Curcumin modified silver nanoparticles for highly efficient inhibition of respiratory syncytial virus infection

Xiao Xi Yang , Chun Mei Li and Cheng Zhi Huang *
Key Laboratory on Luminescence and Real-Time Analytical Chemistry (Southwest University), Ministry of Education, College of Pharmaceutical Science, Southwest University, Chongqing 400715, China. E-mail: chengzhi@swu.edu.cn; Fax: +86 23 68367257; Tel: +86 23 68254659

Received 10th November 2015 , Accepted 5th January 2016

First published on 6th January 2016


Interactions between nanoparticles and viruses have attracted increasing attention due to the antiviral activity of nanoparticles and the resulting possibility to be employed as biomedical interventions. In this contribution, we developed a very simple route to prepare uniform and stable silver nanoparticles (AgNPs) with antiviral properties by using curcumin, which is a member of the ginger family isolated from rhizomes of the perennial herb Curcuma longa and has a wide range of biological activities like antioxidant, antifungal, antibacterial and anti-inflammatory effects, and acts as reducing and capping agents in this synthetic route. The tissue culture infectious dose (TCID50) assay showed that the curcumin modified silver nanoparticles (cAgNPs) have a highly efficient inhibition effect against respiratory syncytial virus (RSV) infection, giving a decrease of viral titers about two orders of magnitude at the concentration of cAgNPs under which no toxicity was found to the host cells. Mechanism investigations showed that cAgNPs could prevent RSV from infecting the host cells by inactivating the virus directly, indicating that cAgNPs are a novel promising efficient virucide for RSV.


Introduction

The use of nanomaterials in medicine raises high expectation for human health and is already contributing to the development of new drugs, biologics, and medical devices, indicating that developing nanoparticle-based drug delivery, biomolecular sensing, biological imaging and nanoparticle-based therapies shows high promise.1,2 The point we are concerned about is the suppressive effect of nanoparticles on virus infection.3–11 In the majority of research studies, the antiviral effect is achieved by preparing nanoparticles modified by different functional biomolecular covers, wherein the modified covers can inactivate the virus directly or recognise the receptors on the host cell surface and block viral entry into cells. Functional gold nanoparticles,3–7 ZnO nanoparticles,8 carbon nanomaterials,9 nanoclay10 and silicon nanoparticles11 have been reported to display antiviral properties to some extent. It seems that the use of metal nanoparticles provides a potential opportunity for novel antiviral therapies. Since metal nanoparticles have a broad-spectrum antiviral ability and are not prone to inducing resistance.12

Among the noble-metal nanomaterials, silver nanoparticles (AgNPs) have received considerable attention owing to their attractive antibacterial,13 antifungal, and antiviral properties. In vitro studies have demonstrated that AgNPs could be used as antiviral agents against human immunodeficiency virus (HIV),14–16 H1N1 influenza A virus,17,18 monkeypox virus,19 adenovirus,20 Tacaribe virus,21 hepatitis B virus (HBV), herpes simplex virus (HSV)22,23 and so on. It has been suggested that silver nanoparticles bind with the viral envelope glycoprotein and inhibit the virus by binding to the disulfide bond regions of the cluster of differentiation 4 (CD4) binding domain within the HIV-1 viral envelope glycoprotein gp120.14,15 Moreover, AgNPs have high binding affinity with the double-stranded HBV, and thus different sized AgNPs can inhibit the production of HBV RNA and extracellular virions.24 Because of their multiple interactions with the glycoprotein receptor and viral envelope glycoprotein, AgNPs can inhibit the viral multiplication inside the host cell by preventing the replication or blocking the entry of virus particles inside the host cell, and thus have strong antiviral potential.12 In the case of cytotoxicity, nanoparticles with large sizes showed a higher level of cytotoxicity than those with small sizes. Furthermore, it has been reported that smaller the size more interaction and more inhibition take place. Because the small size nanoparticles have large surface areas, which can result in a direct interaction with viral envelope proteins. Moreover, the small nanoparticles can enter into the host cell easily and interact with the viral genome to interfere in viral replication.25

Curcumin, [1,7-bis(4 hydroxy-3-methoxy phenyl)-1,6 heptadiene-3,5-diene], a member of the ginger family, is isolated from rhizomes of the perennial herb Curcuma longa.26,27 Similar to natural polyphenols, curcumin has various functions including antioxidant, antifungal, antibacterial, anti-inflammatory, antiviral effects and so on.28,29 Recently, Kojima's group reported that curcumin could prevent replication and budding of respiratory syncytial virus (RSV). The detailed mechanism had been studied at the genetic levels thoroughly and their research has a profound significance.30 However, the poor solubility in water and low bioavailability of curcumin greatly confine its applicable range in clinics.31

RSV, a negative-sense, single-stranded enveloped RNA virus belonging to the Paramyxoviridae family,32–34 targets the ciliated cells of the bronchial epithelium and type 1 pneumocytes in alveoli, causing acute lower respiratory infections in infants, the elderly and immunocompromised individuals.35–37 RSV infects patients with an early age and exhibits greater consequences than other respiratory viruses and causes more frequent and severe infections. In children, RSV can progress to bronchiolitis or pneumonia with an increased chance of significant morbidity or death, and previous infections do not lead to persistent immunity, increasing the possibility of reinfection throughout life without significant antigenic change.34,38 Therefore, effective and specific methods for early diagnosis of RSV and effective treatments used for RSV infections are of great importance. Our group has established a series of sensitive detection methods and new labelling routes about the RSV, and has realized the real-time tracking of RSV.39–44 Currently there have been two antibodies palivizumab (Respigam™ and Synagis™) approved for human beings use.45 The two antibodies, however, are limited due to the risk of transmission of blood-borne pathogens, limited effectiveness and high cost. Meanwhile, only one antiviral drug (ribavirin) is available for treating severe RSV infection. So there is a need to develop cheap, safe and effective antivirals for RSV infection, and it has shown high promise to develop a new modality to inhibit viral infection, for example, by fabricating DNA conjugated gold nanoparticle (DNA-AuNP) networks on the host cell membranes as a protective barrier.46 In this manuscript, we hope to develop new nanoparticles, which can interfere with the interaction between RSV and the host cells, and block viral entry into cells. Considering that the excellent properties both of curcumin and AgNPs, and the breakage of intramolecular hydrogen bonding can increase the availability of curcumin in water at high temperature, we expected that curcumin modified AgNPs should have excellent antiviral activity against RSV infection (Scheme 1).


image file: c5nr07918g-s1.tif
Scheme 1 Schematic representation of the synthesis of cAgNPs (A) and a proposed inhibition mode of cAgNPs against RSV infection (B). The inhibition mode of (B) shows that cAgNPs can reduce the binding ability of virus with the binding centers on the surface of cells (b) as compared to those without cAgNPs (a).

Kojima's finding was very interesting and attractive,30 and it occurred to us to synthesize small, uniform, and stable mono-disperse curcumin-AgNPs (cAgNPs), which might exert synergistic antiviral effects of curcumin and AgNPs and thus act as smart nanomedicine for RSV infection.

Experimental

Materials

Curcumin was purchased from Aladdin, while AgNO3 was from Shanghai Shenbo Chemical Co., Ltd (Shanghai, China). Dimethyl sulphoxide (DMSO) was commercially available from Beijing Dingguo Changsheng Biotechnology Co. Ltd (Beijing, China) and used to dissolve curcumin at first. K2CO3 was obtained from Chengdu Kelong Chemical Co., Ltd, (Chengdu, China) to obtain the desirable pH of the solution. Human laryngeal epithelial type 2 (Hep-2) cells was commercially obtained from XiangYa School of Medicine (Changsha, Hunan), while respiratory syncytial virus (RSV) was commercially available from Guangzhou Biotest Biological Technology Co., Ltd. The Cell Counting Kit-8 (CCK-8) reagent was purchased from Dojindo (Kumamoto, Japan). RPMI 1640 was purchased from Hyclone (USA) and the fetal bovine serum (FBS) was commercially obtained from GIBCO (USA). TRizol reagent was purchased from Life Technologies (Carlsbad, USA). The iScript™ cDNA synthesis kit and iQ™ SYBR Green Supermix were commercially available from Bio-Rad (California, USA).

Apparatus

The UV-vis absorption spectrum of cAgNPs was acquired using a Hitachi U-3100 UV-vis spectrometer (Tokyo, Japan). A Hitachi S-4800 scanning electron microscope (SEM) and a JEM-2010 transmission electron microscope (TEM, Tokyo, Japan) were used to identify the size and shape of cAgNPs. A Biotek Microplate Reader (USA) was used to measure the optical density (OD) of the solution at 450 nm in the cytotoxicity test. Immune-fluorescence imaging was performed with an Olympus IX81 microscope with a 60× objective (Tokyo, Japan). A Shimadzu FTIR-8400S Fourier transform infrared (FTIR) spectrophotometer (Kyoto, Japan) was employed to record the IR spectra. Elemental analysis was performed on a Thermo ESCALAB 250 X-ray photoelectron spectrometer (USA). A Malvern dynamic light scattering (DLS) Nano-ZS zetasizer (England) was used to measure the size and ζ-potential of the cAgNPs. METTLER TGA 1/1600HT (Mettler, Switzerland) was used to investigate the thermal stability of cAgNPs. The gene expression levels of cytokines were detected by using a Bio-Rad iCycler Thermal Cycler w/iQ5 Optical Module for RT-PCR (California, USA).

Preparation of the cAgNPs

All glassware used was thoroughly cleaned using chromic acid before use. In a 100 mL flat-bottomed flask with a condenser, 250 μL of 20 mM curcumin dissolved in DMSO was diluted into 22.5 mL ultra-pure water, and then slightly adjusted to alkaline pH with K2CO3. With vigorous stirring at 100 °C, 2.5 mL AgNO3 (10 mM) was quickly added in the mixture. The color changes from blood red to yellow brown after few minutes. By vigorously stirring at 100 °C for 1 hour, the mixture was then cooled down to room temperature. The mixture was finally ultra-filtered, and the as-prepared cAgNPs were then transferred for optical and shape characterization, and the antiviral study against RSV infection. For comparison, citric acid modified AgNPs were prepared according to the conventional method.47

Biocompatibility of cAgNPs in Hep-2 cells

The in vitro cellular viability of the as-prepared cAgNPs was evaluated using the CCK-8 cell viability assay. First, approximately 1.0 × 104 Hep-2 cells per well were seeded in 96-cell plates and were fed with RPMI 1640 containing 2% fetal bovine serum (FBS). After 24 hours of incubation in a humidified incubator with 5% CO2 at 37 °C, the medium was removed from each well, and Hep-2 cells were washed with phosphate buffered saline (PBS, pH 7.4). Then, sample solutions (cAgNPs with different concentrations) or the control solutions were added in and incubated with cells for 24 h to 72 h. Each concentration was tested with 6 sets of parallel samples. After that, the culture medium was replaced with the CCK-8 reagent and incubated for another 1 h at 37 °C. The last step was to measure the optical density (OD) at 450 nm with a Biotek Microplate Reader. The viability of cells was expressed as the percentage of control untreated cells (100%).

Assays for antiviral activities

Hep-2 cells were plated at 8.0 × 104 cells per well in 24-well plates and incubated for 24 hours at 37 °C. To analyse how cAgNPs affect the infectivity of RSV, the virus pre-treatment assay was taken as follows. RSV were pre-incubated with a series of cAgNPs at 4 °C for 1 hour, and then cultured with Hep-2 cells for 2 hours at 37 °C. After that, cell monolayers were washed with PBS to remove non-adherent virus and cAgNPs, and further incubated with RPMI 1640 (containing 2% FBS) at 37 °C. The cell pre-treatment assay was performed by incubating Hep-2 cells with a series of cAgNPs for 1 h, and then cells were washed with PBS and infected with RSV. After the virus adsorption, the non-adherent RSVs were washed away with PBS and cells were overlaid with RPMI 1640 (containing 2% FBS) at 37 °C. The cell post-treatment assay was started by infecting Hep-2 cells with RSV for 2 h. Following the adsorption period, the inocula were removed, the cells were washed with PBS and then incubated with a series of cAgNP for 1 h at 37 °C. The cAgNPs were later removed, cells were washed with PBS and overlaid with RPMI 1640 (containing 2% FBS). Negative (cells only) and positive (cells infected with RSV without nanoparticles) controls were set as well. Cytopathic effects (CPE) were observed in inoculated cells on the third day. So, the medium was discarded and washed with PBS. After that, 200 μL PBS was added per well, and the plate was frozen and thawed three times. Then, the mixture was centrifuged for 10 min at 3000 rpm to remove cell debris, and the supernatant containing RSV was collected separately and used for the viral titer assay.

Viral titer assay

The viral titer assay of RSV was measured by using tissue culture infectious dose (TCID50) test. Hep-2 cell monolayers were seeded at 1.0 × 104 cells per well in 96-well plates, 24 hours before infection. Serial 10-fold dilutions of the separately collected RSV were made in serum-free medium, and 0.03 mL was used to infect cells for 2 hours at 37 °C. Virus was aspirated from each well, and the RPMI 1640 with 2% FBS was added. The plates were incubated at 37 °C with 5% CO2 for a week. A 50 μL volume of 2.5% glutaraldehyde and 0.05% neutral red in PBS replaced the growth medium to stain live cells. The final value of TCID50 was calculated according to the Reed–Muench formula.

Plaque assay

The RSV plaque reduction assay was performed on Hep-2 cells. This assay is typically used to quantitate the infectious virus by assessing the plaque forming units (PFU). For this assay, Hep-2 cells were seeded into 24-well dishes at a concentration of 2.5 × 105 cells per well. Confluent monolayers of cells were inoculated with 200 μL of virus suspensions (multiplicity of infection (MOI) was 5, 10, 15, 20) with or without cAgNPs at 37 °C. After 2 h incubation, the non-adherent virions and cAgNPs were removed and the cells were overlaid with 1.0 mL of RPMI 1640 medium supplemented with the final concentration of 2.5% FBS and 0.3% agar. After incubating for a week, the cells were fixed with 2.5% formaldehyde and stained with 0.05% neutral red solution.

Indirect immunofluorescence assay

The inhibitory effect of the cAgNPs on RSV infection was further evaluated by immunofluorescence. Twenty-four hours before infection, Hep-2 cells (1.0 × 105 cells) were cultured in 35 mm glass-bottom cell culture dishes (NEST. Corp.). RSV, RSV pre-treated with cAgNPs at 4 °C for an hour and the mixture of RSV and cAgNPs then infected the Hep-2 cells at 4 °C for 30 minutes. The other group was Hep-2 cells pre-incubated with cAgNPs for 1 h before RSV infection. After washing with PBS to remove non-adherent virions and cAgNPs, the cells were fixed in 4% paraformaldehyde for 30 minutes at room temperature. This step was followed by blocking with 2% bovine serum albumin for an hour at 37 °C. After blocking, the cells were incubated with the primary antibody (anti-RSV G protein) for 1.5 hours at 37 °C, followed by incubation with the secondary antibody (Dylight 488-conjugated goat anti-mouse IgG) for another 45 minutes at 37 °C. The last step was that cells were stained with Hoechst 33258 (1 μg mL−1) for 10 minutes at room temperature and washed three times with ice-cold PBS after each incubation step. Fluorescence images were acquired using an Olympus IX-81 inverted microscope equipped with an Olympus IX2-DSU confocal scanning system and a Rolera-MGi EMCCD. The image analyses were performed with Image-Pro Plus software.

Real-time PCR detection of IL-1β and IL-6 mRNA levels

Cells were harvested at 8 and 24 h after RSV infection at an MOI of 1 and the total RNA was extracted using the TRizol reagent according to the manufacturer's protocol. The integrity of the RNA was verified by 1% agarose electrophoresis and scanned with a gel imaging system. Then, RNA was reverse-transcribed into cDNA according to the manufacturer's recommendations of the iScript™ cDNA synthesis kit. Real-time PCR detection was performed using an iQ™ SYBR Green Supermix with a Bio-Rad iQ5 real-time PCR system. The PCRs were amplified under cycling conditions of: 95 °C for 5 min and 40 cycles (30 s at 95 °C, 30 s at 60 °C and 45 s at 72 °C) in triplicate. The sequences of primer pairs are listed in Table 1. The mRNA levels of IL-1β and IL-6 were semi-quantitatively determined and normalized to the expression of housekeeping gene β-actin.
Table 1 Primer pairs used in this study
Gene name Sequence
Forward Reverse
β-Actin CGCGAGAAGATGACCCAGATC CATGAGGTAGTCAGTCAGGTCCC
IL-1β CCCAGAGAGTCCTGTGCTGAATG GAGAGCTGACTGTCCTGGCTGAT
IL-6 AGCCCTGAGAAAGGAGACATG GCAAGTCTCCTCATTGAATCCAG


Statistical analysis

Experimental data were presented as the mean ± standard deviation (SD) of the mean. The t-tests (Excel, Prism 5 statistical and graphing software) were used for the data analysis. P < 0.05 was considered to indicate a statistically significant difference.

Results and discussion

Preparation and characterization of cAgNPs

The synthesis of AgNPs in solution usually contains three main components, namely, metal precursors, reducing agents and capping agents.48 However, reducing agents and organic solvents used in chemical reduction, such as hydration hydrazine and sodium borohydride, are highly reactive and pose potential environmental and biological risks.49 Our method to prepare uniform AgNPs only involves the use of curcumin and AgNO3 without organic solvents, and curcumin plays roles both as a reducing agent and capping agent.

The as-prepared cAgNPs were uniform and mono-disperse, and displayed a yellow brown color with a characteristic silver plasmon band at 410 nm in the UV-vis region (Fig. 1a), which have an average diameter about 11.95 ± 0.23 nm (Fig. 1b), analysed from the SEM image by counting 220 particles (Fig. 1c). High resolution transmission electron microscopy imaging showed that the lattice of the as-prepared cAgNPs is 0.23 nm and Ag atoms were mainly deposited on the {111} facets (Fig. 1d). Dynamic light scattering (DLS) measurements showed that the cAgNPs have a hydrodynamic diameter of 19.72 ± 0.54 nm (Fig. 1e) and a zeta-potential of −25.7 ± 0.7 mV (Fig. 1f).


image file: c5nr07918g-f1.tif
Fig. 1 Characterization of cAgNPs. UV/vis absorption spectrum of the cAgNPs (a) and size distribution of the silver nanoparticles as measured by SEM analysis and calculated with 220 particles (b). SEM images (c) and representative HRTEM images of cAgNPs (d) show the morphology of cAgNPs. The DLS data shows the size distribution (e) and the zeta-potential (f) of cAgNPs.

XPS spectra showed the generation of the zero valence state of silver in cAgNPs (Fig. 2a and b). The thermogram clearly indicated a strong enhancement in the thermal stability compared to curcumin only (Fig. 2c). FTIR spectra showed that both curcumin and cAgNPs have different functional groups, except for phenolic hydroxyl and methoxy groups (–OCH3). As Fig. 2d shows, the absorption peaks at 3240 cm−1, the stretching vibration of phenolic hydroxyl groups, and 2920 cm−1, the asymmetric C–H stretching of –OCH3 groups, appear either in curcumin or cAgNPs, indicating that the synthetic reaction of cAgNPs does not involve the phenolic hydroxyl and the methoxy groups. Since the phenolic hydroxyl groups might play important roles in the curcumin's anti-oxidant, anticancer activity and radicals scavenging,50,51 indicating that phenolic hydroxyl groups of the curcumin on the surface of the as-prepared cAgNPs might also play an important role in the antiviral activity. On the other hand, the absorption peak at 1627 cm−1 in curcumin, owing to a contemporaneous contribution of C[double bond, length as m-dash]C and C[double bond, length as m-dash]O stretching mode, shifted to 1635 cm−1 in cAgNPs, while the strong absorption peaks at 1149 cm−1 and 1276 cm−1, which was assigned to the enol C–O peak of pure curcumin, disappeared in cAgNPs, but appeared at 1381 cm−1 probably due to the binding of Ag with the C[double bond, length as m-dash]O group of the curcumin. The FTIR data showed that the as-prepared AgNPs were capped with curcumin successfully and functionalised with the C[double bond, length as m-dash]O group.


image file: c5nr07918g-f2.tif
Fig. 2 The XPS of as-prepared cAgNPs (a and b), TGA (c) and the FTIR (d) spectrum of curcumin and cAgNPs.

Stability and cytotoxicity test

To investigate the stability of cAgNPs in the biological environment and its toxicity, the ultraviolet spectrum was used for identifying the stability of cAgNPs in Hep-2 cell-culture medium (RPMI 1640) and the CCK-8 cell viability assay was used to investigate the cytotoxicity of cAgNPs in vitro. Fig. 3 shows that the cAgNPs have benign solubility and stability in the cell culture medium (RPMI 1640). By contrast, the conventional silver nanoparticles capping with citric acid are unstable and quite easy to aggregate in the RPMI 1640 solutions, and the characteristic absorption peak of AgNPs at 400 nm gets disappeared.
image file: c5nr07918g-f3.tif
Fig. 3 Comparison of the stability of the cAgNPs and the AgNPs capped with citric acid in RPMI 1640 (RPMI 1640 was used in the RSV adsorption steps).

Fig. 4 shows that the cAgNPs had very low toxicity since the cell viability was more than 95% under all test conditions (Fig. 4, the left column). The AgNPs obtained with citric acid, however, showed apparent cytotoxicity with cell co-incubation for 72 h when its concentration was 0.12 nM and 0.24 nM (Fig. 4, the right column). That is to say, the non-toxic concentrations of AgNPs obtained with citric acid to Hep-2 cells are far less than that of cAgNPs, indicating that our newly prepared cAgNPs are safer and more stable than the AgNPs capped with citric acid in a biological environment. The curcumin alone also showed low toxicity to Hep-2 cells (Fig. S1).


image file: c5nr07918g-f4.tif
Fig. 4 Biocompatibility of cAgNPs (the left column) and AgNPs capped with citric acid (the right column) with Hep-2 cells. Hep-2 cells were exposed to cAgNPs or AgNPs capped with citric acid for 24, 48 and 72 hours. The concentration of cAgNPs and AgNPs capped with citric acid were 0.008, 0.015, 0.03, 0.06, 0.12, 0.24 nM. Each experiment performed was in triplicate, the error bar represents the standard deviation, *P < 0.05 vs. control.

Interaction of cAgNPs with RSV

The interaction between nanoparticles and virus mainly includes inactivating the virus directly, blocking viral entry into the cells, and interfering with viral replication and budding.4,8,12,15,23,52 Each stage of virus infection maybe a possible target for inhibition. To understand the antiviral mechanism of cAgNPs involved in RSV, we should first identify whether or not there are direct interactions between cAgNPs and RSV. The dynamic light scattering (DLS) measurements (Table 2) showed that the mean size of cAgNP pre-treated RSV was about 200 nm, which was much larger than cAgNPs and RSV alone. The possible reason might be the direct attachment of cAgNPs to the viral envelop glycoproteins.
Table 2 DLS measurements of nanoparticles in solution
  Size ± SD (nm)
DLS measurements of cAgNPs and virus alone, cAgNPs incubated with RSV for 1 hour with average size.
cAgNPs 13.69 ± 0.05
RSV 122.90 ± 3.53
cAgNPs + RSV 193.57 ± 14.85


In such cases, we could suppose that the infectivity of RSV would get reduced if RSV first interacts with cAgNPs. In order to identify that, the photo images of cytopathic effects (CPE) were investigated to observe the impact on virus infectivity. As Fig. 5 shows, no CPE was found in the control group (Fig. 5a), but obvious syncytia formation was observed and some infected cells began to die in the group of Hep-2 cells infected with RSV alone (Fig. 5b). If RSV was pre-treated with cAgNPs for 1 h prior to infection, however, significant CPE was scarcely found (Fig. 5c). These results suggested that cAgNPs interacted with the viral envelope glycoproteins directly and interfered with the infectivity of RSV. This comparison also indicated that the viral titers of RSV might be decreased.


image file: c5nr07918g-f5.tif
Fig. 5 The cytopathic effect (CPE) result of Hep-2 cells infected with untreated and cAgNPs treated RSV. The mock Hep-2 cells (a) exhibit no CPE. An obvious CPE is observed in the group of the Hep-2 cells infected with RSV (b). The Hep-2 cells infected with cAgNPs inactivating RSV (c) (cAgNPs incubated with RSV for 1 h prior to infect Hep-2 cells) rarely show CPE (the virions and cAgNPs were removed after viral adsorption).

Antiviral activity of cAgNPs against RSV infection

The reduction of the viral titers of RSV could be further identified by the TCID50 assay, and the change of the viral titers of RSV after treating with different concentrations of cAgNPs could be quantitatively measured. Fig. 6a shows the viral titers of RSV pre-treated with cAgNPs. The viral titers of RSV were decreased significantly because cAgNPs might attach to the virions and inactivate RSV directly. For comparison, the ability of AgNPs capped with citric acid (synthesized with conventional method) to inactivate RSV was examined under the same experimental conditions (Fig. 6b). Both cAgNPs and AgNPs capped with citric acid had a significant reduction in viral titers, but the reduction of the viral titers of RSV pre-treated with cAgNPs was much better (Fig. 6c). It was found that the cAgNPs could decrease two orders of magnitude in viral titers, whereas the AgNPs only get decreased by one order of magnitude in viral titers to the greatest extent. In order to highlight the advantages of cAgNPs, we investigated the antiviral activity of curcumin (Fig. S2 and Table S1). The reduction of the viral titers caused by curcumin was not as much as that caused by cAgNPs. From these results, we could conclude that the antiviral activity of cAgNPs was better than that of AgNPs capped with citric acid and that of curcumin. This might be owing to the benign properties of both AgNPs and curcumin. So the cAgNPs might be an excellent virus inactivating agent against RSV infection.
image file: c5nr07918g-f6.tif
Fig. 6 Antiviral properties of curcumin-AgNPs (cAgNPs) and AgNPs capped with citric acid (obtained with conventional method). The viral titers of RSV pre-treated with cAgNPs (a); the viral titers of RSV pre-treated with AgNPs capped with citric acid (b); the comparison of the two kinds of AgNPs antiviral ability (c). TCID50 mL−1(C0) stands for the viral titers of RSV without nanoparticles; TCID50 mL−1(C) stands for the viral titers of RSV pre-treated with nanoparticles, C is the concentration of nanoparticles correspondingly.

To establish the multifunctional usage of cAgNPs during the different stages of RSV infection, other different treatments were used for the addition of cAgNPs to Hep-2 cells: (1) incubation with cells for 1 h before RSV infection (cell pre-treatment assay), (2) after virus adsorption for 1 h (cell post-treatment assay). As Fig. S3 shows, the viral titers of the harvest virus decreased to some extent both in the cell pre-treatment assay and in the cell post-treatment assay. These findings might illustrate that cAgNPs could prevent the virus from entering into cells and its replication to some extent.

The above results imply that cAgNPs indeed possess efficient antiviral activity against RSV infection. From the present study it was observed that cAgNPs significantly inhibited RSV infection by inactivating RSV directly prior to entry into the cells. Moreover, cAgNPs were able to reduce virus infectivity when added before RSV infection or after RSV infection to some extent. But the reduction in viral titers of the cell pre-treatment assay and cell post-treatment assay was not as effective as that of the virus pre-treatment assay. This showed that the main antiviral activity of cAgNPs was the direct inactivation of RSV.

Plaque assay

The plaque assay was performed to further identify the inhibition effects of cAgNPs against RSV. From the results (Fig. 7), we could observe that the plaque quantity increased significantly with increase in the MOI of RSV. By contrast, the plaque quantity of the group which RSV was interacting with cAgNPs prior to infecting Hep-2 cells was obviously less than the group that was infecting with RSV only under the same experimental conditions. In the control group, there was no plaque appearing at the well of the cells without RSV. The pictures show that the cAgNPs exhibit benign antiviral response to RSV intuitively.
image file: c5nr07918g-f7.tif
Fig. 7 Plaque-reduction assay using Hep-2 cells infected with different MOI of RSV. The first column showed the Hep-2 cells infected by RSV. The second column was that RSV interacted with cAgNPs at 4 °C for an hour prior to infect the Hep-2 cells.

Immunofluorescence assay of cAgNP–RSV interaction

The indirect immunofluorescence assay with virus antibody was proved to be a very useful diagnostic technique.53 Monoclonal antibody specific to G protein of RSV and Dylight 488-labeled goat anti-mouse IgG were employed herein to observe the interaction between cAgNPs and RSV through fluorescence microscopy. As Fig. 8 shows, the nuclei were stained with Hoechst 33258 (blue) and the RSV G proteins were marked with green color. The control did not have any green fluorescence (the first row in Fig. 8), while Hep-2 cells infected by RSV only had obvious green fluorescence around the cell membrane (the second row in Fig. 8). When Hep-2 cells were pre-treated with cAgNPs before RSV infection, the green fluorescence could be observed. But the fluorescence intensity was slightly weaker than that in the RSV-infecting group (the third row in Fig. 8), indicating that cAgNPs could only prevent RSV from adsorbing into cells to a small extent. This result was consistent with the outcome of the viral titer assay (Fig. S3). The green fluorescence could not be observed for those Hep-2 cells infected with cAgNP pre-treated RSV (the fourth row in Fig. 8). When the Hep-2 cells were infected with RSV in the presence of cAgNPs, the green fluorescence was weaker than that in the RSV-infected group (the fifth row in Fig. 8), indicating that cAgNPs could block the viral attachment. These results further demonstrate the efficient antiviral activity of cAgNPs against RSV infection. And we concluded that the cAgNPs played an effective role in inactivating RSV prior to entry into the cells. Meanwhile, the cAgNPs could block RSV attachment and prevent the RSV from infecting the cells to a small extent.
image file: c5nr07918g-f8.tif
Fig. 8 The inhibition effects of cAgNPs against RSV by immunofluorescence staining (60× oil immersion objective). The first row showed the Hep-2 cells only, and the second row showed the Hep-2 cells infected by RSV. The third row was that the Hep-2 cells pre-incubated with cAgNPs for 1 h before RSV infection. The fourth row was that RSV interacted with cAgNPs for 1 h prior to infect the Hep-2 cells. The fifth row was that Hep-2 cells co-incubated with RSV and cAgNPs.

Gene expression assay of cAgNP–RSV interaction

IL-1β and IL-6 are important cytokines which could be detected in RSV-infected respiratory epithelial cell cultures in vitro.53 To further examine the inhibition of cAgNPs against the RSV, we screened the gene expression of IL-1β and IL-6 using real-time quantitative PCR in RSV infected Hep-2 cells with or without cAgNPs. As shown in Fig. 9, the gene expression levels of IL-1β and IL-6 were lower than the control group at the early stage of RSV infection, while the levels of IL-1β and IL-6 got increased significantly at 24 h after being infected with RSV. In Hep-2 cells infected with RSV without cAgNPs, extremely significant upregulation of IL-1β and IL-6 was observed compared to the control group. While in Hep-2 cells infected with RSV pre-treated by cAgNPs, downregulation of IL-1β and IL-6 was observed compared to the cells with RSV infection only, indicating that cAgNP pre-treated RSV could decrease the cell responses to RSV infection. At the same time, no significant difference of the expression of these cytokines was observed in the group of Hep-2 cells treated with cAgNPs only. These results indicated that the cAgNPs really possess significant anti-RSV activity.
image file: c5nr07918g-f9.tif
Fig. 9 The mRNA expressions of IL-1β and IL-6 in Hep-2 cells after RSV infection with or without cAgNPs. Hep-2 cells were incubated with RSV or cAgNPs pre-treated RSV, and cells were harvested at 8 and 24 h after infection for total RNA extraction. Untreated cells as control and β-actin served as an internal reference. Date were expressed as mean ± SD (n = 3).

Conclusions

In conclusion, we investigated that silver nanoparticles functionalized by curcumin have remarkable antiviral activity against RSV infection for the first time. The cAgNPs were uniform, stable, mono-disperse, and had fine bioavailability. The cAgNPs could reduce CPE induced by RSV and showed efficient antiviral activity against RSV infection by directly inactivating the virus prior to entry into the host cells. Moreover, cAgNPs exhibited antiviral activity when incubated before, simultaneously or after with the onset of viral infection to some extent. Compared with the conventional silver nanoparticles capped with citric acid, the cAgNPs were more stable in the physiological environment and possessed better antiviral properties. More pharmacodynamics and toxicological studies of cAgNPs in appropriate animal models would be needed for future investigations. According to our results, curcumin-AgNPs might have potential to be developed as a promising virucide for RSV.

Acknowledgements

This work was financially supported by the National Natural Science Foundation of China (NSFC, 21535006), the National Basic Research Program of China (973 Program, no. 2011CB933600) and the Postdoctoral Science Foundation of Chongqing (no. xm2014001).

Notes and references

  1. P. K. Jain, X. Huang, I. H. El-Sayed and M. A. El-Sayed, Acc. Chem. Res., 2008, 41, 1578–1586 CrossRef CAS PubMed.
  2. N. Sanvicens and M. P. Marco, Trends Biotechnol., 2008, 26, 425–433 CrossRef CAS PubMed.
  3. I. Papp, C. Sieben, K. Ludwig, M. Roskamp, C. Böttcher, S. Schlecht, A. Herrmann and R. Haag, Small, 2010, 6, 2900–2906 CrossRef CAS PubMed.
  4. D. Baram-Pinto, S. Shukla, A. Gedanken and R. Sarid, Small, 2010, 6, 1044–1050 CrossRef CAS PubMed.
  5. B. M. DeRussy, M. A. Aylward, Z. Fan, P. C. Ray and R. Tandon, Sci. Rep., 2014, 4, 5550 CAS.
  6. M. Sametband, S. Shukla, T. Meningher, S. Hirsh, E. Mendelson, R. Sarid, A. Gedanken and M. Mandelboim, MedChemComm, 2011, 2, 421–423 RSC.
  7. J. Vonnemann, C. Sieben, C. Wolff, K. Ludwig, C. Bottcher, A. Herrmann and R. Haag, Nanoscale, 2014, 6, 2353–2360 RSC.
  8. T. E. Antoine, Y. K. Mishra, J. Trigilio, V. Tiwari, R. Adelung and D. Shukla, Antiviral Res., 2012, 96, 363–375 CrossRef CAS PubMed.
  9. M. Sametband, I. Kalt, A. Gedanken and R. Sarid, ACS Appl. Mater. Interfaces, 2013, 6, 1228–1235 Search PubMed.
  10. J. J. Liang, J. C. Wei, Y. L. Lee, S. H. Hsu, J. J. Lin and Y. L. Lin, J. Virol., 2014, 88, 4218 CrossRef PubMed.
  11. L. A. Osminkina, V. Y. Timoshenko, I. P. Shilovsky, G. V. Kornilaeva, S. N. Shevchenko, M. B. Gongalsky, K. P. Tamarov, S. S. Abramchuk, V. N. Nikiforov, M. R. Khaitov and E. V. Karamov, J. Nanopart. Res., 2014, 16, 2430 CrossRef.
  12. S. Galdiero, A. Falanga, M. Vitiello, M. Cantisani, V. Marra and M. Galdiero, Molecules, 2011, 16, 8894–8918 CrossRef CAS PubMed.
  13. N. Wang, B. Hu, M.-L. Chen and J.-H. Wang, Nanotechnology, 2015, 26, 195703–195711 CrossRef PubMed.
  14. J. L. Elechiguerra, J. L. Burt, J. R. Morones, A. Camacho-Bragado, X. Gao, H. H. Lara and M. J. Yacaman, J. Nanobiotechnol., 2005, 3, 6–16 CrossRef PubMed.
  15. H. H. Lara, N. V. Ayala-Nunez, L. Ixtepan-Turrent and C. Rodriguez-Padilla, J. Nanobiotechnol., 2010, 8, 1 CrossRef PubMed.
  16. D. K. Singh and H. t. H. Lara, Retrovirology, 2012, 9, O1 CrossRef.
  17. D. Xiang, Q. Chen, L. Pang and C. Zheng, J. Virol. Methods, 2011, 178, 137–142 CrossRef CAS PubMed.
  18. Y. Mori, T. Ono, Y. Miyahira, V. Q. Nguyen, T. Matsui and M. Ishihara, Nanoscale Res. Lett., 2013, 8, 93 CrossRef PubMed.
  19. J. V. Rogers, C. V. Parkinso, Y. W. Choi, J. L. Speshock and S. M. Hussain, Nanoscale Res. Lett., 2008, 3, 129–133 CrossRef.
  20. N. Chen, Y. Zheng, J. Yin, X. Li and C. Zheng, J. Virol. Methods, 2013, 193, 470–477 CrossRef CAS PubMed.
  21. J. L. Speshock, R. C. Murdock, L. K. Braydich-Stolle, A. M. Schrand and S. M. Hussain, J. Nanobiotechnol., 2010, 8, 19 CrossRef PubMed.
  22. D. Baram-Pinto, S. Shukla, N. Perkas, A. Gedanken and R. Sarid, Bioconjugate Chem., 2009, 20, 1497–1502 CrossRef CAS PubMed.
  23. P. Orlowski, E. Tomaszewska, M. Gniadek, P. Baska, J. Nowakowska, J. Sokolowska, Z. Nowak, M. Donten, G. Celichowski, J. Grobelny and M. Krzyzowska, PLoS One, 2014, 9, e104113 Search PubMed.
  24. L. Lu, R. W. Y. Sun, R. Chen, C. K. Hui, C. M. Ho, J. M. Luk, G. K. K. Lau and C. M. Che, Antiviral Ther., 2008, 13, 253–262 CAS.
  25. N. Khandelwal, G. Kaur, N. Kumar and A. Tiwari, Dig. J. Nanomater. Bios., 2014, 9, 175–186 Search PubMed.
  26. W. Wu, J. Shen, P. Banerjee and S. Zhou, Biomaterials, 2011, 32, 598e609 Search PubMed.
  27. K. I. Priyadarsini, J. Photochem. Photobiol., C, 2009, 10, 81–95 CrossRef CAS.
  28. Bhawana, R. K. Basniwal, H. S. Buttar, V. K. Jain and N. Jain, J. Agric. Food Chem., 2011, 59, 2056–2061 CrossRef CAS PubMed.
  29. D. K. Singh, R. Jagannathan, P. Khandelwal, P. M. Abraham and P. Poddar, Nanoscale, 2013, 5, 1882–1893 RSC.
  30. K. Obata, T. Kojima, T. Masaki, T. Okabayashi, S. Yokota, S. Hirakawa, K. Nomura, A. Takasawa, M. Murata, S. Tanaka, J. Fuchimoto, N. Fujii, H. Tsutsumi, T. Himi and N. Sawada, PLoS One, 2013, 8, 70225–70239 Search PubMed.
  31. P. Anand, A. B. Kunnumakkara, R. A. Newman and B. B. Aggarwal, Mol. Pharm., 2007, 4, 807–818 CrossRef CAS PubMed.
  32. M. Donalisio, M. Rusnati, V. Cagno, A. Civra, A. Bugatti, A. Giuliani, G. Pirri, M. Volante, M. Papotti, S. Landolfo and D. Lembo, Antimicrob. Agents, 2012, 56, 5278–5288 CrossRef CAS PubMed.
  33. S. Krishnan, M. Halonen, S. R. Robert and C. Welliver, Viral Immunol., 2004, 17, 220–233 CrossRef CAS PubMed.
  34. S. S. Bawage, P. M. Tiwari, S. Pillai, V. Dennis and S. R. Singh, Adv. Virol., 2013, 2013, 595768 Search PubMed.
  35. W. Zhang, E. Moore and R. A. Tripp, Future Microbiol., 2009, 4, 279–297 CrossRef PubMed.
  36. M. T. Lotz and R. S. P. L. Jr, Curr. Allergy. Asthma. Rep., 2012, 12, 380–387 CrossRef CAS PubMed.
  37. S. M. Bueno, P. A. González, C. A. Riedel, L. J. Carreno, A. E. Vásquez and A. M. Kalergis, Immunol. Lett., 2011, 136, 122–129 CrossRef CAS PubMed.
  38. J. Harris and D. Werling, Cell. Microbiol., 2003, 5, 671–680 CrossRef CAS PubMed.
  39. L. L. Zheng, X. X. Yang, Y. Liu, X. Y. Wan, W. B. Wu, T. T. Wang, Q. Wang, S. J. Zhen and C. Z. Huang, Chem. Commun., 2014, 50, 15776–15779 RSC.
  40. L. Zhan, W. B. Wu, X. X. Yang and C. Z. Huang, New J. Chem., 2014, 38, 2935–2940 RSC.
  41. L. Zhan, C. M. Li, W. B. Wu and C. Z. Huang, Chem. Commun., 2014, 50, 11526–11528 RSC.
  42. W. Wang, L. Zhan, Y. Q. Du, F. Leng, Y. Chang, M. X. Gao and C. Z. Huang, Anal. Methods, 2013, 5, 5555–5559 RSC.
  43. Y. Q. Du, P. F. Gao, W. Wang, T. T. Wang, Y. Chang, J. Wang and C. Z. Huang, Analyst, 2013, 138, 5745–5750 RSC.
  44. X. Y. Wan, L. L. Zheng, P. F. Gao, X. X. Yang, C. M. Li, Y. F. Li and C. Z. Huang, Sci. Rep., 2014, 4, 4529 Search PubMed.
  45. L. Sun, A. K. Singh, K. Vig, S. R. Pillai and S. R. Singh, J. Biomed. Nanotechnol., 2008, 4, 149–158 CAS.
  46. C. M. Li, L. L. Zheng, X. X. Yang, X. Y. Wan, W. B. Wu, S. J. Zhen, Y. F. Li, L. F. Luo and C. Z. Huang, Biomaterials, 2016, 77, 216–226 CrossRef CAS PubMed.
  47. D. Steinigeweg and S. Schlücker, Chem. Commun., 2012, 48, 8682–8684 RSC.
  48. L. Wei, J. Lu, H. Xu, A. Patel, Z. Chen and G. Chen, Drug Discovery Today, 2015, 20, 595–601 CrossRef CAS PubMed.
  49. M. Murphy, K. Ting, X. Zhang, C. Soo and Z. Zheng, J. Nanomater., 2014, 2015 Search PubMed.
  50. K. K. Soudamini and R. Kuttan, J. Ethnopharmacol., 1989, 27, 227–233 CrossRef CAS PubMed.
  51. J. R. Fuchs, B. Pandit, D. Bhasin, J. P. Etter, N. Regan, D. Abdelhamid, C. Li, J. Lin and P.-K. Li, Bioorg. Med. Chem. Lett., 2009, 19, 2065–2069 CrossRef CAS PubMed.
  52. J. Trigilio, T. E. Antoine, I. Paulowicz, Y. K. Mishra, R. Adelung and D. Shukla, PLoS One, 2012, 7, e48147 CAS.
  53. X. Lv, P. Wang, R. Bai, Y. Cong, S. Suo, X. Ren and C. Chen, Biomaterials, 2014, 35, 4195–4203 CrossRef CAS PubMed.

Footnote

Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr07918g

This journal is © The Royal Society of Chemistry 2016