Protein engineering of a new recombinant peptide to increase the surface contact angle of stainless steel

Abstract

Biofouling seriously affects the properties and service life of metal materials. A number of studies have shown that the initial bacterial attachment to the metal surface and the subsequent formation of biofilm are dependent on the surface characteristics of the substratum, including metal surface free energy, roughness and metallurgical features. In this study, a novel recombinant fusion protein, which consists of receptor binding domain protein (RBD), truncated protein fragment of MrpF and alkaline phosphatase (PhoA) domains, has been constructed in an attempt to increase the surface contact angle of stainless steel. It has been confirmed that RBD has a strong affinity to 304 stainless steel; the truncated protein fragment of MrpF has high hydrophobicity and anchoring features, which can improve the contact angle of the material surface, whilst PhoA is an effective detection tool to monitor the expression and secretion of fusion protein. Multiple assays including FTIR, XPS, SEM-EDS and contact angle measurement revealed the existence of nitrogen and sulfur elements, binding energy shifts of nitrogen, carbon and oxygen atoms, and new FTIR peaks in treated stainless steel samples with increased contact angles at about 50°, confirming that a new organic steel material has been produced responding to these surface property changes. Using novel recombinant peptides to react with steel could become a new technique to increase the surface contact angle of the stainless steel for diverse applications.

---

1. Introduction

Sections of ships under the marine waterline which are immersed in seawater for a long time frequently have adhesive bacteria and/or bacillariophyta, etc. adhering to them. This process leads to the formation of biofilm. The biofilm then attracts a large number of fouling organisms, resulting in adhered fouling on the surface of the metal.¹ According to incomplete statistics, the damage caused by biofouling can reach tens of billions of dollars a year due to the increase in ship drag, for example.²

Biofouling starts with the formation of the biofilm. If the early evolution of the biofilm is prevented, adhesion of subsequent macrofauna will also be prevented, therefore, increasing attention has recently been paid to altering the surface properties of material surfaces via surface modification.^3,4

The initial bacterial attachment to the metal surface and the subsequent formation of biofilm are dependent on the surface characteristics of the substratum, including the surface free energy, roughness, as well as metallurgical features.⁵ Thus, attaining a low surface energy and adhesive force by surface modification has become a widely acceptable strategy to combat the formation of biofilms. Many pure natural extracts with antifouling biological properties have been investigated, and the extracts contain organic acid, inorganic acid, lactones, terpenoids, protein, polypeptide, sugar, fat and alkaloids, etc.⁶

It has recently been found that a receptor binding domain (RBD) displaying at type IV pili (T4P) of Pseudomonas aeruginosa (PA), consisting of a semi-conserved 17-amino acid region that includes an intra-chain disulfide loop, has an extremely high affinity for stainless steel. This RBD can alter the physical/chemical attributes of untreated 304 stainless steel. The reaction product of RBD with regular 304 stainless steel has been shown to significantly reduce the adhesive force, increase electron work function, and increase the hardness of the steel.⁷

MrpF is part of the Mrp operon in basophilic bacteria. Its gene length is about 282 bp, coding the protein with 94 amino acids. From computer prediction, it has been found that MrpF is simple in structure. It contains three transmembrane helices and has hydrophobic characteristics. In previous research, a truncated protein fragment of MrpF has been shown to still retain the properties of hydrophobicity and anchoring.⁸ The fusion protein can anchor to the cell membrane using the truncated protein fragment of MrpF, and, interestingly, this anchoring force is relatively weak so that extraction of the fusion protein is relatively easy.⁹ Hence, the cells do not need to be broken to extract the fusion protein and the extracting protein solution will have fewer impurities.

Alkaline phosphatase (PhoA) is an enzyme which is commonly used as a tool in genetic engineering. It has been widely used in pharmaceutical production, cosmetics manufacturing, disease detection, etc.¹⁰ PhoA from E. coli is a secreted protein that is usually found in the periplasmic space of E. coli. One end of the PhoA sequence has a signal peptide. The membrane transport proteins can identify this signal peptide and secrete the PhoA into the periplasmic space. In this process, the signal peptide is usually cleaved and only the PhoA which is present in the periplasmic space has biological activity.¹¹ Therefore, by inserting the PhoA sequence into targeted fusion protein and detecting alkaline phosphatase activity, the expression and secretion of the targeted fusion protein can be preliminarily monitored.

In this study, we are specifically interested in the design and production of a novel fusion protein from the truncated MrpF fragment, RBD with type IV pili (T4P) of Pseudomonas aeruginosa and PhoA of E. coli by genetic recombination. We hypothesize that the new fusion protein will not only have high affinity to metal, but also strong hydrophobicity. The protein reacting with stainless steel by a previously unreported type of chemical interaction will generate an altered form of stainless steel, defined as bioorganic stainless steel. Thus, the contact angle of the new bioorganic stainless steel could be higher than the untreated 304 stainless steel.

2. Materials and methods

2.1 Vector design

To construct the plasmid vector for RBD-MrpF recombinant protein production, template plasmid pYC[PhoA-MrpF(L11)] (pYC) was used following the previous reported method⁹ (Fig. 1A). Generation of the plasmid pXY[RBD-PhoA-MrpF(L11)] (RPM) (Fig. 1B) was achieved by reverse transcription PCR (RT-PCR) using primers PPSR and PPSF (Table 1). In plasmid pXY[RBD-PhoA-MrpF(L11)], the RBD gene was inserted into pMAL-p4x between PhoA signal peptide and the rest of PhoA sequence. Another plasmid pXY[PhoA-RBD-MrpF(L11)] (PRM) (Fig. 1C) was generated by RT-PCR using primers PPFR and PPFF (Table 1). In the plasmid PRM, the RBD gene was inserted into pMAL-p4x between PhoA and MrpF instead of SacI.

Fig. 1 Schematic diagrams of plasmids for constructing the vectors of recombinant protein. (A) Plasmid pYC[PhoA-MrpF(L11)], the template plasmid. (B) Plasmid pXY[RBD-PhoA-MrpF(L11)], in which the RBD gene was inserted into pMAL-p4x between PhoA signal peptide and the rest of PhoA sequence. (C) Plasmid pXY[PhoA-RBD-MrpF(L11)], in which the RBD gene was inserted into pMAL-p4x between PhoA and MrpF instead of SacI.

Table 1 Primers used in this study

Primers	Sequence 5′-3′	Applications
PPSF	gataacaaatatctgccgaaaacctgccagacccggacaccagaaatgcctg	RT-PCR primer for RPM
PPSR	cggcagatatttgttatccgcgttgctggtgcacgcggcttttgtcacagggg	RT-PCR primer for RPM
PPFF	gataacaaatatctgccgaaaacctgccagaccaacaacaacaacaataac	RT-PCR primer for PRM
PPFR	cggcagatatttgttatccgcgttgctggtgcacgctttcagccccagagcggc	RT-PCR primer for PRM
PhoA F2	gaccgaaagcaacgtacc	Screening and sequencing primer for PRM
PAR	tctggcaggttttcggcag	Screening primer for PRM
PAF	accagcaacgcggataac	Screening primer for RPM
Mal R1	agggggatgtgctgcaag	Screening primer for RPM
Mal promoter F	acttcaccaacaaggacc	Sequencing primer for RPM

---

In these plasmids, MrpF was the truncated protein fragment of MrpF. It still has the properties of hydrophobicity and anchoring. Because of its anchoring effect, the fusion protein can be anchored on the cell membrane; however, its sequence is shorter than the full length of MrpF, so its anchoring effect is weak and the fusion proteins can be peeled off from the membrane by weaker shocks. PhoA was used as a detection tool. It is a secreted protein that is usually found in the periplasmic space. If PhoA is secreted into the periplasmic space, it has enzymatic activity. Therefore, detecting alkaline phosphatase activity is used to preliminarily monitor the expression and secretion of the target fusion protein.

To confirm the structure of the new vector, screening PCR was conducted using primers PAF and mal R1 for RPM and primers PhoA F2 and PAR for PRM (Table 1). DNA sequencing was performed by Sangon Biotech (Shanghai) Co., Ltd. The construct was transformed into E. coli strain BL21 (DE3) (from the Laboratory of Living Material, Wuhan University of Technology) to express recombinant proteins. Primer PhoA F2 was the sequencing primer for PRM and primer mal promoter F was the sequencing primer for RPM. Table 1 lists all PCR primers used in this study.

2.2 Cell growth and expression of recombinant protein

A single colony of E. coli BL21 (DE3) harboring expression vectors was inoculated into Luria–Bertani medium containing 100 μg ml⁻¹ ampicillin and shaken at 37 °C overnight. The cell suspension was inoculated into M9 medium at a ratio of 1 : 50, cultured by shaking at 37 °C until the optical density (OD) at 600 nm (OD600) reached 0.4–0.8. Protein expression was initiated by adding 1 mM growth repressor, isopropyl-β-D-thiogalactoside (IPTG), and continuing shaking at 25 °C. After 3 h induction, the cell suspension was sampled to assay the enzymatic activity and the remaining cell suspension was harvested by centrifugation at 5000g for 10 min.

2.3 Extraction of recombinant protein and its analysis

The recombinant proteins were extracted by osmotic shock. Osmotic shock was based on a previously reported method.¹² Cells were resuspended in buffer A (20% sucrose, 50 mM Tris–HCl, pH 8.0), followed by shaking at room temperature for 10 min, then centrifuged at 8000g for 5 min. The pellet was resuspended in ice water and shaken in an ice bath for 10 min. The suspension was centrifuged at 12000g for 10 min at 4 °C. The supernatant was collected for further analysis and use. In order to maximize the extraction yield, the precipitation was carried out through two osmotic shock cycles. The two extracted protein solutions were pooled for further protein quantification and reaction with 304 stainless steel.

In order to preliminarily assess whether the fusion protein was expressed, its enzymatic activity was examined. The PhoA activity assay for cells treated with chloroform and SDS was based on a previously reported method.¹³ Cells were washed with PBS and resuspended in buffer B (1 M Tris–HCl, pH 8.0, 0.1 mM ZnCl₂). Equal volumes of chloroform and 0.1% SDS were added into the cell suspension, and incubated at 37 °C for 5 min to permeate the cells. Then, the cell suspension was diluted with buffer B until OD600 was between 0.1 and 0.2. After 0.4% p-nitrophenyl phosphate had been added, the cell suspension was incubated at 37 °C for 10 min. OD405 and OD550 were monitored after that. PhoA activity was calculated using formula (1):

To determine whether the extracted protein solution contained the fusion protein and whether the fusion protein had biological activity, enzymatic activity detection was performed for the protein solution following the above procedure and protein activity was calculated using formula (1).

The recombinant protein samples were further analyzed via Coomassie blue SDS-PAGE gels. Protein concentration was measured by the Bradford method.

2.4 Preparation of the new biological organic metal material

Samples of 304 stainless steel (1 mm thick) were annealed at 1040 °C for 1 h, then cut into 1 cm × 1 cm coupons.⁷ The surface was polished using sandpaper of increasing grit size, from 120^# to 1200^#, on an automatic metallographic grinding and polishing machine. The coupons were washed with detergent, then rinsed with distilled water, and immersed in 95% (v/v) alcoholic solution for 15 min. They were then rinsed with distilled water, immersed in acetone for 1 min, and rinsed with distilled water. The coupons were then placed in six-well cell culture plates (1 coupon per well), covered with 3 ml sterile phosphate-buffered saline (PBS) (pH 7.4) containing a range of concentrations of recombinant protein, where the final protein concentrations were 0.2 μg μl⁻¹ and 0.4 μg μl⁻¹. Then they were incubated at room temperature (RT) for 1 h with gentle agitation. After the reaction, the coupons were washed 6 times with distilled water and dried in air. The reacted sample was denoted as PRM steel.

2.5 Analysis of the biological organic metal material

To ensure that the recombinant peptides had reacted with the surface of the 304 stainless steels, Fourier transform infrared (FTIR) spectroscopy was used to detect the functional groups on PRM-steel samples in comparison to untreated steel samples with an attenuated total reflection (ATR) model on a Bruker Vertex 80 V FTIR spectrometer.

X-ray photoelectron spectroscopy (XPS) (AXIS-ULTRADLD-600 W, Shimadzu-Kratos, Japan) was used to examine the surface electron activity of PRM steel in comparison to untreated 304 stainless steel. The base pressure in the analytical chamber was less than 7 × 10⁻⁸ Pa. A monochromatic Al Kα source was used at a power of 450 W. The analysis spot was 300 × 700 μm, resolution of the instrument was 0.48 eV for Ag 3d 5/2 peak, and the scan step was 0.05 eV. XPS spectra were generated by XPS software within the instrument.

The surface morphology of the samples was examined with an S-4800 scanning electron microscope (SEM) (Hitachi, Ltd., Japan). The surface elemental analysis was determined by energy dispersive spectrometer (EDS). The primary electron beam voltage was 10 kV, and the probing beam current was 7 nA.

The contact angles of the samples were tested with an OCA35 contact angle measuring instrument (Data physics Instruments GmbH). Wettability refers to the degree of affinity of the solid surface and liquid, measured by the contact angle of a droplet on a solid surface. The droplet used in this study was 1 μl of distilled water.

In each test set, at least three repeat samples were used to rule out random effects.

2.6 Statistics

All quantitative measurements were conducted on at least three samples per group and data were expressed as means ± SEM. Groups were compared using independent t-tests. P-values ≤ 0.05 were considered statistically significant.

3 Results and discussion

3.1 Vector design

To determine whether the vector design was correct, screening PCR and gene sequencing were carried out. Screening PCR was conducted using primers PAF and mal R1 for RPM. The size of the amplification fragment was around 1500 bp in theory. The molecular weight of the amplification fragment from agarose gel electrophoresis was around 1500 bp and matched the theoretical molecular weight in Fig. 2, implying that the vector design was correct. Gene sequencing was also used to determine whether the vector sequence was correct. The recombinant cells were sequenced by Shanghai Biological Engineering Co., Ltd. The results of sequencing and comparison are shown in Fig. 3. The gene sequencing result was in accordance with the basic theory of the design sequence. Screening PCR using primers PhoA F2 and PAR for PRM and subsequent inspections showed the same structure. The size of the amplification fragment was around 600 bp in theory. The molecular weight of the amplification fragment from agarose gel electrophoresis was around 600 bp and matched the theoretical molecular weight in Fig. 4. The results of sequencing and comparison shown in Fig. 5 demonstrated high similarity. The above tests proved that the sequences of the two vectors were constructed correctly.

Fig. 2 Agarose gel electrophoresis results from screening the PCR products of RPM. The band in column 1 indicated by the arrow was the target product, showing the size of RPM was around 1500 bp.

Fig. 3 Results of gene sequencing and comparison for RPM. Rows marked ‘Target’ are theoretical sequences and rows marked ‘Sequencing’ are test sequences. The tested gene sequencing results were in accordance with the designed sequences.

Fig. 4 Agarose gel electrophoresis results from screening the PCR products of PRM. The band indicated by the arrow was the target product, showing the size of PRM was around 600 bp.

Fig. 5 Results of gene sequencing and comparison for PRM. Rows marked ‘Target’ are theoretical sequences and rows marked ‘Sequencing’ are test sequences. The tested gene sequencing results were in accordance with the designed sequences.

3.2 Expression of the recombinant peptide

In order to observe the growth of E. coli and the influence of isopropyl-β-D-thiogalactoside (IPTG) on the growth rate, the bacterial growth curves were measured. Fig. 6 and 7 show that bacteria grew steadily and IPTG suppressed the proliferation considerably after it was added.

Fig. 6 Growth curve for E. coli containing plasmid RPM. At 4 hours, IPTG was added (indicated by the arrow) and bacterial growth was restrained.

Fig. 7 Growth curve for E. coli containing plasmid PRM. At 4 hours, IPTG was added (indicated by the arrow) and bacterial growth was restrained.

3.3 Extraction and characterization of the recombinant protein and its analysis

Enzymatic activity of PhoA was assayed in whole cells permeabilized by chloroform/SDS and peptide solution treated with Tris–HCl (Fig. 8), respectively. It was found that the enzymatic activity of IPTG-induced E. coli cells containing PRM was higher than the uninduced E. coli cells. However, the enzymatic activity of IPTG-induced E. coli cells containing RPM was the same as uninduced E. coli cells and they did not have the enzymatic activity of PhoA. In addition, the enzymatic activity of peptide solution of PRM was higher than the E. coli cells. This indicated that the RPM did not express the protein whilst the PRM did successfully. Since PhoA only had enzymatic activity when it was expressed in the periplasmic space, and did not show activity when located inside the cell, the cell enzymatic activity of PhoA can be used to detect whether the recombinant protein is expressed in the periplasmic space. Equally, if the extracted protein solutions had the enzymatic activity of PhoA, this indicated that the protein solutions contained the recombinant protein.

Fig. 8 Enzymatic activity of the recombinant protein. Groups 1–3 were the enzymatic activities of RPM, and 4–6 were the enzymatic activities of PRM. 1 and 4 were uninduced whole cells; 2 and 5 were the induced whole cells; 3 and 6 were the extracted protein solutions.

Over-expressed recombinant proteins were confirmed via SDS PAGE analysis of total proteins from the cells and the extracted protein solutions (Fig. 9). The theoretical molecular weight of mature recombinant protein is about 57 kDa. Clearly, there was no band of RPM in the corresponding position (Fig. 9A). However, the molecular weight of recombinant protein PRM shown in SDS PAGE gel matched the theoretical molecular weight (Fig. 9B). This further evidence shows that the recombinant protein RPM could not be expressed and the recombinant protein PRM could be expressed successfully. As a result, the recombinant protein PRM was used for reaction and analysis in the subsequent experiments.

Fig. 9 SDS-PAGE analysis of IPTG-induced (+) or uninduced (−) cells harboring recombinant expression protein and the extracted protein in solutions. (A) SDS-PAGE analysis of whole cell protein harboring RPM vector; (B) SDS-PAGE analysis of extracted PRM protein solution and whole cell protein harboring PRM vector. The arrowheads indicate the targeted protein.

By testing and calculation based on the Bradford method, the yield of fusion protein from all culturing bacteria was between 11.9% and 16.8%.

3.4 Analysis of properties of biological organic metal material

After the recombinant protein PRM had reacted with 304 stainless steel, the changed properties of the new bioorganic steel, PRM-steel, were examined including the surface chemistry, contact angle, and topography, as a result of the peptide binding.

FTIR spectroscopy was used to identify new functional groups (Fig. 10). Comparing untreated 304 stainless steel (Fig. 10A) with the PRM-steel (Fig. 10B), multiple new peaks are present in the spectra. A small peak occurred around 3100 cm⁻¹, which may be due to NH– stretching; the peak around 1650 cm⁻¹ corresponded to C=O stretching; the peak near 1550 cm⁻¹ corresponded to C–N stretching or NH bending; the peak appearing near 3000 cm⁻¹ corresponded to CH saturated or unsaturated bond.¹⁴ To sum up, peptide associated bonds (–CO–NH–) have been detected in the surface of the PRM-steel when compared with untreated 304 stainless steel. Amide bonds are characteristic functional groups of the peptide, and they did not exist in untreated 304 stainless steel. Comparing PRM-steel (Fig. 10B) with the recombinant peptide solution (Fig. 10C), the same peaks were observed with slightly different intensities and peak shifting (Table 2). Fig. 10D shows the combined spectra from Fig. 10A–C for an easier comparison. This phenomenon may be caused by chemical reaction between the recombinant peptides and 304 stainless steel. The chemical reaction caused a small change in functional groups, which ensured that the recombinant peptide could react with stainless steel and firmly combine on the 304 stainless steel through chemical reaction.

Fig. 10 Fourier transform infrared spectra of the samples. (A) Untreated 304 stainless steel; (B) PRM-steel; (C) recombinant peptide in solution; (D) combined spectra.

Table 2 Comparison of the peak values between PRM-steel and PRM protein solution

Sample	PRM-steel	PRM solution
N–H stretching	3257 cm^−1	3358 cm^−1
C–N stretching	2927 cm^−1	2930 cm^−1
C=O stretching	1639 cm^−1	1656 cm^−1

---

In practice, the amide I band in FTIR is primarily used to assign secondary structures to proteins. The IR frequencies in the amide I region, diagnostic of protein secondary structures, are reported in Fig. 11. In the image, the FTIR of PRM-steel showed a peak around 1643 cm⁻¹. This was assigned to the random coil (RC) conformation, which demonstrated that the recombinant peptides adsorbed on the steel surface have strong secondary structures. Interestingly, the shape of the amide I peak was sensitive to the amount of peptide on the metal surface (Fig. 11).

Fig. 11 The FTIR spectra of the recombinant peptide absorbed on 304 stainless steel in the amide I region. The line with square symbols corresponds to PRM-steel samples reacting with 0.4 μg μl⁻¹ PRM solution. The line with star symbols corresponds to PRM-steel samples reacting with 0.2 μg μl⁻¹ PRM solution.

This further proved that the fusion peptide was chemically reacting with the 304 stainless steel by a previously unreported chemical interaction. Such an interaction that generates a new material would result in changes in the electronic state of the surface. To further characterize the chemical properties of PRM-steel, as well as to detect whether new bonding occurred and to identify which elements were involved in the interaction, XPS analysis was used to examine the electronic state of the elements on the surface of PRM-steel in comparison to 304 stainless steel. Spectral analysis of the iron, oxygen, sulfur, carbon and nitrogen demonstrated that the iron 2p 1/2 and 2p 3/2 orbitals did not appear to play an important role in bond formation and electron stabilization as no shifts were observed in the PRM-steel when compared to 304 stainless steel (Fig. 12A). An increase in the peak of the nitrogen 1s orbital of PRM-steel was observed compared to 304 stainless steel (Fig. 12B), with the PRM-steel nitrogen 1s peaking at 8500 counts per second (CPS) compared to 3800 CPS for 304 stainless steel, suggesting a role for nitrogen in bond formation. Similarly, an increase in the peak of the carbon 1s orbital of PRM-steel was observed compared to 304 stainless steel (Fig. 12C), with the PRM-steel carbon 1s peaking at 17 000 CPS compared to 12 000 CPS for 304 stainless steel, suggesting a role for carbon in bond formation. Simultaneously, electron shifts were found in the nitrogen 1s orbital and carbon 1s orbital of PRM-steel compared to 304 stainless steel (Fig. 12B and C). As a result, nitrogen and carbon play an important role in the formation of the bonds. No significant changes were observed in the spectra of the oxygen 1s and sulfur 2p 3/2 (Fig. 12D and E). The differences between the electronic states of nitrogen and carbon on the surface of PRM-steel and 304 stainless steel confirmed that PRM-steel was a new material that was chemically different from 304 stainless steel. The XPS spectra data supported the involvement of several elements in the formation of PRM-steel.

Fig. 12 XPS spectral analysis of elements in PRM-steel and 304 stainless steel. (A) Fe 2p 1/2 and 2p 3/2 orbitals, (B) N 1s orbital, (C) C 1s orbital, (D) O 1s orbital, (E) S 2p 3/2. XPS spectra of PRM-steel are plotted with triangle symbols while the XPS spectra of 304 stainless steel are plotted with square symbols.

The surface morphology samples were examined by standard scanning electron microscope (SEM) in combination with energy dispersive spectrometry (EDS) of 304 stainless steel, which detected the presence of the different surface elements, and the distribution of the elements nitrogen and sulfur. On the surface of 304 stainless steel (Fig. 13), nitrogen and sulfur were not detected, which indicated that the 304 stainless steel did not contain nitrogen or sulfur. In contrast, nitrogen and sulfur were present on the surface of PRM-steel (Fig. 14). The proportion of each element on the PRM-steel testified that nitrogen and sulfur exist on the PRM-steel surface (Fig. 14B). The presence of nitrogen and sulfur on PRM-steel surface, which are not normally components of steel surfaces, and the even distribution across the surface on the new PRM-steel surface (Fig. 14C and D) suggested that the recombinant protein PRM reacted chemically with 304 stainless steel, and the reaction was non-physical adsorption.

Fig. 13 Surface morphology, elemental analysis, and distribution of nitrogen and sulfur in the original 304 stainless steel. (A) Topographical scan of the surface. (B) Overall elemental analysis of elements on the surface. (C) Element scan of nitrogen. (D) Element scan of sulfur.

Fig. 14 Surface morphology, elemental analysis, and distribution of nitrogen and sulfur on the new bioorganic material, PRM-steel. (A) Topographical scan of the surface. (B) Overall elemental analysis of elements on the surface. (C) Element scan of nitrogen. (D) Element scan of sulfur.

The water wettability of the treated and untreated metal surfaces has been tested with the OCA35 automatic contact angle measuring instrument. Surfaces with a greater surface free energy were more easily infiltrated by some substances, and vice versa. The contact angle is used to measure the spreading capacity between the material surface and the liquid. Generally, a larger contact angle indicates that the affinity between the surface and the liquid is weak.¹⁵ In this report, the contact angle of the new bioorganic steel became larger than that of the original 304 stainless steel. Moreover, the concentration of recombinant protein participating in the reaction had an influence on the contact angle increase. The higher the protein concentration in the reaction, the higher the contact angle of the bioorganic metal surface (Fig. 15).

Fig. 15 Contact angle of the new bioorganic steel and regular 304 stainless steel. 304 is the sample of the original 304 stainless steel. PRMS0.2 is the PRM-steel samples reacting with 0.2 μg μl⁻¹ fusion protein solution. PRMS0.4 is the PRM-steel samples reacting with 0.4 μg μl⁻¹ fusion protein solution. **P < 0.001, 0.001 <*P < 0.05.

4. Conclusions

A smart fusion protein which has metal affinity and hydrophobicity was successfully constructed. Reaction of this new fusion protein with stainless steel under mild reaction conditions has resulted in the development of a new material, PRM-steel. Multiple assays have revealed that the new protein readily and spontaneously reacted with stainless steel, perhaps through the functional adhesion component in the T4P. The PRM-steel has significantly different properties compared with regular 304 stainless steel. At about 50°, the contact angles in PRM-steel were higher than in 304 stainless steel. Moreover, the concentration of recombinant protein participating in the reaction had an influence on the contact angle increase. The higher the protein concentration in the reaction, the higher the contact angle of the bioorganic metal surface. FTIR indicated the presence of characteristic functional amide groups in PRM-steel with shifted peak positions compared with the recombinant peptide, which supported the view that the recombinant peptide was involved in a chemical interaction with 304 stainless steel. The XPS spectral data for PRM-steel revealed that elemental nitrogen increased and the electron state changed, which further indicated that the fusion protein had reacted chemically with 304 stainless steel. All of these facts confirmed that a new bioorganic material had been generated.

The technique whereby a recombinant peptide bonds with 304 stainless steel to form a new material with altered attributes offers a new method to modify 304 stainless steel imparting increased contact angles. Optimization of the constructed recombinant protein can further increase the contact angle, which could eventually change the metal into a hydrophobic surface. Such alteration of the metal surface is through an environmentally friendly technique, which may support a green approach to antifouling.

Acknowledgements

This work was financially supported by the National Science Foundation of China (No. 51375355 and No. 51422507) and the Program of Introducing Talents of Discipline to Universities (B08031).

References

1. L. D. Chambers, K. R. Stokes, F. C. Walsh and R. J. K. Wood, Surf. Coat. Technol., 2006, 201, 3642.
2. A. S. Clare, D. Rittschof, D. J. Gerhart and J. S. Maki, Invertebr. Reprod. Dev., 1992, 22, 67.
3. D. X. Duan, J. Mar. Sci., 2011, 35, 107.
4. P.-Y. Qian, S. C. K. Lau, H.-U. Dahms, S. Dobretsov and T. Harder, Mar. Biotechnol., 2007, 9, 399.
5. H. H. P. Fang, L. C. Xu and K. Y. Chan, Water Res., 2002, 36, 4709.
6. A. S. Clare, Towards nontoxic antifouling, 1998, vol. 6, p. 3.
7. E. M. Davis, D. Li and R. T. Irvin, Biomaterials, 2011, 32, 5311.
8. T. H. Swartz, S. Ikewada, O. Ishikawa, M. Ito and T. A. Krulwich, Extremophiles, 2005, 9, 345.
9. C. Yang, H. Xie, J. K. Zhang and B. L. Sun, Protein Expression Purif., 2012, 85, 60.
10. J. E. Coleman and P. Gettins, Advances in Enzymolgy Related Areas of Molecular Biology, 1983, vol. 55, p. 381.
11. D. Drew, D. Sjöstrand, J. Nilsson, T. Urbig, C. N. Chin, J. W. de Gier and G. von Heijne, Proc. Natl. Acad. Sci. U. S. A., 2002, 99, 2690.
12. M. H. Malamy and B. L. Horecker, Biochemistry, 1964, 3, 1889.
13. S. Michaelis, H. Inouye, D. Oliver and J. Beckwith, J. Bacteriol., 1983, 154, 366.
14. M. Carbonaro and A. Nucara, Amino Acids, 2010, 38, 679.
15. X. J. Fan, Research on the Fabrication of Superhydrophobic Surface on Typical Metal Substrate, Master's thesis, Dalian University of Technology, 2012.

---