, the basal diet supplemented with 100 mg kg^−1 chitosan oligosaccharide.c Values are means of six replicates per treatment (except foetal survival rate, individual viable foetus weight, and crown-to-rump length).d Total number of corpora lutea counted in both ovaries.e Foetal survival rate (%) = viable foetuses/ovulation rate × 100.f To calculate total litter weight, the sum of individual viable foetus weights was determined per litter.
Uterine weight (kg)	4.83 ± 1.11	5.70 ± 0.34	0.481
Ovary weight (g)	25.22 ± 1.55	24.60 ± 1.96	0.811
Ovulation rate^d	28.50 ± 1.63	24.33 ± 2.64	0.209
Foetal survival rate^e (%)	53.80	66.39^a	0.031
Total litter weight^f (g)	95.23 ± 13.33	110.60 ± 9.38	0.368
Individual viable foetus weight (g)	6.21 ± 0.27	6.83 ± 0.18^b	0.065
Crown-to-rump length (cm)	3.83 ± 0.07	4.16 ± 0.06^a	<0.001
Number of foetuses per litter (n)
Total foetuses	20.67 ± 1.84	19.00 ± 0.45	0.415
Alive foetuses	17.83 ± 3.20	17.50 ± 0.67	0.922
Viable foetuses	15.33 ± 2.51	16.17 ± 0.70	0.761
Mummies	2.83 ± 1.80	1.33 ± 0.56	0.456

---

Sow reproductive performance, as affected by diets, is shown in Table 4. The total numbers of piglets born and those born alive did not differ (P > 0.05) between the COS-supplemented and control multiparous sows. However, COS supplementation not only increased (P < 0.05) the number of piglets born viable but also decreased (P < 0.05) the number of stillborn and mummified piglets born per litter. The birth weights, including total weight of pigs born alive per litter and average individual weight of pigs born alive within litters, were greater (P < 0.05) in multiparous sows fed the COS-supplemented diet than in those fed the control diet (17.28 vs. 14.50 kg; and 1.32 vs. 1.20 kg, respectively).

Table 4 Effects of dietary chitosan oligosaccharide supplementation on the reproductive performance of sows^b

Items	Treatments		P-Value
	CON	COS
a P < 0.05 versus the CON group. CON, a corn–soybean basal diet; COS, the basal diet supplemented with 100 mg kg^−1 chitosan oligosaccharide.b Values are means of seventeen replicates per treatment. The numbers of sows returning to oestrus in COS-supplemented and CON treatments were 3 and 2, respectively. Unfortunately, one sow aborted on day 70 of gestation in the CON group.c Piglets born viable included piglets born with weights ≥ 900 g total per litter.
Number of piglets per litter (n)
Total born	13.06 ± 0.64	13.71 ± 0.65	0.485
Born alive	12.06 ± 0.63	13.35 ± 0.56	0.132
Born viable^c	10.29 ± 0.58	11.82 ± 0.40^a	0.038
Stillborn and mummified	0.94 ± 0.23	0.35 ± 0.15^a	0.041
Birth weights (kg)
Piglets born alive per litter	14.50 ± 0.78	17.28 ± 0.47^a	0.005
Average for piglets born alive	1.20 ± 0.03	1.32 ± 0.05^a	0.047

---

Serum hormones

Concentrations of serum progesterone, estradiol or luteinizing hormone did not differ (P > 0.05) between the COS-supplemented and the control sows throughout the experimental period (Table 5). However, serum leptin concentrations were higher (P < 0.05) in the COS-supplemented group than in the control sows on days 35 and 85 of gestation.

Table 5 Effects of dietary chitosan oligosaccharide supplementation on serum hormone concentrations of sows at days 35 and 85 of gestation^b

Items	Treatments		P-Value
	CON	COS
a P < 0.05 versus the CON group. CON, a corn–soybean basal diet; COS, the basal diet supplemented with 100 mg kg^−1 chitosan oligosaccharide.b Values are means of six replicates per treatment.
Day 35 of gestation
Leptin (ng mL^−1)	8.96 ± 1.07	15.36 ± 1.24^a	0.003
Progesterone (ng mL^−1)	2.95 ± 0.13	3.62 ± 0.37	0.122
Estradiol (ng mL^−1)	0.94 ± 0.06	1.18 ± 0.15	0.169
Luteinizing hormone (mIU mL^−1)	5.54 ± 0.46	6.61 ± 0.50	0.154
Day 85 of gestation
Leptin (ng mL^−1)	11.24 ± 1.36	16.01 ± 1.32^a	0.030
Progesterone (ng mL^−1)	1.39 ± 0.16	1.74 ± 0.15	0.149
Estradiol (ng mL^−1)	0.87 ± 0.04	0.90 ± 0.12	0.852
Luteinizing hormone (mIU mL^−1)	4.91 ± 0.26	6.24 ± 0.76	0.137

---

Immune indices in serum

As shown in Table 6, COS supplementation significantly increased (P < 0.05) serum IL-1, TNF-α, IgA, and IgM concentrations in the sows at gestation day 35, but not at 85 days of gestation. Moreover, inclusion of COS in the diet elevated (P < 0.05) serum IgG concentrations in sows on days 35 and 85 of gestation.

Table 6 Effects of dietary chitosan oligosaccharide supplementation on serum immune responses of sows at days 35 and 85 of gestation^c

Items	Treatments		P-Value
	CON	COS
a P < 0.05 versus the CON group.b P < 0.10 versus the CON group. CON, a corn–soybean basal diet; COS, the basal diet supplemented with 100 mg kg^−1 chitosan oligosaccharide.c Values are means of six replicates per treatment.d IL-1, interleukin 1.e TNF-α, tumour necrosis factor α.f IgG, immunoglobulin G.g IgA, immunoglobulin A.h IgM, immunoglobulin M.
Day 35 of gestation
IL-1^d (pg mL^−1)	284.48 ± 14.63	359.95 ± 7.79^a	0.002
TNF-α^e (pg mL^−1)	386.69 ± 27.70	522.63 ± 41.04^a	0.025
IgG^f (μg mL^−1)	233.18 ± 28.18	343.40 ± 35.06^a	0.040
IgA^g (μg mL^−1)	48.52 ± 7.04	77.88 ± 3.34^a	0.006
IgM^h (μg mL^−1)	87.81 ± 5.31	117.05 ± 3.42^a	0.002
Day 85 of gestation
IL-1^d (pg mL^−1)	299.80 ± 14.79	278.53 ± 24.50	0.425
TNF-α^e (pg mL^−1)	439.00 ± 37.41	457.61 ± 55.86	0.789
IgG^f (μg mL^−1)	240.77 ± 24.72	424.77 ± 33.20^a	0.002
IgA^g (μg mL^−1)	82.35 ± 6.99	102.13 ± 7.02^b	0.081
IgM^h (μg mL^−1)	111.86 ± 4.60	114.32 ± 10.22	0.832

---

Antioxidant indicators in serum

Table 7 shows that sows fed the diet with COS supplementation had a lower (P < 0.05) concentration of serum MDA (on days 35 and 85 of gestation). Compared with the CON diet, COS supplementation increased (P < 0.05) the T-AOC in the serum of sows at 35 days of gestation, but not at 85 days of gestation. At all of the selected gestation time points, dietary supplementation with COS had no effect (P > 0.05) on the concentrations of serum SOD and GSH-Px in sows.

Table 7 Effects of dietary chitosan oligosaccharide supplementation on serum antioxidant status of sows at days 35 and 85 of gestation^b

Items	Treatments		P-Value
	CON	COS
a P < 0.05 versus the CON group. CON, a corn–soybean basal diet; COS, the basal diet supplemented with 100 mg kg^−1 chitosan oligosaccharide.b Values are means of six replicates per treatment.c MDA, malondialdehyde.d T-AOC, total antioxidant capacity.e SOD, superoxide dismutase.f GSH-Px, glutathione peroxidase.
Day 35 of gestation
MDA^c (nm mL^−1)	19.81 ± 2.43	13.20 ± 0.82^a	0.033
T-AOC^d (U mL^−1)	5.51 ± 0.51	8.22 ± 0.88^a	0.028
SOD^e (U mL^−1)	81.08 ± 4.23	86.81 ± 2.59	0.281
GSH-Px^f (U mL^−1)	1371.02 ± 44.28	1528.46 ± 83.41	0.134
Day 85 of gestation
MDA^c (nm mL^−1)	20.19 ± 2.41	11.42 ± 1.05^a	0.010
T-AOC^d (U mL^−1)	4.99 ± 0.59	5.48 ± 0.36	0.500
SOD^e (U mL^−1)	85.58 ± 1.92	91.90 ± 5.14	0.282
GSH-Px^f (U mL^−1)	1373.74 ± 75.62	1449.60 ± 66.68	0.473

---

Gene expression in the placenta and foetus

The data for placental growth and foetal development related gene expression are shown in Fig. 1 and 2, respectively. In the placenta, leptin and VEGFA mRNA expression was up-regulated (P < 0.05) by COS supplementation at 35 days of gestation. However, RBP4 and PGR mRNA abundance did not differ (P > 0.05) in the placenta between the two dietary treatments at 35 days of gestation. Foetal STAT3, TGF-β, and FGFR2 mRNA abundance was enhanced (P < 0.05) by COS supplementation at 35 days of gestation. Furthermore, there was no positive effect (P > 0.05) of dietary COS supplementation on PGR gene expression levels in the foetuses at 35 days of gestation.

Fig. 1 Effects of dietary chitosan oligosaccharide supplementation on the relative mRNA expression of leptin, VEGFA, RBP4, and PGR in the placenta of sows at day 35 of gestation. Values are means (6 sows/treatment) with standard errors represented by vertical bars. * P < 0.05 (indicates that the relative mRNA expression in the COS group is significantly higher than that in the CON group). CON, a corn–soybean basal diet; COS, the basal diet supplemented with 100 mg kg⁻¹ chitosan oligosaccharide. VEGFA, vascular endothelial growth factor A. TGF-β, transforming growth factor β. FGFR2, fibroblast growth factor receptor 2. RBP4, retinol binding protein 4. PGR, progesterone receptor. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Fig. 2 Effects of dietary chitosan oligosaccharide supplementation on the relative mRNA expression of STAT3, TGF-β, FGFR2, and PGR in the foetuses of sows at day 35 of gestation. Values are means (6 sows/treatment) with standard errors represented by vertical bars. * P < 0.05 (indicates that the relative mRNA expression in the COS group is significantly higher than that in the CON group). CON, a corn–soybean basal diet; COS, the basal diet supplemented with 100 mg kg⁻¹ chitosan oligosaccharide. STAT3, signal transducer and activator of transcription 3. TGF-β, transforming growth factor β. FGFR2, fibroblast growth factor receptor 2. PGR, progesterone receptor. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Discussion

Foetal loss is a major problem in mammals, including humans and swine.^34,35 As noted previously, more than 75% of prenatal loss occurs during the first 25 days of gestation.³⁶ Interestingly, dietary supplementation of various bioactive substances or feed additives during gestation decreased sow foetal loss.^37,38 COS is a product of chitosan degradation that may be an effective alternative to antibiotics for the livestock industry. In the present study, the influences of COS supplementation on the foetal survival of sows was determined because it has been previously shown to be biologically active in vivo.³⁹ As expected, dietary supplementation with COS as a bioactive substance enhanced foetal survival rate and growth in the sows. In our view, this implies that dietary COS supplementation may have a positive effect on fertility when it is initiated during early pregnancy, which is the most critical window of opportunity to control foetal mortality in pigs. To the best of our knowledge, this is the first report of increased foetal survival rate (approximately 13.00%) following COS intervention.

A previous study has indicated that dietary 40 mg kg⁻¹ COS supplementation in sows increased the number of piglets born alive.²⁵ In the present study, the improvements in reproductive performance (the number of piglets born alive or viable) observed in sows fed the COS-supplemented diets are consistent with previous results described by Cheng et al.²⁵ Among these results, it was proposed that dietary supplementation with COS during pregnancy could enhance the number of piglets born alive or viable in sows. Generally, a greater number of piglets born will lead to a reduced individual birth weight, and larger foetuses will cause a lower number of piglets to be born^40,41 as the blood supply to the other foetuses during pregnancy is reduced. Noticeably, the present study demonstrates that COS supplementation during gestation diets improved the individual piglet weights at birth without reducing the total number of piglets born alive. Therefore, we conjectured that COS supplementation might allow for rapid growth by enhancing foetal metabolism.⁴² In addition, another important finding from our study is that the corpora lutea number was not affected by dietary COS supplementation during gestation. Similarly, no differences were detected in maternal serum concentrations of reproductive hormones between the two groups.

Previous studies have shown that leptin can stimulate placental angiogenesis as a placental growth factor^43,44 and induce tube formation by stimulating several angiogenic genes in extra villous trophoblast cells.⁴⁴ The results of our present study demonstrated that leptin mRNA expression in the placenta was higher in COS-supplemented sows. Based on the above reasoning, we hypothesized that COS supplementation might enhance foetal survival and development by stimulating angiogenesis.^45–47 However, the mechanisms responsible for the effects of COS on pregnancy remain largely elusive. Another interesting and novel finding of the present study is that critical foetal development-related genes (STAT3, TGF-β, and FGFR2) in foetus were up-regulated in COS sows, which was consistent with results demonstrating that the foetal survival rate and crown-to-rump length were higher in COS than in the CON group.

Specifically, some studies revealed that COS could stimulate macrophages to secrete multifunctional cytokines, such as TNF-α and IL-1, which stimulates the differentiation of T and pre-B cells,^48,49 and serum IgG.⁵⁰ Yin et al.⁵¹ also reported that dietary COS supplementation increased serum concentrations of IL-1 and immunoglobulins in early weaned pigs. In the present study, sows fed COS-supplemented diets had increased serum concentrations of IL-1, TNF-α, and immunoglobulins, suggesting that COS supplementation could mediate the host inflammatory response to prevent susceptibility to infection.^52,53 In livestock production, numerous factors can induce oxidative stress to damage cellular antioxidant defences and then result in suboptimal livestock health conditions and tremendous economic loss. Recently, polysaccharides such as COS have been widely used as antioxidants to prevent oxidative damage in animals.^54,55 To investigate the effects of COS supplementation on serum antioxidant capacity in sows, we assayed MDA content and the activities of both enzymatic (SOD and GSH-Px) and non-enzymatic (T-AOC) antioxidants in the sow serum. Our results showed that COS supplementation elevated the T-AOC in sows at 35 days of gestation and decreased serum MDA content in sows at days 35 and 85 of gestation. Given these results, we supposed that COS supplementation could enhance the antioxidant ability in sows.^56–58 Taken together, these results demonstrate that COS supplementation can maintain the health status and internal environment to a certain extent in pregnant sows, thereby providing evidence of improvements in immunity and antioxidant ability in response to COS supplementation.

Conclusion

Our results first demonstrated that dietary supplementation with 100 mg kg⁻¹ COS during gestation could improve sow health status by boosting immunity and antioxidant ability, which offers an optimal internal environment for foetal growth and survival. COS supplementation also increased the gene expression of certain biochemical markers in the placenta and foetus of sows. The results not only furthered our understanding of the mechanisms underlying the beneficial effects of COS on foetal survival and reproductive performance in pregnant sows but also provided a theoretical basis for developing functional carbohydrates such as COS as green feed additives for the livestock industry.

Conflict of interest

The authors declare that they have no competing interests.

Ethics approval and consent to participate

All experimental procedures for the present study were approved by the Animal Management Rules of the Ministry of Health of the People's Republic of China and the Animal Care and Use Committee of Sichuan Agricultural University.

Acknowledgements

We wish to thank Fei Jiang, Quyuan Wang, and Huifen Wang for their assistance during the experiments. We also would like to thank Likun Cheng, Heng Yin, and Yuguang Du for their analysis and preparation of the COS. This work was supported by the National Natural Science Foundation of China (31372347) and the Special Fund for Agro-scientific Research in the Public Interest (201403047).

References

1. M. D. Barton, Nutr. Res. Rev., 2000, 13, 279–299.
2. J. Wan, Y. Li, D. W. Chen, B. Yu, P. Zheng, X. B. Mao, J. Yu and J. He, J. Microbiol. Biotechnol., 2016, 26, 461–468.
3. M. Otsuka, A. Ishida, Y. Nakayama, M. Saito, M. Yamazaki, H. Murakami, Y. Nakamura, M. Matsumoto, K. Mamoto and R. Takada, Anim. Sci. J., 2004, 75, 225–229.
4. Y. J. Chen, I. H. Kim, J. H. Cho, J. S. Yoo, Y. Wang, Y. Huang, H. J. Kim and S. O. Shin, Livest. Sci., 2009, 124, 255–260.
5. X. F. Kong, X. L. Zhou, G. Q. Lian, F. Blachier, G. Liu, B. E. Tan, C. M. Nyachoti and Y. L. Yin, Livest. Sci., 2014, 160, 97–101.
6. D. F. Xiao, Z. R. Tang, Y. L. Yin, B. Zhang, X. G. Hu, Z. M. Feng and J. Q. Wang, Int. Immunopharmacol., 2013, 17, 670–676.
7. Y. L. Yin, R. L. Huang, T. J. Li, Z. Ruan, M. Y. Xie, Z. Y. Deng, Y. Q. Hou and G. Y. Wu, Amino Acids, 2010, 39, 1581–1587.
8. S. K. Kim and N. Rajapakse, Carbohydr. Polym., 2005, 62, 357–368.
9. J. L. Dou, C. Y. Tan, Y. G. Du, X. F. Bai, K. Y. Wang and X. J. Ma, Carbohydr. Polym., 2007, 69, 209–213.
10. X. L. Zhou, X. F. Kong, G. Q. Lian, F. Blachier, M. M. Geng and Y. L. Yin, Nutr. Res., 2014, 34, 780–788.
11. P. Kang, H. L. Xiao, Y. Q. Hou, B. Y. Ding, Y. L. Liu, H. L. Zhu, Q. Z. Hu, Y. Hu and Y. L. Yin, Asian-Australas. J. Anim. Sci., 2010, 23, 750–756.
12. Z. H. Sun, Z. R. Tang, Y. L. Yin, R. L. Huang, T. J. Li, S. X. Tang and Z. L. Tan, J. Appl. Anim. Res., 2009, 36, 207–211.
13. J. Z. Knaul, S. M. Hudson and K. A. Creber, J. Polym. Sci., Polym. Phys. Ed., 1999, 37, 1079–1094.
14. S. Y. Chae, M. K. Jang and J. W. Nah, J. Controlled Release, 2005, 102, 383–394.
15. Y. Okamoto, A. Inoue, K. Miyatake, K. Ogihara, Y. Shigemasa and S. Minami, Macromol. Biosci., 2003, 3, 587–590.
16. D. A. Zaharoff, C. J. Rogers, K. W. Hance, J. Schlom and J. W. Greiner, Vaccine, 2007, 25, 2085–2094.
17. S. Matsuhashi and T. Kume, J. Sci. Food Agric., 1997, 73, 237–241.
18. Y. J. Jeon, P. J. Park and S. K. Kim, Carbohydr. Polym., 2001, 44, 71–76.
19. J. Rhoades, G. Gibson, K. Formentin, M. Beer and R. Rastall, Carbohydr. Polym., 2006, 64, 57–59.
20. S. Swiatkiewicz, M. Swiatkiewicz, A. Arczewska-Wlosek and D. Jozefiak, J. Anim. Physiol. Anim. Nutr., 2015, 99, 1–12.
21. P. Liu, X. S. Piao, S. W. Kim, L. Wang, Y. B. Shen, H. S. Lee and S. Y. Li, J. Anim. Sci., 2008, 86, 2609–2618.
22. G. R. Gibson and M. B. Roberfroid, J. Nutr., 1995, 125, 1401–1412.
23. R. L. Huang, Z. Y. Deng, C. B. Yang, Y. L. Yin, M. Y. Xie, G. Y. Wu, T. J. Li, L. L. Li, Z. R. Tang and P. Kang, J. Sci. Food Agric., 2007, 87, 153–159.
24. X. Xiong, H. S. Yang, X. C. Wang, Q. Hu, C. X. Liu, X. Wu, D. Deng, Y. Q. Hou, C. M. Nyachoti and D. F. Xiao, J. Anim. Sci., 2015, 93, 1089–1097.
25. L. K. Cheng, L. X. Wang, Q. S. Xu, L. J. Huang, D. S. Zhou, Z. Li, S. G. Li, Y. G. Du and H. Yin, Livest. Sci., 2015, 174, 74–81.
26. National Research Council, Nutrient Requirements of Swine. National Academics Press, Washington, DC, 11th edn, 2012.
27. X. Li, F. W. Bazer, G. A. Johnson, R. C. Burghardt, D. W. Erikson, J. W. Frank, T. E. Spencer, I. Shinzato and G. Wu, J. Nutr., 2010, 140, 1111–1116.
28. D. R. Livingstone, P. G. Martinez, X. Michel, J. Narbonne, S. O'hara, D. Ribera and G. Winston, Funct. Ecol., 1990, 415–424.
29. W. Cao, G. M. Liu, T. T. Fang, X. J. Wu, G. Jia, H. Zhao, X. L. Chen, C. M. Wu, J. Wang and J. Y. Cai, RSC Adv., 2015, 5, 76607–76614.
30. N. J. Miller, C. Rice-Evans, M. J. Davies, V. Gopinathan and A. Milner, Clin. Sci., 1993, 84, 407–412.
31. E. Beutler, Red cell metabolism: a manual of biochemical methods, Grune & Stratton, 1975.
32. J. Wan, Y. Li, D. W. Chen, B. Yu, G. Chen, P. Zheng, X. B. Mao, J. Yu and J. He, Anim. Feed Sci. Technol., 2016, 211, 216–226.
33. K. J. Livak and T. D. Schmittgen, Methods, 2001, 25, 402–408.
34. W. K. Ren, W. Luo, M. M. Wu, G. Liu, X. L. Yu, J. Fang, T. J. Li, Y. L. Yin and G. Y. Wu, Amino Acids, 2013, 45, 479–488.
35. G. Y. Wu, F. W. Bazer, M. C. Satterfield, X. L. Li, X. Q. Wang, G. A. Johnson, R. C. Burghardt, Z. L. Dai, J. J. Wang and Z. L. Wu, Amino Acids, 2013, 45, 241–256.
36. W. F. Pope, in Embryonic mortality in domestic species, ed. M. Zavy and R. Geisert, CRC Press, Boca Raton, 1994, pp. 53–77.
37. G. Y. Wu, F. W. Bazer, R. C. Burghardt, G. A. Johnson, S. W. Kim, X. L. Li, M. C. Satterfield and T. E. Spencer, J. Anim. Sci., 2010, 88, E195–E204.
38. X. L. Li, F. W. Bazer, G. A. Johnson, R. C. Burghardt, J. W. Frank, Z. L. Dai, J. J. Wang, Z. L. Wu, I. Shinzato and G. Y. Wu, Amino Acids, 2014, 46, 375–384.
39. W. S. Xia, P. Liu, J. L. Zhang and J. Chen, Food Hydrocolloids, 2011, 25, 170–179.
40. J. L. Vallet, K. A. Leymaster and R. K. Christenson, J. Anim. Sci., 2002, 80, E115–E125.
41. R. K. Johnson, M. K. Nielsen and D. S. Casey, J. Anim. Sci., 1999, 77, 541–557.
42. P. J. Thureen, K. A. Baron, P. V. Fennessey and W. W. Hay, Pediatr. Res., 2002, 51, 464–471.
43. M. R. Sierra-Honigmann, A. K. Nath, C. Murakami, G. García-Cardeña, A. Papapetropoulos, W. C. Sessa, L. A. Madge, J. S. Schechner, M. B. Schwabb and P. J. Polverini, Science, 1998, 281, 1683–1686.
44. S. Basak and A. K. Duttaroy, Eur. J. Obstet. Gynecol. Reprod. Biol., 2012, 164, 24–29.
45. C. J. Ashworth, N. Hoggard, L. Thomas, J. G. Mercer, J. M. Wallace and R. G. Lea, Rev. Reprod., 2000, 5, 18–24.
46. K. Linnemann, A. Malek, R. Sager, W. F. Blum, H. Schneider and C. Fusch, J. Clin. Endocrinol. Metab., 2000, 85, 4298–4301.
47. S. G. Hassink, E. de Lancey, D. V. Sheslow, S. M. Smith-Kirwin, D. M. O'Connor, R. V. Considine, I. Opentanova, K. Dostal, M. L. Spear and K. Leef, Pediatrics, 1997, 100, e1.
48. L. C. Liu, Y. Zhou, X. H. Zhao, H. Wang, L. Wang, G. L. Yuan, M. Asim, W. M. Wang, L. B. Zeng and X. L. Liu, Dev. Comp. Immunol., 2014, 47, 17–24.
49. Y. B. Dang, S. Li, W. X. Wang, S. J. Wang, M. M. Zou, Y. J. Guo, J. H. Fan, Y. G. Du and J. N. Zhang, Carbohydr. Polym., 2011, 83, 1075–1081.
50. P. Zhang, W. Z. Liu, Y. F. Peng, B. Q. Han and Y. Yang, Int. Immunopharmacol., 2014, 23, 254–261.
51. Y. L. Yin, Z. R. Tang, Z. H. Sun, Z. Q. Liu, T. J. Li, R. L. Huang, Z. Ruan, Z. Y. Deng, B. Gao and L. X. Chen, Asian-Australas. J. Anim. Sci., 2008, 21, 723–731.
52. P. D. Schley and C. J. Field, Br. J. Nutr., 2002, 87, S221–S230.
53. P. Zelnickova, L. Leva, H. Stepanova, F. Kovaru and M. Faldyna, Vet. Immunol. Immunopathol., 2008, 124, 367–378.
54. T. Li, R. Na, P. Yu, B. Shi, S. Yan, Y. Zhao and Y. Xu, Czech J. Anim. Sci., 2015, 60, 38–44.
55. S. M. Lin, S. H. Mao, Y. Guan, X. Lin and L. Luo, Fish Shellfish Immunol., 2012, 32, 909–913.
56. H. Sies, in EJB Reviews 1993, Springer, Berlin Heidelberg, 1994, pp. 101–107.
57. L. F. Cardozo, L. M. Pedruzzi, P. Stenvinkel, M. B. Stockler-Pinto, J. B. Daleprane, M. Leite and D. Mafra, Biochimie, 2013, 95, 1525–1533.
58. J. E. Heffner and J. E. Repine, Am. Rev. Respir. Dis., 1989, 140, 531–554.

---

Footnote

† Contributed equally.

---