A novel mariner-based transposon system for the enhanced removal of high strength ammoniacal nitrogen in pharmaceutical effluents

Abstract

Industrial wastewater is a major polluting agent in the environment as huge amounts of untreated effluents are discharged from industries causing serious effects to biotic systems. The pharmaceutical industry effluent used in the present study contains a high concentration of ammoniacal nitrogen (NH₃–N) about 500 mg L⁻¹. In the present study, an efficient NH₃–N removing strain was isolated, and enriched in the effluent with a high NH₃–N concentration for its efficient removal. The strain which showed higher removal efficiency was identified as Proteus penneri by ribotyping. The wild type P. penneri exhibited low removal efficiency (64%) in 24 hours even after the conventional enrichment method. Hence, the strain was mutated to improve its degradation efficiency using a modified mariner based transposon system. It was constructed by replacing the Kan^r gene with Gm^r gene to develop pSC189::miniTn(Gm), since the isolated strain was resistant to kanamycin. Two mutant strains T₅₅ and T₁₃₂ were shown to have enhanced NH₃–N removal efficiency by 84% and 81% respectively, in 24 hours. The kinetic rate constants such as pseudo first and second order kinetics were evaluated for the degradation of NH₃–N by wild type P. penneri and transposon mutants; both of them followed second order rate kinetics. The NH₃–N removal was confirmed by ion chromatography (IC) and Fourier Transform-Infrared Spectroscopy (FT-IR). To date, there is no report on the strain improvement using transposon mutagenesis for the treatment of NH₃–N.

---

1. Introduction

Waste waters released from various industries has become a major concern to environmentalists since they contain a complex nature of chemicals with poor biodegradability.¹ Ammonium salts are present in certain industrial wastewaters such as leather, chemical, pharmaceutical and pesticide manufacturing industries.² Pharmaceutical industries all over the world generate large quantities of wastewaters that contain considerable concentrations of antibiotics, organic compounds as well as ammoniacal nitrogen (NH₃–N). The conventional methods such as chemical precipitation (Magnesium Ammonium Phosphate (MAP) process),^3,4 air stripping process,⁵ ion exchange,⁶ etc. have been examined and each process has its own demerits in field level implementation. The chemical precipitation generates huge amount of toxic sludge and it needs to be dumped in landfill sites and the landfill leachates cause major environmental problems. The air stripping process releases the toxic ammonia into the air and the ion exchange process is not economically viable since it needs to be regenerated after the removal. Thus, the biological process is preferred, since it overcomes the demerits caused by physico-chemical treatment methods. Mainly, the biological process is eco-friendly in nature, since it provides the sludge free treatment. The economic advantage, both in terms of capital investment and operating costs of biological treatment over other conventional treatment processes, has cemented its place in any integrated wastewater treatment plant. The major problem with biodegradation of pharmaceutical effluent is the presence of high concentration of NH₃–N (>100 mg L⁻¹); such high concentration impairs the biodegradation of antibiotics and other organic compounds in effluent due to the toxicity of NH₃–N exerted to the microorganisms. Therefore, in pharmaceutical effluent, it becomes important to remove the NH₃–N, inorder to ease the biodegradation of antibiotics and organic compounds by the microbial consortium. Therefore, the focal theme of the present investigation was to isolate the ammonia utilizing bacterial strain Proteus penneri, enrich and use for the removal of ammonia from pharmaceutical industry effluent (PIE).

Commonly, 16S rDNA molecules are the tools to investigate microbial communities that avoid limitations of culturability. Several functional genes were to be useful for the same purpose because their phylogeny are congruent or very similar to phylogenetic relationships based on 16S rRNA gene (rDNA) analyses and moreover they indicate functional diversity in the environment.⁵

This paper mainly discusses about the biological method for the removal of NH₃–N in PIE by P. penneri. In addition, the study was aimed to extend the modification and incorporation of a mariner transposon in the genome of P. penneri to generate libraries of random insertion mutants. The mariner transposons as demonstrated by Linong et al.⁷ was expected to move through a DNA intermediate during transposition using a ‘cut-and-paste’ mechanism, resulting in excision of the transposon from the original location and insertion at novel sites in the genome. Lionel et al.⁸ reported that they always integrate into a TA target dinucleotide, which causes insertional inactivation of the particular site. The libraries are then screened to identify mutants that are defective in a particular phenotype so that it shows enhanced removal of NH₃–N in a short duration of time. This approach is cost-effective and applicable to a wide variety of bacteria.⁹ These “suicide” vectors are rapidly lost but allow the integration of passenger exogenous DNA carrying selection markers through transposition or homologous recombination in the chromosomes of recipient strains.

Therefore, in the present study, evaluated the use of Himar1 mariner transposons¹⁰ for random mutagenesis of P. penneri and the efficient bacterial strains were isolated by screening the transposon mutants from its library. They were further enriched in the industrial effluent and their efficiency was increased to further enhance the efficient treatment in a short duration of time. To date, there is no report on the treatment of NH₃–N by the strain which is modified by the method of transposon mutagenesis.

2. Materials and methods

2.1. Materials

The ammoniacal nitrogen containing pharmaceutical wastewater was obtained from a pharmaceutical industry, Chennai, India. The chemicals used in the study were purchased from Himedia and Sigma-Aldrich-Fluka Chemical Co., India. The primers were purchased from Bioserve, Chennai. All the enzymes used for molecular biology works were purchased from New England Biolabs (NEB), Chennai, India.

2.2. Isolation and identification of ammonia oxidizing microbial strain

The efficient ammonia oxidizing bacterial strains were isolated from the PIE contaminated soil by the enrichment method. The enrichment was started with the introduction of contaminated soil in the industrial effluent and incubated it for 96 hours under aeration (1 L min⁻¹) and the grown up bacterial cultures were used as mother inocula for the further periodic enrichment. The culture was then periodically transferred into the fresh effluents in 3 days interval where the enrichment was continued upto 3 weeks. Then the bacterial strains which acclimatized with the PIE were screened for the better efficiency in the removal of NH₃–N. Around 3 different bacterial strains were isolated from the enriched sample. Amongst 3 strains, the strain which showed higher efficiency in the removal of NH₃–N was subjected to molecular identification by ribotyping.

To identify the strain, fD1 [CGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG] and rP1 [CCCGGGATCCAAGCTTACGGTTACCTTGTTACGACTT] primers¹¹ were used for amplification of the variable region of the 16S rDNA gene. The deduced sequence was subjected to BLAST analysis against NCBI database. Phylogenetic analysis was performed by subjecting the deduced sequence to the 16S rDNA data base to obtain the closely related sequences, and the phylogenetic tree was constructed, based on evolutionary distances that were calculated by following the distance matrix method, using the Phylip package.¹² The strain was maintained in Luria Bertani (LB) medium for the further use.

2.3. Removal of ammoniacal nitrogen in industrial effluent by wild type strain Proteus penneri

The removal of ammoniacal nitrogen in PIE was carried out in 1 L batch reactor. The enriched P. penneri culture was centrifuged at 10 000 rpm for 10 minutes and the pellet was collected and inoculated in 1 L PIE. The moisture content of the biomass is 0.2 g g⁻¹ of biomass. Various parameters were optimized for the enhanced removal of NH₃–N from PIE by varying the time (24, 48, 72 and 96 hours), pH (6.0 to 9.0) and biomass (inoculums) concentrations (10, 20, 30, 40 and 50 g (wet weight) L⁻¹) of effluent. The effect of trace elements on the removal of NH₃–N was determined by adding 2 mL of trace element solution per litre of PIE. Trace element composition was EDTA (5 g L⁻¹), ZnSO₄·7H₂O (2.2 g L⁻¹), CoCl₂·6H₂O (1.6 g L⁻¹), MnCl₂·4H₂O (5.1 g L⁻¹), CuSO₄·5H₂O (1.6 g L⁻¹), (NH₄)₂Mo₇O₂₄ (1.1 g L⁻¹), CaCl₂·2H₂O (5.5 g L⁻¹) and FeSO₄·7H₂O (5 g L⁻¹). In addition to the trace elements, the salts such as (NH₄)₂SO₄ (1 g L⁻¹), KH₂PO₄ (0.07 g L⁻¹) and NaHCO₃ (3 g L⁻¹) were added to improve the growth of the P. penneri and thus the removal efficiency of NH₃–N. Aeration was provided at the rate of 1 L min⁻¹ and results were analysed for 96 hours in 24 hours interval. The removal of ammonia was analyzed by using Kjeldhal method¹³ and further the nitrite and nitrate which are formed from the conversion of NH₃–N were analyzed using the colorimetric methods followed by Narayana and Sunil.¹⁴

2.4. Construction of transposon mutant library

A transposon mutant library of P. penneri was constructed by using a modified mariner transposon, pSC189::miniTn(Gm), wherein, the Kan^r gene in the transposable element was replaced by a Gm^r gene (Fig. 1), since the wild strain was initially found to be sensitive to gentamycin.

Fig. 1 Schematic representation of construction of pSC189::miniTn(Gm).

A transposon mutant library of P. penneri was constructed by using a modified mariner transposon, pSC189::miniTn(Gm), which is developed by replacing KanR gene in pSC189 with GmR gene from pGp-Tn7-Gm. The Gmr gene was PCR amplified with the primer listed in Table 1 that introduce the desired restriction sites Xho1 and RsrII for further cloning. The PCR products was digested using XhoI/RsrII restriction enzymes and ligated in pSC189 which is pre-digested with same enzyme to delete Kmr gene as illustrated in Fig. 1, to give plasmid pSC::miniTn(Gm). This resultant plasmid is preferred to creating mutant library of P. penneri since the wild strain was found to be sensitive to gentamycin. The procedure was adapted from Tn7-based cloning and delivery system developed by Sebastien et al.¹⁵ and Neal et al.¹⁶ The cultures with appropriate doses of antibiotics were supplemented at the following concentrations: Gm, 15 mg mL⁻¹ (w/v) and Amp, 100 mg mL⁻¹ (w/v) and they were incubated at 37 °C. All the primers used for vector construction were presented in Table 1. The Gm^r gene from pGP-Tn7-Gm was PCR amplified, digested using XhoI/RsrII restriction enzymes and cloned in pSC189 which is pre-digested with same enzyme to delete Km^r gene as illustrated in Fig. 1, to give plasmid pSC::miniTn(Gm). The positive clones were further selected on a selective media of LB supplemented with Amp₅₀ and Gm₁₅.

Table 1 Primers used in this study

Name of the primers	Sequence (5′ to 3′)	Function
Gm F	CGGWCCGGAATTGTTAGGTGGCGGTACTTGG	Amplification of Gm^r gene from pGP-Tn7-Gm
Gm R	GAGCTCATGCATGATATCGTCCG CTCGAG
R6K F	GCCGCTCTAGACCCCTATAGTGAGTC	Amplification of the R6K origin of replication site for the confirmation of transposon integration in the genome
R6K R	GAATTCCTGCACCCTTAATTAACCCCG

---

For the conjugal transfer, pSC::miniTn(Gm) were further transformed to Mu-free donor (MFD) cells to act as donor, grown in LB supplemented with 0.3 mM diaminopimilic acid (DAP). Conjugation was performed according to the procedure followed by Lionel et al.⁸ with little modification as follows: equal volumes of the donor and recipient cells to read optical density of 1.0 at 600 nm was mixed, centrifuged to collect the pellet and washed twice with LB broth. The pellet was further suspended in 50 μl of LB broth and spotted on dry LB agar plates to make tight contact for conjugation. After incubation of plates for 1 hour at 37 °C, the cell spot was harvested and resuspended in fresh LB broth. The transconjugants were further selected on an LB plate containing Gm₁₅ by spread plate after overnight incubation at 37 °C. The absence of DAP provided the non selection of MFD donor strain. They were confirmed for the transposon insertion by colony PCR using R6K primers, which were amplified the R6K origin of replication located inside the transposable elements. Genomic DNA of the transconjugants was used as the template for PCR amplification.

2.5. Screening of the mutant with enhanced ammoniacal nitrogen removal

Following mutagenesis, viable mutants were screened for enhanced NH₃–N removal. The removal ability of the mutants was verified from reduction profiles of different mutant strains and compared with wild strain under the optimised conditions. For this purpose, a total of 350 isolates were screened, each of which was inoculated into 1 L of PIE, and incubated for 24 hours under optimum conditions together with the addition of other trace elements and salts. The residual NH₃–N content was determined in the treated effluent by Kjeldhal method.¹³ Reduction profile of each of the mutant strain was plotted and analysed.

2.6. Kinetic rate constants for the degradation of NH₃–N by P. penneri wild type and transposan mutants

In order to investigate the kinetic rate constants for the degradation of NH₃–N using P. penneri, the non-linear kinetic models were applied. The pseudo first order¹⁷ and pseudo second order¹⁸ kinetic models were employed, following the equations, eqn (1) and (2) respectively.

r_t = r_e(1 − exp^−K₁t) (1)

where r_e and r_t are the amounts of NH₃–N (%) degraded at equilibrium and at time (t), K₁ and K₂ are the first and second order rate constants.

2.7. Fourier transform-infrared spectroscopy (FT-IR) studies

A Perkin Elmer infrared spectrometer was used for the investigation of nitrite and nitrate ions in treated PIE sample. The treated and untreated samples were lyophilized and mixed with KBr and made into pellets at a pressure of about 1 MPa. The pellets with dimensions diameter 10 mm and thickness 1 mm, the samples were scanned in the spectral range of 4000–400 cm⁻¹.

2.8. Quantification of nitrite and nitrate in treated and untreated effluent by colorimetric method and ion chromarography (IC)

The nitrite and nitrate produced from the conversion of NH₃–N by wild and mutant strains were analyzed using the colorimetric methods followed by Narayana and Sunil.¹⁴ Also, the ion chromatography was used to confirm the conversion of NH₃–N into nitrite and nitrate ions. The ion chromatography was performed with Metrohm instrumentation consisting of a 709 IC Pump, 733 IC Separation Centre and a 732 IC conductivity detector. Cation separation was carried out in non suppressor mode on a Metrosep cation 1–2 analytical column (125 × 4 mm) connected in series with a Metrosep cartridge. The Metrosep cartridge is used as a precolumn to protect the analytical column. The dilution factor for each of the sample was fixed at 50. Sample injection volume used was 20 μl. The nitrite ad nitrate quantity in mg L⁻¹ was determined from the peak area and time in minutes from the chromatogram.

3. Results and discussion

3.1. Isolation and identification of ammonia oxidizing microbial strain

The strain with enhanced ammonia removal was isolated and identified as Proteus penneri by the method of ribotyping. The 16S rDNA sequencing data indicated that the isolate was P. penneri (Fig. 2). The nucleotide sequence reported here has been assigned an accession number “KM000848” from NCBI Gene Bank database. The BLAST result showed 99% similarities to those of nearest strain P. penneri NCTC 12737. NH₃–N analysis by Kjeldhal method¹³ showed that the major reduction was obtained with enriched wild strain of P. penneri wherein it was reported to have an efficient ammonia removal by 64% in 24 hours.

Fig. 2 Maximum likelihood phylogenetic tree of Proteus penneri with other closely related species on 16S rDNA sequences. Numbers in the nodes are the bootstrap values from 1000 replicates.

3.2. Optimization of culture conditions for the removal of ammoniacal nitrogen by wild type P. penneri

3.2.1. Effect of time. The effect of time on percentage removal of ammonia by wild type strain was studied and was observed that longer the incubation time, the better the efficiency of NH₃–N removal and it was 64% in 24 hours and 74% in 72 hours (Fig. 3a). It was observed that increase in treatment period beyond 72 hours decreased the removal percentage for the wild strain. Several factors such as toxicity of the other chemicals presented in the sample or secondary metabolites produced during the treatment of PIE could be attributed to the decrease in efficiency. Tang et al.¹⁹ reported that they achieved around 78% ammonium removal efficiency with the initial effluent NH₃–N concentration 123–257 mg L⁻¹ by the ammonia oxidizers in the anaerobic ammonium oxidation (ANAMMOX) process. Comparatively, Proteus penneri can be considered as highly efficient strain for the removal of high strength ammoniacal nitrogen containing wastewater since it showed 74% efficiency with the initial effluent NH₃–N concentration 500 mg L⁻¹. To our knowledge, such a high ammoniacal nitrogen removal capacity for pharmaceutical wastewater has not been previously reported.

Fig. 3 Effect of (a) time, (b) pH, (c) temperature and (d) biomass concentration on NH₃–N removal.

3.2.2. Effect of pH. The pH of the culture is one of the most important environmental parameters affecting microbial cell growth and enzyme production. The effect of initial pH on the NH₃–N removal by P. penneri was investigated for pH values from pH 6 to 9 as shown in Fig. 3b. The maximum removal of NH₃–N was observed at pH 8. The oxidation of ammonia by nitrifying bacteria growing in inorganic liquid media generally occurs optimally within the pH range 7.0–8.5.^20,21 Also, the most likely mechanism for inhibition of growth in lower pHs are ionization of NH₃ to NH₄⁺ at low pH and either the lack of an active ammonium transport system.²⁰

3.2.3. Effect of temperature. The temperature has greater role in the removal of NH₃–N. The maximum removal of NH₃–N (64%) was observed at 35 °C. The efficiency of the NH₃–N removal was not much affected at 40 °C, but at 45 °C and 50 °C, the removal efficiency was gradually decreased (Fig. 3c). This indicates that the optimum temperature for the removal of NH₃–N by P. penneri was 35 °C and the bacterial strain may be regarded as mesophilic in nature.

3.2.4. Effect of biomass concentration. The selection of suitable biomass concentration becomes an important parameter to improve the NH₃–N removal efficiency since the efficiency is controlled by the number of cells. Hence, various concentrations of biomass 10 to 50 g L⁻¹ (w/v) were added to 1 L PIE at pH 8.0. The results showed that NH₃–N removal efficiency was achieved by 64% with biomass concentration of 40 g L⁻¹ (w/v) and there was no much difference in NH₃–N removal efficiency for increase in biomass concentrations beyond 40 g L⁻¹. This infers that 40 g L⁻¹ of biomass was required to provide the maximum removal of NH₃–N in 1 L of PIE (Fig. 3d).

3.3. Construction of pSC189::miniTn(Gm)

In the present study, pSC189 was chosen to be the suitable transposon delivery vector for P. penneri, as they are non-replicative plasmid with R6K origin of replication and hence replicate only in those system which encodes the λ-pir protein.⁸ The wild stain P. penneri was observed to be sensitive to gentamycin and resistant to kanamycin, and thus more versatile vector was developed in the present investigation by replacing the kanamycin resistant gene with gentamycin resistant gene (ESI-Fig. 1†). As suggested by Lionel et al.⁸ and Chiho et al.²² the replication of these plasmids requires the pir-encoded protein, which is usually provided in trans in the donor strain. In the absence of pir site in the recipient strain, these plasmids cannot replicate.

For the conjugal transfer, pSC189::miniTn(Gm) were further transformed to MFD λ-pir donor strain. After conjugation with P. penneri, the transconjugants were selected on LB with gentamycin in the absence of DAP. The donor MFD λ-pir cells will not survive since it requires the supplementation of DAP, rather transconjugants alone will survive on the gentamycin plate. The transconjugants were confirmed by PCR amplification of R6K origin of vector backbone (ESI-Fig. 6†).

3.4. Screening of the mutant with enhanced ammonia removal

About 350 mutant colonies were screened from transposon mutant library. The NH₃–N removing mutants were screened by inoculating the mutants in the PIE while the wild type strain served as control. Of which, 2 mutants (T₅₅ and T₁₃₂) showed enhanced removal of NH₃–N compared to other mutants. NH₃–N content was estimated for the mutated strains under the optimized conditions and was found to be 84% and 81% in 24 hours for the transposon mutants T₅₅ and T₁₃₂ respectively. Since the T₅₅ mutant strain showed higher efficiency when compared to T₁₃₂, the T₅₅ was selected for the further study. The mutant T₅₅ was proved to have an improved efficiency of NH₃–N removal as they showed a high removal efficiency of 84% within 24 hours and 89, 95 and 97% in 48, 72 and 96 hours respectively, whereas the wild type strain removed NH₃–N by only 64% in 24 hours and 70% in 96 hours. This indicates that, the P. penneri transposon mutant was an inevitable source for the enhancement of the NH₃–N removal. The stability of the transposon mutant strain, T₅₅ was confirmed even after five subcultures in non-selective media.

3.5. Hydrolysis rate kinetic constants

The validity of the kinetic order of degradation process was based on the regression coefficients. The first order rate constant K₁ and the second order rate constant K₂ are summarized in Table 2. The results confirmed that the degradation of NH₃–N obeyed the second order rate kinetic model as observed greater R² values.

Table 2 Kinetic rate constants for the degradation of NH₃–N

Microbial strain	Pseudo first order		Pseudo second order
	K1 (h^−1)	R^2	K2 (mg L^−1 h^−1)	R^2
P. penneri (wild type)	0.028	0.966	2.56 × 10^−3	0.999
Transposon mutant	0.039	0.928	1.75 × 10^−3	0.999

---

3.6. Characterization of the treated sample using FT-IR studies

The FT-IR spectrum of untreated effluent (Fig. 4a) has a wide band at 3432.71 cm⁻¹, due to the 1° and 2° amines – stretching vibrations caused due to the presence of ammonium ions present in industrial effluent. The peak observed at 2358.3 cm⁻¹ is attributed to NH₂ scissoring (1° amines) – bending vibrations and the peak observed at 1083.637 cm⁻¹ are due to C–N stretching vibrations.

Fig. 4 FT-IR spectroscopy of (a) untreated sample, (b) effluent treated with wild strain, and (c) effluent treated with T₅₅ mutant strain.

The FT-IR spectrum of the PIE treated with wild-type strain (Fig. 4b) shows the peak at 1398.11 cm⁻¹ suggest the presence of aliphatic NO groups and the peaks at 1666.71 cm⁻¹ is due to the asymmetrical stretching in NO₂. The bands at 834.50 cm⁻¹ and 703.48 cm⁻¹ could be attributed to stretching of π bond of N–O linkage and the presence of NO₂ bending vibrations.

The spectral data of various peaks corresponding to the PIE sample treated with transposon mutant T₅₅ (Fig. 4c) indicated that the peaks at 1634.43 cm⁻¹ and 788.964 cm⁻¹ correspond to NH₂ scissoring (1° amines) – bending vibrations and NH₂ and NH wagging respectively. The peak at 1402.134 cm⁻¹ indicates the presence of aliphatic NO groups and peak at 788.964 cm⁻¹ indicated NO₂ bending vibrations.

Therefore, it is observed that the intensity of the 1° and 2° amines stretching vibrations, caused due to the presence of ammonium ions, has decreased in the treated effluent when compared to the untreated sample. Hence, it can be validated that the presence of various nitro (nitrite and nitrate) groups in the treated sample indicates that the major removal of NH₃–N has occurred through the conversion of amine groups to nitro groups.

3.7. Nitrite and nitrate determination in the treated and untreated effluent by colorimetric method and ion chromatography (IC)

The treated PIE sample (24 hours sample) by wild type and mutant strains were subjected to nitrite and nitrate analysis by colorimetric methods, it shows the nitrite and nitrate production were enhanced in the treated PIE sample by the mutant strain compared to wild type strain. The treated PIE by wild type strain contains around 12.6 mg L⁻¹ of the nitrite and 4.8 mg L⁻¹ of the nitrate and the treated PIE by mutant strain contains around 61 mg L⁻¹ of the nitrite and 26 mg L⁻¹ of the nitrate. This was further confirmed with ion chromatography.

Ion chromatogram was collected to determine the quantity of nitrite and nitrate ions present in the treated and untreated PIE sample (figure not shown). The data obtained from the chromatogram validates that the quantity of nitrite present in the untreated PIE sample was 23.7 mg L⁻¹ and the nitrite present in the PIE sample treated with wild type strain P. penneri was 26.2 mg L⁻¹. This shows that 9.5% conversion of NH₃–N to nitrite ions has occurred during the treatment process with the wild strain in 24 hours under optimized conditions. The treatment efficiency of the transposon treated sample shows a major conversion of 56.7% as nitrite present in the transposon treated effluent has increased from 23.7 mg L⁻¹ to 54.8 mg L⁻¹. Around 23.6% nitrate was observed in the transposon treated sample while it is 5.2% in the wild type treated sample.

Therefore, it is inferred that major removal of NH₃–N was caused due to the conversion to nitrite ions and a minor conversion to nitrate ions. Hence, it is studied that the amoA gene which is responsible for the expression of ammonia monooxygenase, which is the first enzyme involved in the conversion of ammonia²³ to nitrite plays a key role in the process of NH₃–N removal from the effluent sample. This is corroborated with the findings of Zhi et al.²⁴ and also with Zhi and Ji.²⁵ They reported that the ammoniacal nitrogen removal is collectively controlled by amoA and nxrA gene.

4. Conclusion

In this study, the P. penneri was isolated and enriched in the PIE for the NH₃–N removal. The wild strain showed only 64% and 74% NH₃–N removal in 24 and 72 hours respectively. The strain improvement was done for the purpose of industrial applications by reducing the reaction time and increasing the efficiency of the strain by constructing a mutagenesis library of P. penneri by the method of transposon mutagenesis. A series of mutant strains were developed for the purpose enhanced removal of NH₃–N in PIE. NH₃–N removing mutant strains T₅₅ and T₁₃₂ were acquired from the transposon mutation bank, which exhibited increased NH₃–N removal than the wild strain under the optimized conditions and in short duration (24 hours). The selected mutant strain T₅₅ were found versatile for the removal of NH₃–N by 84% in 24 hours. Hence, random mutagenesis was found to be an efficient method for the strain improvement to enhance the removal of NH₃–N in the pharmaceutical industrial effluent. The study has wide applications for the treatment of high strength NH₃–N containing pharmaceutical wastewater.

References

1. L. Yuan, W. Zhi, Y. Liu, S. Karyala, P. J. Vikesland, X. Chen and H. Zhang, Environ. Sci. Technol., 2014, 49(2), 824–830.
2. M. Suneetha, K. Ravindhranath, Der Pharma Chemica, 4(1), 214–227.
3. K. J. Suthar and N. P. Chokshi, Proceedings: International conference on current trend in technology, 2011, pp. 08–10.
4. H. Wang, G. W. Cheng, X. W. Song, Z. H. Xu, J. J. Meng and C. Q. Dong, Huanjing Kexue, 2013, 34(7), 2718–2728.
5. B. H. Sorensen and S. E. Jorgensen, Stud. Environ. Sci., 1993, 23–24.
6. B. Gesche, Z. Jizhong, W. U. Liyou, H. D. Allan and M. T. James, Appl. Environ. Microbiol., 2000, 66(5), 2096–2104.
7. Z. Linong, S. Uma, J. L. David, M. R. Hugh and L. G. Frank, Nucleic Acids Res., 1998, 26, 3687–3693.
8. F. Lionel, H. Gaelle, N. Toan, M. Anne, M. Didier, B. Christophe and M. G. Jean, J. Bacteriol., 2010, 192, 6418–6427.
9. T. C. Stephen and P. M. Nigel, Appl. Environ. Microbiol., 2010, 76(4), 1103–1109.
10. A. R. Drew, A. T. Lily and P. S. Herbert, Appl. Environ. Microbiol., 2008, 74, 7529–7535.
11. W. G. Weisburg, S. M. Barns, D. A. Pelletier and D. J. Lane, J. Bacteriol., 1991, 697–703.
12. J. F. Phylip, Bacteriology, 1993, 98, 756–766.
13. American Public Health Association (APHA), American Water Works Association and Water Pollution Control Federation, 18th edn, 1992.
14. B. Narayana and K. Sunil, Eurasian J. Anal. Chem., 2009, 4(2), 204–214.
15. C. Sebastien, H. Josee and M. D. Charles, Appl. Environ. Microbiol., 2012, 1128(10), 00986.
16. J. Neal, I. Golden, C. Drew and W. K. David, American Society for Microbiology, 2000, 68(9), 5450–5453.
17. S. Lagergren and B. K. Svenska, Veternskapsakad Handlingar, 1898, 24, 1–39.
18. Y. S. Ho and G. Mckay, Trans IChem E., 1998, 76B, 183–191.
19. C. J. Tang, P. Zheng, T. T. Chen, J. Q. Zhang, Q. Mahmood, S. Ding, X. G. Chen, J. W. Chen and D. T. Wu, Water Res., 2011, 45, 201–210.
20. S. A. Q. Burton and J. I. Prosser, Appl. Environ. Microbiol., 2001, 2952–2957.
21. S. M. Allison and J. I. Prosser, Soil Biol. Biochem., 1993, 25(7), 935–941.
22. M. M. Chiho, M. G. Anne and M. Didier, Res. Microbiol., 2004, 155, 455–461.
23. S. H. Hong, D. J. Hyun, J. Bongjin and Y. L. Eun, J. Microbiol. Biotechnol., 2012, 22(9), 1193–1201.
24. W. Zhi, L. Yuan, G. Ji and C. He, Environ. Sci. Technol., 2015, 49(7), 4575–4583.
25. W. Zhi and G. Ji, Water Res., 2014, 64, 32–41.

---

Footnote

† Electronic supplementary information (ESI) available. See DOI: 10.1039/c5ra26423e

---