DOI:
10.1039/C6RA10774E
(Paper)
RSC Adv., 2016,
6, 58343-58353
Protective effects of phyllanthin, a lignan from Phyllanthus amarus, against progression of high fat diet induced metabolic disturbances in mice
Received
26th April 2016
, Accepted 1st June 2016
First published on 2nd June 2016
Abstract
Evidence based studies have proved the efficacy of plant derived bioactives against lifestyle oriented disorders as they can be incorporated in to the diet or diet based supplements. Phyllanthin is one such lignan from Phyllanthus amarus as well as different Phyllanthus species. Phyllanthin was evaluated as a chronic intervention (12 weeks) in mice, at a daily dose of 2 and 4 mg kg−1 of body weight along with a lard based high fat diet (HFD). Phyllanthin protected against HFD induced weight gain and adiposity. Phyllanthin supplementation reduced mRNA expression of adipogenic genes and increased expression of lipolytic genes in white adipose tissue. Treatment also showed reduction in liver triglyceride accumulation. HFD induced serum lipid disturbances were found to be restored by phyllanthin. Treatment reduced serum triglycerides and free fatty acids in HFD fed mice. Phyllanthin counteracted coexisting low grade inflammation and oxidative stress in adipose tissue and liver. Along with serum proinflammatory cytokines, expression of NF-κB and F4/80 was decreased by phyllanthin. Supplementation of phyllanthin accelerated glucose clearance along with alleviation of insulin resistance in terms of HOMA-IR. Furthermore, mRNA expression of the insulin receptor and insulin receptor substrate-1 was elevated by phyllanthin in liver and adipose tissue. The present study confirmed the protective effects of phyllanthin against HFD induced metabolic changes. Daily consumption of phyllanthin in the diet as a nutraceutical can ameliorate the development of metabolic disorders.
1. Introduction
Obesity is a preventable ailment. It can be considered as a broad terminology for complex and interconnected chronic metabolic disorders. According to the World Health Organization (WHO), most of the global population resides in countries where obesity and being overweight kills more than being underweight due to the prevalence of foods with high fat, high sugar, high salt and poor micro ingredients.1
Energy dense and lower nutritional dietary habits along with sedentary lifestyles and low resting metabolic rates are major causes of disturbance in normal physiological metabolic homeostasis.2 In general such disturbances include hyperlipidemia, hyperglycemia, glucose intolerance, insulin resistance, liver fat accumulation, low grade inflammation etc.3 These complications cause predisposition to progress of obesity and associated morbidities like type 2 diabetes, non alcoholic fatty liver disease (NAFLD), hepatic fibrosis, arthritis, cardiovascular diseases etc.4
Plants of Phyllanthus species such as Phyllanthus amarus, Phyllanthus niruri, phyllanthus urinaria, Phyllanthus emblica are widely used for culinary and medicinal purposes in tropical and subtropical countries.5 These herbs contain lignans as their major phytoconstituents. Lignans have been proven to influence metabolic processes in beneficial way as they are present in various dietary components.6 Phyllanthin, a lignan, is known to be the biochemical marker of plants of Phyllanthus species.7 P. amarus, a major source of phyllanthin, has been found effective against diabetes as well as various chemical and virus induced liver abnormalities including hepatitis, jaundice and cancer. The herb is also known to possess hepatoprotective, immunomodulatoty, nephroprotective, gastroprotective and radioprotective properties.8
There are no reports on the protective effects of phyllanthin supplementation on the development of diet induced obesity and associated morbidities. The present study was designed to examine the influence of phyllanthin supplementation on high fat diet induced metabolic changes associated with lipid and glucose homeostasis.
2. Experimental procedures
2.1. Isolation of phyllanthin
Whole plant material of Phyallanthus amarus Schum. & Thonn. (Voucher specimen no NIP-H-161) was collected from NIPER campus during the months of August–October and shade dried. Powdered plant material (3.5 kg) was extracted for 48 h in Soxhlet apparatus using hexanes as an extracting solvent. Dried extract (140 g) was subjected to vacuum liquid chromatography (6 cm × 13 cm) using silica gel # 230–400 (Merck, Darmstadt, Germany) as stationary phase and hexanes: ethyl acetate (Rankem, Mumbai, India) gradient (0–100%) as eluting solvents. Collected fractions were pooled to 8 fractions on the basis of chemoprofile. Fraction 6 (35 g) was subjected to repeated vacuum liquid chromatography (6 cm × 13 cm) using silica gel # 230–400 as stationary phase and hexanes: ethyl acetate gradient (0–100%) as eluting solvents to achieve enriched fraction (6 g). Phyllanthin was recrystallized using petroleum ether from the enriched fraction. Structure of phyllanthin was confirmed by comparing NMR spectroscopic data reported in literature (Fig. 1a).9
 |
| | Fig. 1 (A) Effects of phyllanthin on lipid accumulation and lipolysis in 3T3 L1 murine cells: [a] structure of phyllanthin; [b] percentage lipid accumulation during adipocyte differentiation process; [c] glycerol release during lipolysis of mature adipocytes (μM); [d] oil red O staining of phyllanthin treated cells observed at 10× magnification. Data expressed as mean ± SEM and analyzed using one-way ANOVA statistical test with Dunnett's post-hoc analysis. *p < 0.05, **p < 0.01, ***p < 0.001 (vs. control at same time interval). (B) Effect of phyllanthin on HFD induced alterations in anthropometric parameters: [e] body weight gain progression pattern over study period; [f] bodyweight progression pattern over study period; [g] bodyweight gain (g); [h] Lee's index; [i] feed intake (g per day/animal) at 12th week; [j] percentage feed efficiency calculated as (weight gain per day/energy consumed kcal per day) × 100. Data expressed as mean ± SEM and analysed using One-way ANOVA statistical test with Tukey's post-hoc analysis. *p < 0.05 (vs. control), **p < 0.01 (vs. control), ***p < 0.001 (vs. control), #p < 0.05 (vs. HFD), ##p < 0.01 (vs. HFD), ###p < 0.001 (vs. HFD). | |
2.2. In vitro 3T3 L1 preadipocytes culture
Murine 3T3-L1 preadipocyte cells were procured from National Centre for Cell Science (NCCS-Pune, India). Cells were maintained at 37 ± 1 °C and 5% CO2 in Dulbecco's modified Eagle's medium (DMEM-HiMedia, Mumbai, India) with 10% (v/v) fetal bovine serum (FBS-HiMedia, Mumbai, India) and 1% antibiotics (HiMedia, Mumbai, India). After confluency, preadipocytes were incubated with differentiation medium i.e. DMEM supplemented with 10% FBS, 1% antibiotics, 0.5 mM isobutyl methyl xanthin (IBMX-Sigma Aldrich, St Louis, USA), 1 μM dexamethasone (Sigma Aldrich, St Louis, USA) and 1 μg mL−1 insulin (Sigma Aldrich, St Louis, USA) for 48 h. From day 3, cells were allowed to differentiate in maintenance medium i.e. DMEM supplemented with 10% FBS, 1% antibiotics and 1 μg mL−1 insulin for 6 days with medium replacement on every 48 h.
2.3. Estimation of lipid accumulation in mature adipocytes
As per reported method, phyllanthin, in DMSO carrier (not more than 1%), was added in supplementation medium throughout differentiation process.10 On day 9, the culture medium was removed and adipocytes were washed with phosphate buffer saline (PBS; pH 7.4, 10% w/v). Lipid accumulation was measured using AdipoRed™ assay reagent (Lonza, Basel, Switzerland) as per kit protocol. Treated and untreated mature adipocytes were stained with Oil Red O (ORO) as per the previously reported method.11 In brief, cells were rinsed with PBS and fixed with 10% v/v formalin for 20 min. After washing with PBS, cells were incubated with ORO (0.5% in 70% isopropyl alcohol) for 30 min in the dark. Images of stained lipid droplets were captured using Nikon eclipse 90 inverted microscope at 10× magnification.
2.4. Estimation of lipolysis in mature adipocytes
Mature, lipid filled adipocytes were washed with Hanks's balanced salt solution (HBSS-Himedia, Mumbai, India). Cells were treated with phyllanthin in incubation solution i.e. HBSS supplemented with 2% bovine serum albumin (BSA-Himedia, Mumbai, India). After 12 h and 24 h of treatment, supernatants were removed and estimated for glycerol concentration using free glycerol reagent (Zenbio, NC, USA).11
2.5. Experimental animals
Animal experimental protocols were approved by Institutional Animal Ethics Committee (IAEC), NIPER. Swiss albino mice (7–8 weeks old; 21 ± 1 g, male) were housed in Central Animal Facility, NIPER under standard laboratory conditions (22 ± 2 °C, 55 ± 5% RH) and allowed to acclimatize. Guidelines from Committee for the Purpose of Control and Supervision on Experiments on Animals (CPCSEA) were followed throughout animal experimentation.
2.6. Study design
Animals were divided into 4 experimental groups, each with 8 animals: [I] Control [II] High fat diet (HFD) [III] HFD + phyllanthin 2 mg kg−1 of body weight (LD) [IV] HFD + phyllanthin 4 mg kg−1 of body weight (HD). Control group was fed with normal pellet diet (NPD) (Ashirwad, Ropar, India), while other three groups received HFD ab libitium. The energy value of 3.84 kcal g−1 of NPD was attributed to 67% carbohydrate, 21% protein and 12% fat while energy value of 5.29 kcal g−1 of HFD was attributed to 17% carbohydrate, 25% protein and 58% fat. The composition of HFD included:12,13 powdered NPD: 365 g kg−1; lard, 320 g kg−1; casein, 250 g kg−1; vitamin and mineral mix, 60 g kg−1; DL-Methionine, 03 g kg−1; yeast powder, 01 g kg−1; sodium chloride, 01 g kg−1. Lard was procured from local meat shop (Chandigarh, India). Casein was purchased from Spectrochem (Mumbai, India). DL-Methionine, sodium chloride and yeast powder were procured from Himedia (Mumbai, India). Vitamin and mineral mix was a product of Zydus (Ahmedabad, India). The treatment groups received phyllanthin in the form of oral suspension with 0.4% Tween 80 on a daily basis for 12 weeks. HFD group received 0.4% Tween 80 as a vehicle. Throughout the study period, body weights and food intake of the animals were monitored regularly at an interval of 2 week. Lee's index was calculated as weight0.33 × 1000/naso-anal length.14 Food efficiency for each group was calculated as weight gain/kcal consumed × 100 where energy consumed was calculated from feed intake at last week of treatment schedule.15
2.7. Oral glucose tolerance test
In the 12th week, blood glucose level was measured after 4 h of fasting. Following oral administration of glucose load (2 g kg−1 of body weight), blood glucose levels were measured at time interval of 0, 15, 30, 45, 60, 90 and 120 min using tail snipping method and blood glucose monitoring kit Glucocard™ 01-mini (Arkaray, Japan).13
2.8. Serum and tissue collection
Animals were fasted for 4 h and blood was collected from the tail vein. Collected blood samples were allowed to clot on ice for 20 min and centrifuged at 4500 rpm for 15 min at 4 °C. Serum was separated and stored at −80 °C until further analysis. Animals were sacrificed by cervical dislocation. Liver and visceral adipose tissues such as gonadal, mesenteric and retroperitoneal were carefully removed and stored at −80 °C for further analysis.
2.9. Serum biochemical analysis
Serum lipid parameters like triacylglycerols (TG), total cholesterol (TC), high density lipoproteins (HDL), low density lipoproteins (LDL) were analyzed using commercially available colorimetric kits (Accurex, Mumbai, India) while Friedewald's equation (TG/5) was used to calculate very low density lipoproteins (VLDL) levels.16 Serum free fatty acids (FFAs) were quantified as per manufacturer's protocol of free fatty acid estimation kit (Sigma Aldrich, St Louis, USA). Other markers such as insulin (Ray Biotech, GA, USA) and leptin (Invitrogen, CA, USA) were evaluated as per manufacturer's instructions. Inflammatory cytokines TNF-α, IL-1β and IL-6 (Krishgen Biosystems, CA, USA) were measured using ELISA kits as per manufacturer's protocol. Extent of insulin resistance was evaluated using various indices like homeostasis model assessment-insulin resistance HOMA-IR [(serum glucose mg dL−1 × serum insulin)/405] and quantitative insulin sensitivity check QUICKI [1/(log fasting glucose + log fasting insulin)]. Lipid based insulin sensitivity indices such as revised QUICKI [1/(log fasting glucose mg dL−1 + log fasting insulin μU/mL + log FFA mmol l−1) and McAuley index in fat free mass for insulin resistance Mffm/I [exp{2.63 − 0.28
ln(fasting insulin μU mL−1) − 0.31
ln(fasting triglycerides mmol L−1)}] were also calculated.17,18
2.10. Biochemical analysis of tissues
Weighed amount of liver and visceral adipose tissue (vWAT) tissues were homogenized in phosphate buffer saline (pH 7.4, 10% w/v) and analyzed for protein content using Bradford reagent. Homogenates of vWAT and a portion of liver homogenates were centrifuged at 10
000 rpm. As per reported methods, supernatants were evaluated for various oxidative stress parameters like thiobarbituric acid reactive substances (TBARS), reduced glutathione (GSH), superoxide dismutase (SOD) and nitrite concentrations.19 Remaining portion of liver homogenates was partitioned with chloroform/methanol (2
:
1, v/v). The organic layer was collected and dried under vacuum. Dried lipid extract was suspended in 2% Triton X and evaluated for TG and TC content using commercial kits (Accurex, Mumbai, India).20
2.11. mRNA expression analysis using RT PCR
Total RNA was extracted from vWAT and liver using the method described elsewhere.21 In brief, aliquots of tissues were homogenized in Qiazol™ (Qiagen, CA, USA). Precipitation of RNA was done with isopropanol. RNA was quantified using Infinite® M200 PRO NanoQuant (Tecan, Switzerland) and agarose gel (1.2%) was used to evaluate the integrity of RNA. From pure intact RNA samples (2.0 μg), cDNA was prepared using the RT2 First Strand Synthesis Kit (Invitrogen, CA, USA) according to the manufacturer's instructions. Expression of different genes were determined by RT-PCR (Applied Biosystems 7500 Fast Real-Time PCR machine, CA, USA) using SYBR® green (Qiagen, CA, USA) under the following conditions: 95 °C for 10 min, followed by 40 cycles of 95 °C and 60 °C for 1 min. Data was analyzed using ΔΔCt method and values were expressed in terms of Relative fold change (RFC) as compared to control group. β-actin was used as internal standard. Primer sequences of genes are provided in Table 1.
Table 1 List of primers
| Primer |
Forward 5′-3′ |
Reverse 5′-3′ |
| NF-κB |
GAGGTCTCTGGGGGTACCAT |
TTGCGGAAGGATGTCTCCAC |
| FASN |
GTGAGTCTATCCTGCGCTCC |
TCAGTAGGTCGATGAGGGCA |
| ACC |
CAGAACATGTGGGTGTCCAG |
GGGCGTTCTTTGAAATACCA |
| ACOX-1 |
GAATTTGGCATCGCAGACCC |
GATCTCCAGATTCCAGGCCG |
| HSL |
GAGGCCTTTGAGATGCCACT |
GCCAGGCTGTTGAGTACCTT |
| F4/80 |
TCTGGGGAGCTTACGATGGA |
GAATCCCGCAATGATGGCAC |
| DLK-1 |
GCTGCCCATACACATCTCCT |
ACTTGCCTGCCAAAGAAAAA |
| IRS-2 |
ATCAGGTATCTGGGGTGGAG |
TGTGGCGCTTGGAATTGTGG |
| GLUT-4 |
GATTCTGCTGCCCTTCTGTC |
ATTGGACGCTCTCTCTCCAA |
| IR |
TCCCCACCCTTTGAGTCTGA |
GGGATCTTCGCTTTCGGGAT |
| IRS-1 |
GGGAGATTCCAACACCAGCA |
AGGCGTCCAGAGCTAGAAGA |
| PPAR-γ |
TGAACGTGAAGCCCATCGAG |
GGGTGAAGGCTCATGTCTGT |
| C/EBP α |
CCAGTGACAATGACCGCCT |
CGACCCTAAACCATCCTCCG |
| β-actin |
TGTTACCAACTGGGACGACA |
GGGGTGTTGAAGGTCTCAAA |
| PNPLA2 |
TCACGTCACCTGTGCCTTAC |
TGCAGAAGTGAGGAAGGCAG |
| PLIN-1 |
GATCGCCTCTGAACTGAAGG |
CTTCTCGATGCTTCCCAGAG |
| MGLL |
CCAGGCGAACTCCACAGAAT |
ACCACCATCCTCTCTCCCTC |
2.12. Histological examination
Liver and vWAT tissues were fixed in 10% buffered formalin. Fixed tissues were dehydrated using serial dilutions of absolute ethanol and embedded in paraffin. Thin sections of embedded tissues (8 μm) were fixed on egg white coated glass slide followed by haematoxylin and eosin staining (H&E). Images were captured using Nikon eclipse 90i microscope attached with Nikon DS-Ri1 camera (Nikon, Japan) at 20× magnification.
2.13. Statistical analysis
Data are expressed as mean ± SEM. Otherwise mentioned, statistical variations were analyzed using one way ANOVA followed by Tukey's post hoc test using GraphPad Prism 5 software (GraphPad Software Inc, CA, USA). P values ≤0·05 were considered significant.
3. Results
3.1. Effect of phyllanthin on lipid accumulation and lipolysis in murine adipocytes
Treatments with phyllanthin during differentiation process of preadipocytes to mature adipocytes decreased lipid accumulation as compared to untreated cells (Fig. 1b). Considering untreated cells with 100% lipid accumulation, phyllanthin treated cells showed lipid accumulation of 77.29 ± 2.18, 71.98 ± 1.87, 75.58 ± 3.09, 70.90 ± 3.06 and 60.41 ± 2.45% at 10–50 μM concentration respectively without any cytotoxicity. Reduction in lipid accumulation was visualized in ORO staining (Fig. 1d). As shown in Fig. 1c, phyllanthin treatment after complete differentiation of adipocytes, resulted in lipolysis of stored fat.
3.2. Effect of phyllanthin supplementation on HFD induced alterations in anthropometric and serum biochemical parameters
Animal body weight and weight gain progressions in control and treatment groups are shown in Fig. 1e and f. Mice, started with almost similar initial body weights, showed higher body weight of 34.71 ± 0.56 g after 12 weeks upon HFD feeding against 30.33 ± 0.42 g in the control group. Supplementation of phyllanthin in LD and HD groups reduced body weights to 31.57 ± 0.42 g and 31.42 ± 0.72 g respectively. Average weight gain of 74.17 ± 6.37% was observed in HFD against 38.68 ± 4.54% in control group (Fig. 1g). Phyllanthin showed protection against HFD induced weight gain with 46.78 ± 5.38 and 40.08 ± 4.57% in LD and HD groups respectively. Obesity indicating parameter Lee's index was also found to be improved in HD group against HFD group (Fig. 1h). There was no change observed in feed intake of animals among treatment groups although feed efficiency of treatment groups was reduced as compared to HFD (Fig. 1i and j).
As shown in Table 2, along with no significant change in serum TC and HDL, chronic high fat diet induced serum hypertriglyceridemia was observed in HFD group. Both the doses of phyllanthin prevented the increase in serum TG levels significantly. Serum LDL levels were raised in HFD group but no significant effect of phyllanthin treatment was observed (Table 2). Elevated levels of serum FFA in HFD were reduced in treatment groups LD and HD (Table 2). Serum VLDL levels were calculated using Friedewald equations which showed similar trend as serum TG. Phyllanthin reduced HFD induced serum hyperleptinemia in LD and HD groups (Table 2).
Table 2 Effect of phyllanthin on serum biochemical parameters and weights of liver and visceral adipose tissuea
| |
Control |
HFD |
LD |
HD |
| Data expressed as mean ± SEM. One-way ANOVA statistical test with Tukey's post-hoc analysis was used. *p < 0.05 (vs. control), **p < 0.01 (vs. control), ***p < 0.001 (vs. control), #p < 0.05 (vs. HFD), ##p < 0.01 (vs. HFD) ###p < 0.001 (vs. HFD). |
| Serum biochemical parameters |
| TG (mg dL−1) |
103.00 ± 2.58 |
133.90 ± 6.40** |
82.18 ± 3.92### |
91.63 ± 2.82### |
| TC (mg dL−1) |
177.43 ± 2.08 |
185.60 ± 1.08 |
174.94 ± 2.06 |
181.94 ± 3.00 |
| HDL (mg dL−1) |
100.27 ± 3.37 |
103.25 ± 4.81 |
104.40 ± 5.13 |
105.96 ± 8.39 |
| LDL (mg dL−1) |
9.43 ± 2.60 |
22.78 ± 3.82* |
28.57 ± 3.01 |
31.03 ± 3.42 |
| VLDL (mg dL−1) |
20.60 ± 0.63 |
26.78 ± 1.40** |
16.43 ± 0.67### |
18.32 ± 0.48### |
| FFA (mmol L−1) |
1.03 ± 0.06 |
1.45 ± 0.06*** |
1.02 ± 0.03### |
0.86 ± 0.08### |
| Serum leptin (ng mL−1) |
4.28 ± 0.02 |
5.98 ± 0.05*** |
4.83 ± 0.12### |
5.20 ± 0.21# |
![[thin space (1/6-em)]](https://www.rsc.org/images/entities/char_2009.gif) |
| Liver fat |
| Liver weight (g) |
1.35 ± 0.05 |
1.63 ± 0.04*** |
1.12 ± 0.04## |
1.30 ± 0.04## |
| Liver TG (μg mg−1 tissue) |
192.55 ± 5.53 |
292.55 ± 19.41* |
218.97 ± 26.79 |
195.50 ± 26.41# |
| Liver TC (μg mg−1 tissue) |
133.07 ± 9.43 |
152.14 ± 10.51 |
142.02 ± 9.94 |
159.14 ± 13.58 |
![[thin space (1/6-em)]](https://www.rsc.org/images/entities/char_2009.gif) |
| Visceral adipose tissue |
| Mesentric (g) |
0.35 ± 0.01 |
0.57 ± 0.01*** |
0.40 ± 0.02### |
0.41 ± 0.02### |
| Retroperitoneal (g) |
0.106 ± 0.008 |
0.33 ± 0.02*** |
0.196 ± 0.02## |
0.12 ± 0.02### |
| Gonadal (g) |
0.54 ± 0.03 |
1.19 ± 0.04*** |
0.77 ± 0.06### |
0.60 ± 0.07### |
3.3. Effect of phyllanthin supplementation on fat accumulation in adipose tissue and liver
As shown in Table 2, the extracted amounts of the gonadal fat pad were found to be 2.2 times higher in HFD animals than control animals. Phyllanthin decreased size of gonadal fat pads in LD and HD groups. Both the doses of phyllanthin lowered weights of fat pads isolated from other visceral regions such as mesenteric and retroperitoneal (Table 2). HFD feeding showed elevated expressions of adipogenic genes PPARγ, CEBPα and also preadipocyte marker DLK-1 in relation to control group. Phyllanthin (LD and HD) lowered the expressions of PPARγ, CEBPα as well as DLK-1 (Fig. 2a). Expressions of ACC and FASN were downregulated in HFD group as compared to control group, although no significant changes were observed in treatment groups (Fig. 2b). Other lipid oxidation related gene ACOX-1 showed up regulation in the treatment groups but was found to be statistically insignificant. Genes involved in lipid breakdown such as MGLL and PNPLA2 showed elevated expressions in LD and HD group (Fig. 2c). Expression of HSL and PLIN also showed the similar trend but changes remained statistically insignificant. HFD group showed higher weight of liver than the control group which was found to be aligned with increased concentrations of liver TG accumulation. Liver TG concentrations of phyllanthin treated groups were found to be alleviated (Table 2 & Fig. 2e).
 |
| | Fig. 2 Effect of phyllanthin supplementation on fat accumulation in adipose tissue and liver: [a] expression of genes affecting adipogenesis in vWAT: PPARγ, CEBPα, DLK-1; [b] expression of genes affecting lipid metabolism in vWAT: FASN, ACC; [c] expression of genes affecting lipid metabolism in vWAT : MGLL, HSL, PLIN, PNPLA2 and ACOX-1; [d] H&E staining images of visceral adipose tissue microsections at 20× magnification; [e] H&E staining images of liver microsections at 20× magnification. Data expressed as mean ± SEM and analyzed using one-way ANOVA statistical test with Tukey's post-hoc analysis. *p < 0.05 (vs. control), **p < 0.01 (vs. control), ***p < 0.001 (vs. control), #p < 0.05 (vs. HFD), ##p < 0.01 (vs. HFD), ###p < 0.001 (vs. HFD). | |
3.4. Effect of phyllanthin supplementation on HFD induced low grade inflammation and lipid peroxidation
HFD fed mice showed increased serum pro inflammatory cytokines TNF-α, IL-1β and IL-6 (Fig. 3a). Phyllanthin intervention reduced serum TNF-α, IL-1β and IL-6 levels in LD and HD groups. Inflammatory response in serum was complemented by elevated expressions of NF-κB and F4/80 in vWAT in HFD group (Fig. 3b). Phyllanthin treated LD and HD groups down regulated NF-κB while only HD group showed down regulation of F4/80. Hepatic NF-κB expression remained unaffected while expression of F4/80 was reduced in HD group (Fig. 3c). Tissue homogenates of vWAT did not show any difference in concentration of lipid peroxides and nitrites among all the experimental groups. Treatments showed improved levels of antioxidant mechanisms like GSH and SOD (Fig. 3d) but found to be statistically insignificant. Liver homogenates of HFD showed higher level of lipid peroxides in liver as compared to control and treatment showed a decrease in lipid peroxidation (Fig. 3e). Similar trend was observed in the concentration of tissue nitrites. Treatment elevated concentrations of GSH and SOD in liver (Fig. 3e).
 |
| | Fig. 3 Effect of phyllanthin on HFD induced low grade inflammation and lipid peroxidation: [a] serum proinflammatory cytokines: TNFα (pg mL−1), IL-1β (pg mL−1), IL-6 (pg mL−1); [b] expression of inflammatory genes in vWAT: NF-κB and F4/80; [c] expression of inflammatory genes in liver: NFκB and F4/80; [d] oxidative stress indicators in vWAT : thiobarbituric acid reactive substances (TBARS) (nmol mg−1 protein); nitrite concentrations (μg mL−1); Reduced glutathione (GSH) (μmol mg−1 protein); superoxide dismutase (SOD) (U/mg protein); [e] oxidative stress indicators in liver: TBARS (nmol mg−1 protein); nitrite concentrations (μg mL−1); GSH (μmol mg−1 protein); SOD (U mg−1 protein). Data expressed as mean ± SEM and analyzed using one-way ANOVA statistical test with Tukey's post-hoc analysis. *p < 0.05 (vs. control), **p < 0.01 (vs. control), ***p < 0.001 (vs. control), #p < 0.05 (vs. HFD), ##p < 0.01 (vs. HFD), ###p < 0.001 (vs. HFD). | |
3.5. Effect of phyllanthin supplementation on glucose clearance and insulin sensitivity
Oral glucose tolerance test resulted in bell shaped curve of serum glucose vs. time. The area under curve for HFD animals was significantly higher than NPD fed group (Fig. 4a). Treatment groups supplemented with phyllanthin showed lower area under curve than HFD groups. Reduction in HFD induced hyperglycemia was found to be statistically insignificant (Fig. 4b). HFD fed animals showed hyperinsulinemia and phyllanthin treatment regressed serum insulin levels in LD and HD groups (Fig. 4c). Improvement in insulin sensitivity was observed in various indices such as HOMA-IR, QUICKI, revised QUICKI and McAuley's index (Fig. 4d). vWAT of HFD group showed down regulation of IRS-1 which in turn found to be elevated in LD and HD groups (Fig. 4e). Expressions of GLUT-4 and IR in vWAT of treatment groups (LD and HD) were found to be elevated than HFD. On contrary, IRS-2 expression was found to be elevated in HFD and further up regulated in LD and HD groups. As shown in Fig. 4f, expressions of hepatic genes IR, IRS-1 and IRS-2 were found to be down regulated in HFD animals. Phyllanthin treated animals (LD and HD) showed up regulation in the expressions of IR, IRS-1 and IRS-2.
 |
| | Fig. 4 Effect of phyllanthin supplementation on glucose clearance and insulin sensitivity: [a] oral glucose tolerance test (mg dL−1 vs. min), area under curve; [b] fasting blood glucose (mg dL−1); [c] serum insulin levels (μIU mL−1); [d] calculated insulin sensitivity indices: HOMA-IR calculated as (serum glucose mg dL−1* serum insulin μIU/mL)/405; QUICKI calculated as 1/(log fasting glucose mg dL−1 + log fasting insulin μIU/mL); revised QUICKI calculated as 1/(log fasting glucose mg dL−1 + log fasting insulin μU mL−1 + log FFA mmol l−1); McAuley index calculated as exp[2.63 − 0.28 ln(fasting insulin μU/mL) – 0.31 ln (fasting triglycerides mmol L−1)]; [e] expression of genes from vWAT: IRS-1, IRS-2, IR, GLUT-4; [f] expression of genes from liver: IRS-1, IRS-2, IR. Data expressed as mean ± SEM. One-way ANOVA statistical test with Tukey's post-hoc analysis was used. *p < 0.05 (vs. control), **p < 0.01 (vs. control), ***p < 0.001 (vs. control), #p < 0.05 (vs. HFD), ##p < 0.01 (vs. HFD), ###p < 0.001 (vs. HFD). | |
4. Discussion
P. amarus is well reported for its ethanomedicinal importance against wide range of human ailments.22 Being major component, phyllanthin may have major possible share in pharmacological properties exerted by the P. amarus. In the present study, phyllanthin showed a significant decrease in lipid accumulation during adipocyte differentiation process and also induced lipolysis in mature adipocytes. Apart from P. amarus, various other plants of Phyllanthus spp have also shown the presence of phyllanthin as their major constituent and thus suggesting role of phyllanthin in beneficial effects of Phyllanthus spp. Various reports are available on hypoglycemic, hypolipidemic, anti-inflammatory and antioxidant properties of P. amarus and other Phyllanthus spp against chemically induced diabetes and inflammation in mammalian models but effects of phyllanthin supplementation on diet induced chronic metabolic changes is not well studied.
Lignans, the basic scaffold of phyllanthin, are a group of bioactive, non nutrient and noncaloric phytoestrogens and chemically dimers of phenylpropanoid moieties.4,23 Flaxseeds, seasame seeds, grains, cereals and berries are the richest sources of most common lignans like secoisolariciresinol, lariciresinol, pinoresinol, matairesinol etc. Plant originated lignans have been proven beneficial in lifestyle related cardiovascular disorders, hormone dependent cancer and hormone dependent obesity.24 Secoisolariciresinol-diglucoside (SDG) at 0.5–1% lowers serum lipids TG, TC, LDL-C as well as serum insulin and leptin levels in high fat diet fed mice. Flaxseeds and SDG have shown antidiabetic effects in experimental diabetic animals.25,26 Mammalian lignans like enterolactone and enterodiol, metabolites of flaxseed lignans are potent antioxidant and possesses estrogen like properties.27 Similar to Secoisolariciresinol, phyllanthin is a diarylbutane type of lignan.
The present study emphasized on prevention of HFD induced metabolic changes by phyllanthin in Swiss albino mice. Co administration of phyllanthin prevented animal body weight gain in comparison to HFD but not in dose dependent manner. Antihyperlipemic potential of phyllanthin was proved on the basis of reduced serum triglycerides although neither high fat diet nor phyllanthin did change serum cholesterol profile. Crude extracts of P. niruri and P. amarus have shown lipid lowering activity in acute triton WR-1339 induced hyperlipidemia and chronic cholesterol fed hyperlipidemia. Both the plants have shown inhibition of hepatic cholesterol synthesis, increase in bile acids excretion as well as tissue lipase activation.28,29 The present study demonstrated up regulation of genes of adipose tissue lipases MGLL, HSL, and PNPLA2 in vWAT by phyllanthin which may be responsible for depletion of stored lipid and increased lipolysis in vitro. The set of three lipase assembly appears to control lipid breakdown cascade in adipose tissue. PNPLA2 (also known as adipose triglyceride lipase ATGL) and partly HSL are responsible for generation of DAG from TG. HSL regulates breakdown of second ester bond followed by MGLL to breakdown of MAG.30
Additionally, reduction in adiposity was found to be aligned with suppression of adipogenic genes PPARγ and CEBPα. PPARγ and CEBPα, expressed in mature adipocytes, are found to be promoting adipocyte differentiation and fat accumulation synergistically.31 Fat accumulation in adipose tissue was found to be impaired in CEBPα knockout mice.32 Although DLK-1 is a known preadipocytes marker and its up regulation indicates loss of fat mass, the recent studies have postulated role of DLK-1 in potentiating adipogenesis under influence of insulin in initial stages of differentiation in multipotent C3H10T1/2 cell line.33 In present study HFD feeding showed increased expression of DLK-1.
The reports suggest that chronic high fat diet feeding tends to aggravate low grade secondary inflammation by macrophage infiltration into WAT followed by raised circulatory levels of TNF-α, IL-10, IL-1β etc.34,35 P. amarus has been studied for its anti inflammatory properties such as inhibition of LPS-induced inflammation in macrophages and human blood cells.8 IL-1β is also known to contribute to insulin resistance via down regulation of IRS-1 and thereby disruption of insulin signaling pathway.36 Null mutation of TNF-α and TNF receptors in mice showed reduced FFA levels along with improvement in insulin sensitivity than wild type of mice.34,37 Pro inflammatory markers like TNF-α, IL-1β and IL-6 were found to be suppressed by phyllanthin and down regulation of inflammatory genes NF-κB and F4/80 in vWAT and liver suggested overall decrease in inflammation.
Increased TNF-α and IL-6 have shown influence on induction of lipolysis suggesting rise in FFAs. FFAs cause serine phosphorylation of IRS-1 via activation of PKC-θ and thereby reducing tyrosine phosphorylation of IRS-1.38 In consistence with the reports, we also observed increased inflammation and FFAs accompanied by hyperinsulinemia and insulin resistance. Phyllanthin corrected serum hyperinsulinemia and restored insulin sensitivity was observed in terms of improved HOMA-IR, QUICKI, revised QUICKI and McAuley index. Revised QUICKI and MaAuley index depict a degree of insulin resistance based on serum lipid parameters with insulin.17 Lipotoxicity induced ROS generation has been reported for its contribution to insulin resistance.39 Phyllanthin supplementation showed reduced degree of HFD induced lipid peroxidation and increased antioxidant enzymes. Phyllanthin reverted negative effects of inflammation and oxidative stress as well as FFAs on insulin sensitivity. It elevated expressions of, IR, IRS-1 and IRS-2 in liver and vWAT and enhanced clearance of oral glucose overload.
To summarize (Fig. 5), phyllanthin delayed progression of high fat diet induced changes affecting lipid and glucose metabolism such as adiposity, hypertriglyceridemia, fatty liver, inflammation and lipid peroxidation. These effects of phyllanthin may be responsible for improvement in insulin sensitivity.
 |
| | Fig. 5 Schematic presentation of effects of phyllanthin supplementation. | |
5. Conclusion
Bioactive plants of Phyllanthus spp such as P. amarus, P. niruri, P. urinaria, P. emblica (Emelica officinalis) are being extensively used in various nutraceuticals and functional foods. They have shown presence of phyllanthin as their major lignan component. The present study supports benefits of phyllanthin against diet induced metabolic alterations leading to chronic metabolic disorders. These protective effects of phyllanthin suggest potential role of Phyllanthus spp as functional food against progression of diet induced metabolic changes.
Abbreviations
| ACC | Acetyl-CoA carboxylase |
| ACOX-1 | Acyl-CoA oxidase 1 |
| C/EBP α | CCAAT enhancer-binding protein-α |
| DLK1 | Delta-like 1 homolog |
| F4/80 or EMR1 | EGF-like module-containing mucin-like hormone receptor-like 1 |
| FASN | Fatty acid synthase |
| GLUT-4 | Glucose transporter type-4 |
| GSH | Reduced glutathione |
| HD | Higher dose |
| HFD | High-fat diet |
| HOMA-IR | Homeostasis model assessment-insulin resistance |
| HSL | Hormone sensitive lipase |
| IL-1β | Interleukin 1β |
| IL-6 | Interleukin-6 |
| IR | Insulin receptor |
| IRS-1 | Insulin receptor substrate-1 |
| IRS-2 | Insulin receptor substrate-2 |
| LD | Lower dose |
| MGLL | Monoglyceride lipase |
| NFκB | Nuclear factor kappa-light-chain-enhancer of activated B cells |
| NPD | Normal pellet diet |
| PLIN-1 | Perilipin-1 |
| PNPLA2 | Patatin-like phospholipase domain-containing protein 2 |
| PPARγ | Peroxisome proliferator activated receptor γ |
| QUICKI | Quantitative insulin sensitivity check index |
| RFC | Relative fold change |
| SOD | Superoxide dismutase |
| TBARS | Thiobarbituric acid reactive substances |
| TC | Total cholesterol |
| TG | Triacylglycerol |
| TNF-α | Tumor necrosis factor-α |
| vWAT | Visceral white adipose tissue. |
Acknowledgements
Authors would like to thank Director, NIPER and Director, NABI for providing research grants as well as facility to carry out presented work. Authors would like to thank Dr A. S. Sandhu for his efforts in collection and identification of plant material.
References
- World Health Organization (WHO). WHO factsheet 311: obesity and overweight. 2015, URL:http://www.who.int/mediacentre/factsheets/fs311/en/, Accessed on January 20, 2016.
- L. J. Aronne, Obes. Res., 2002, 10, 105S–115S CrossRef PubMed.
- R. K. Baboota, M. Bishnoi, P. Ambalam, K. K. Kondepudi, S. M. Sarma, R. K. Boparai and K. Podili, J. Funct. Foods, 2013, 5, 997–1012 CrossRef.
- M. González-Castejón and A. Rodriguez-Casado, Pharmacol. Res., 2011, 64, 438–455 CrossRef PubMed.
- J. B. Calixto, A. R. S. Santos, V. C. Filho and R. A. Yunes, Med. Res. Rev., 1998, 18, 225–258 CrossRef CAS PubMed.
- H. Adlercreutz, Crit. Rev. Clin. Lab. Sci., 2007, 44, 483–525 CrossRef CAS PubMed.
- P. K. Mukherjee, A. Wahile, V. Kumar, S. Rai, K. Mukherjee and B. P. Saha, Drug Inf. J., 2006, 40, 131–139 Search PubMed.
- J. R. Patel, P. Tripathi, V. Sharma, N. Chauhan and V. K. Dixit, J. Ethnopharmacol., 2011, 138, 286–313 CrossRef CAS PubMed.
- A. Somanabandhu, S. Nitayangkura, C. Mahidol, S. Ruchirawat, K. Likhitwitayawuid, H. Shieh, H. Chai, J. M. Pezzuto and G. A. Cordell, J. Nat. Prod., 1993, 56, 233–239 CrossRef CAS.
- A. Karmase, S. Jagtap and K. K. Bhutani, Phytomedicine, 2013, 20, 1267–1271 CrossRef PubMed.
- A. Karmase, R. Birari and K. K. Bhutani, Phytomedicine, 2013, 20, 805–812 CrossRef CAS PubMed.
- K. Srinivasan, B. Viswanad, L. Asrat, C. L. Kaul and P. Ramarao, Pharmacol. Res., 2005, 52, 313–320 CrossRef CAS PubMed.
- K. Srinivasan, P. S. Patole, C. L. Kaul and P. Ramarao, Methods Find. Exp. Clin. Pharmacol., 2004, 26, 327–333 CrossRef CAS PubMed.
- F. Lei, X. N. Zhang, W. Wang, D. M. Xing, W. D. Xie, H. Su and L. J. Du, Int. J. Obes., 2007, 31, 1023–1029 CrossRef CAS PubMed.
- J. C. Fraulob, R. Ogg-Diamantino, C. Fernandes-Santos, M. B. Aguila and C. A. Mandarim-de-Lacerda, J. Clin. Biochem. Nutr., 2010, 46, 212–223 CrossRef CAS PubMed.
- G. R. Warnick, R. H. Knopp, V. Fitzpatrick and L. Branson, Clin. Chem., 1990, 36, 15–19 CAS.
- B. Antuna-Puente, E. Disse, M. Faraj, M. E. Lavoie, M. Laville, R. Rabasa-Lhoret and J. P. Bastard, Eur. J. Endocrinol., 2009, 161, 51–56 CrossRef CAS PubMed.
- D. P. Singh, P. Khare, J. Zhu, K. K. Kondepudi, J. Singh, R. K. Baboota, R. K. Boparai, R. Khardori, K. Chopra and M. Bishnoi, Int. J. Obes., 2015, 40(3), 487–496 CrossRef PubMed.
- D. P. Singh and K. Chopra, Eur. J. Pharmacol., 2013, 720, 98–106 CrossRef CAS PubMed.
- I. Kazmi, M. Afzal, S. Rahman, M. Iqbal, F. Imam and F. Anwar, Eur. J. Pharmacol., 2013, 709, 28–36 CrossRef CAS PubMed.
- R. K. Baboota, D. P. Singh, S. M. Sarma, J. Kaur, R. Sandhir, R. K. Boparai, K. K. Kondepudi and M. Bishnoi, PLoS One, 2014, 9, e103093 Search PubMed.
- G. Bagalkotkar, S. R. Sagineedu, M. S. Saad and J. Stanslas, J. Pharm. Pharmacol., 2006, 58, 1559–1570 CrossRef CAS PubMed.
- F. Shahidi and M. Naczk, Phenolics in food and nutraceuticals, CRC press, Tylor & Francis Group, 2003 Search PubMed.
- M. Imran, N. Ahmad, F. M. Anjum, M. K. Khan, Z. Mushtaq, M. Nadeem and S. Hussain, Nutr. J., 2015, 14, 71 CrossRef PubMed.
- S. M. Cornish, P. D. Chilibeck, L. Paus-Jennsen, H. J. Biem, T. Khozani, V. Senanayake, H. Vatanparast, J. P. Little, S. J. Whiting and P. Pahwa, Appl. Physiol., Nutr., Metab., 2009, 34, 89–98 CrossRef CAS PubMed.
- S. Fukumitsu, K. Aida, N. Ueno, S. Ozawa, Y. Takahashi and M. Kobori, Br. J. Nutr., 2008, 100, 669–676 CrossRef CAS PubMed.
- J. Peterson, J. Dwyer, H. Adlercreutz, A. Scalbert, P. Jacques and M. L. McCullough, Nutr. Rev., 2010, 68, 571–603 CrossRef PubMed.
- A. K. Khanna, F. Rizvi and R. Chander, J. Ethnopharmacol., 2002, 82, 19–22 CrossRef CAS PubMed.
- R. P. Umbare, G. S. Mate, D. V. Jawalkar, S. M. Patil and S. S. Dongare, Biol. Med., 2009, 1, 28–33 Search PubMed.
- V. Schoenborn, I. M. Heid, C. Vollmert, A. Lingenhel, T. D. Adams, P. N. Hopkins, T. Illig, R. Zimmermann, R. Zechner and S. C. Hunt, Diabetes, 2006, 55, 1270–1275 CrossRef CAS PubMed.
- Z. Wu, P. Puigserver and B. M. Spiegelman, Curr. Opin. Cell Biol., 1999, 11, 689–694 CrossRef CAS PubMed.
- N. D. Wang, M. J. Finegold, A. Bradley, C. N. Ou, S. V. Abdelsayed, M. D. Wilde, L. R. Taylor, D. R. Wilson and G. J. Darlington, Science, 1995, 269, 1108–1112 CrossRef CAS PubMed.
- M.-L. Nueda, V. Baladrón, B. Sánchez-Solana, M.-Á. Ballesteros and J. Laborda, J. Mol. Biol., 2007, 367, 1281–1293 CrossRef CAS PubMed.
- N. Murtaza, R. K. Baboota, S. Jagtap, D. P. Singh, P. Khare, S. M. Sarma, K. Podili, S. Alagesan, T. S. Chandra and K. K. Bhutani, Br. J. Nutr., 2014, 112, 1447–1458 CrossRef CAS PubMed.
- H. Xu, G. T. Barnes, Q. Yang, G. Tan, D. Yang, C. J. Chou, J. Sole, A. Nichols, J. S. Ross and L. A. Tartaglia, J. Clin. Invest., 2003, 112, 1821 CAS.
- C. Lagathu, L. Yvan-Charvet, J. P. Bastard, M. Maachi, A. Quignard-Boulangé, J. Capeau and M. Caron, Diabetologia, 2006, 49, 2162–2173 CrossRef CAS PubMed.
- K. T. Uysal, S. M. Wiesbrock, M. W. Marino and G. S. Hotamisligil, Nature, 1997, 389, 610–614 CrossRef CAS PubMed.
- C. Yu, Y. Chen, G. W. Cline, D. Zhang, H. Zong, Y. Wang, R. Bergeron, J. K. Kim, S. W. Cushman, G. J. Cooney, B. Atcheson, M. F. White, E. W. Kraegen and G. I. Shulman, J. Biol. Chem., 2002, 277, 50230–50236 CrossRef CAS PubMed.
- N. Houstis, E. D. Rosen and E. S. Lander, Nature, 2006, 440, 944–948 CrossRef CAS PubMed.
|
| This journal is © The Royal Society of Chemistry 2016 |
Click here to see how this site uses Cookies. View our privacy policy here.