Metabolic transformation evidence of caffeic acid derivatives in male rats after the oral administration of functional food by UPLC coupled with a hybrid quadrupole-orbitrap mass spectrometer

Abstract

Caffeic acid (CaA) and caffeic acid derivatives (CADs) in plant-derived foods or common diet have a variety of biological functions, which rely on their absorption and metabolism. However, their metabolic pathways and transformation mechanisms are unclear due to the co-existence of multi- and micro-CADs in functional foods. We report an efficient and comprehensive analytical methodology based on ultra-performance liquid chromatography coupled with a Q Exactive hybrid quadrupole-orbitrap mass spectrometer (Q Exactive UPLC-MS/MS) to simultaneously determine the CADs and their metabolites in male rat plasma after the oral administration of a type of typical Chinese functional food, danshencha (DSC), as well as the transformation of the phase II enzymes. A total of 20 phenolic acid components were obtained and identified from the DSC extracts. This method was successfully applied to the simultaneous identification of 15 prototype and 13 metabolites of CADs in rat plasma. The biotransformation of DSC was a phase II metabolic process, especially sulfation and glucuronidation. The sulfation and glucuronidation were further confirmed by evaluating the mRNA expression of sulfotransferases (SULTs) and UDP-glucoronosyltransferases (UGTs) in rat liver. SULT1A1 and SULT1B1 were induced significantly (P < 0.001). The present study provides a suitable and convenient method to analyze and identify the CADs and metabolites of DSC in complex biological matrices. In addition, this study also reveals the possible phase II metabolic process of DSC mediated by SULTs and UGTs in male rats.

---

1. Introduction

Salvia miltiorrhizae (called “Danshen” in China), as a main raw material and as a water decoction, is a widely used and extensively studied traditional Chinese herb. In addition, it is accepted as a health product in western countries owing to its remarkable and reliable biological activities, especially in the treatment of coronary heart disease, cerebrovascular disease, hepatitis, and cancer.^1–3 Green tea also has many beneficial functions and is chosen by people as a daily drink.^4,5 Mainly consisting of danshen (70%) and green tea (25%), danshencha (DSC) is a traditional herbal tea and used by people in China mainly for its healthy effects, and has been registered as a health food (no. G20041341) by the China State Food and Drug Administration. Single phenolic acids and polyphenolic acids, which may be considered as the condensation derivatives of caffeic acid (CaA) in different linkage forms and numbers, are bioactive compounds that contribute to their beneficial effects. It is well known that based on the number of CaA units, the phenolic acids can be sorted into some subtypes,⁶ such as monomers, dimmers and tetramers, etc. These co-existing caffeic acid derivatives (CADs) in food exhibit synergistic bioactivities that are related to their absorption and metabolism.^7–9 The present study focused on CADs in DSC and their following metabolites in rats after oral administration.

Previous studies focused mainly on the prototype and pharmacokinetics of phenolic acids.^10,11 Up to now, most studies determined the conjugates indirectly by measuring the phenolic acids released by hydrolysis with β-glucuronidase or sulfatase.^12,13 The apparent potential for incomplete enzymatic hydrolysis introduces an inherent underestimation of the phenolic acids metabolism. The glucuronidation and sulfation of xenobiotics in the liver are carried out by UDP-glucoronosyltransferases (UGTs) and sulfotransferases (SULTs), respectively. Thus, the present study evaluated the effects of DSC on the expression of UGTs and SULTs. This may help reveal the phase II metabolic process of DSC.

Recently, liquid chromatography coupled with tandem mass spectrometry (LC-MS) has become one of the most powerful analytical technologies for the bio-analysis of phenolic acids in danshen or green tea relying on its sensitivity and selectivity.^14–17 Single or multiple components were assayed in bio-samples, such as plasma, urine and bile of rat,¹⁸ pig¹⁹ or human body.²⁰ However, for separation and structure identification, many methods are cumbersome and time consuming, and have low sensitivity to low concentration components, especially to biological metabolites. Q Exactive hybrid quadrupole-orbitrap mass spectrometry (Q Exactive MS) is a newly developed method combined with high-performance quadrupole precursor selection with high-resolution and accurate-mass orbitrap detection. It has many attributes that allow for a comprehensive analysis of the target components extracted from a complex biological matrix. Thus, in the present study, an ultra-performance liquid chromatography coupled with Q Exactive MS (Q Exactive UPLC-MS/MS) was developed and validated to examine the CADs and their metabolites in the plasma of rats treated with DSC.

2. Experimental

2.1. Chemicals and materials

Acetonitrile, methanol and formic acid were of HPLC-grade and purchased from Merck (Merck, Darmstadt, Germany). Deionized water used throughout the experiment was prepared using a Milli-Q50SP Reagent system (Millipore Corporation, MA, USA). All other reagents and chemicals were analytical grade. Danshencha was purchased from New World Danshen Base Industrial Co., Ltd. (Sichuan, China). The standards, caffeic acid (CaA), salvianolic acid B (Sal B), ferulic acid, tanshinol, protocatechuic acid, chlorogenic acid, epicatechin gallate, rosmarinic acid, lithospermic acid, Sal A, and Sal C were of 98% purity and purchased from Zelang Medical Technology Co., LTD (Nanjing, China).

2.2. Preparation of danshencha extracts

The dried and powdered sample of danshencha was prepared. A total of 12 g was accurately weighed, immersed in 80 mL water and heated under reflux in a 100 °C water bath for 1 h. The mixture was filtered, and the residue was again heated under reflux with 80 mL water under the same conditions. After the extracts were merged and filtered, 95% ethyl alcohol was added to adjust it to 60% ethyl alcohol. The extracts were allowed to settle for 12 h and then filtered. The filtrate was evaporated by rotary evaporation under vacuum at 50 °C. Finally, the residue was dissolved in normal saline (NS) to obtain the mixture oral solution with a concentration of 0.75 g mL⁻¹ of the crude drug. All solutions were stored at 4 °C and filtered through a 0.22 μm filter membrane before being injection into the UPLC system.

2.3. Animal-experiments and drug administration

Experiments with animals were performed using a protocol approved by the Nanjing Medical University Institutional Animal Care and Use Committee. Eighteen male Sprague-Dawley (SD) rats (200–220 g) were supplied by Shanghai SLAC Lab. Animal Co., Ltd. (Shanghai, China). The rats were housed in a breeding room at 22–24 °C, relative humidity of 50–70% and a 12 h light–dark cycle. They were fed a standard pellet diet, supplied with water ad libitum, and acclimatized to the facilities for 1 week prior to the experiments. The animals were then fasted with free access to water for 12 h before the experiments. Nine rats chosen randomly were given orally through an intragastric tube a dose of 0.75 g mL⁻¹ extracts with 7.5 g kg⁻¹ body weight. The other 9 rats in the control group were administered orally with an equivalent volume of NS solution.

2.4. Sample collection and pretreatment

Blood samples were collected from the heart at 90 min after administration and the rats were then sacrificed. The plasma was then separated immediately by centrifuging at 3500 rpm for 10 min at 4 °C, and the supernatant was transferred. The plasma was stored at −80 °C until additional extraction and analysis. The liver was excised rapidly and stored in liquid nitrogen for later analysis. For the plasma samples, 300 μL of plasma was mixed with 30 μL of 10% (v/v) hydrochloric acid, vortexed for 1 min, mixed with 1 mL of ethyl acetate, and vortexed again for 2 min. The samples were then centrifuged (9000 rpm) for 10 min, and the supernatant was transferred to a clean test tube. The resulting samples were filtered through a 0.22 μm membrane and a 10 μL aliquot was injected for UPLC-MS analysis.

2.5. Instrumental and analytical conditions

Q Exactive UPLC-MS analysis was performed on a Thermo Scientific Q Exactive hybrid quadrupole-orbitrap mass spectrometer (Thermo Fisher Scientific, San Jose, USA) coupled with Dionex Ultimate 3000 ultra-performance liquid chromatographic system (Thermo Fisher Scientific, San Jose, USA). Chromatographic separation was achieved using a Thermo Scientific Hypersil Gold C18 column (2.1 × 100 mm, 1.9 μm) held at 30 °C, and the flow rate was 0.4 mL min⁻¹. The optimal mobile phase consisted of solvent A (water contains 0.1% formic acid) and solvent B (acetonitrile) under the following gradient elution: 5–95% B from 0–12 min and 95–5% B from 12–12.5 min. Mass spectrometry was performed on a Q Exactive hybrid quadrupole-orbitrap mass spectrometer using a heated electrospray ionization source for ionization of the target compounds in both positive and negative ion modes. The key MS parameters were set as follows: ionization voltage, +3.5 kV; sheath gas pressure, 35 arbitrary units; auxiliary gas, 10 arbitrary units; the flow rate of drying gas (N₂) 10.0 L min⁻¹, heat temperature, 350 °C; and capillary temperature, 263 °C. For the compounds of interest, a scan range of m/z 120–1000 was chosen. An amplitude voltage of 1.0 V was used typically for fragmentation in the ion trap auto MS/MS experiments. Control of the instruments and collection of the chromatographic and mass spectrometry information were carried out using Chromleteon 6 software.

2.6. Total RNA extraction and reverse transcription polymerase chain reaction (RT-PCR)

The rat liver was used to extract the total RNA and the first strand cDNA was synthesized by reverse transcription of the total RNA using a Transcriptor First Strand cDNA Synthesis Kit (InvitrogenTech-Line™, Carlsbad, CA, USA). The primers were designed using Primer 5.0 software and synthesized by Invitrogen (Shanghai, China). The gene-specific primers are listed in Table 1. The mRNA expression of sulfotransferases (SULTs) and UDP-glucuronosyltransferases (UGTs) were determined using PCR and a real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR), and gapdh was used as a reference to normalize the expression levels. The PCR reaction was carried out in a 20 μL reaction volume using a diluted cDNA sample. After PCR, 20 μL samples of the PCR products were electrophoresed through a 2% agarose gel, and stained with ethidium bromide. qRT-PCR was performed using FastStart Universal SYBR Green Master (Roche, Mannheim, Germany) on a 7300 Fast Real Time PCR System (Applied Biosystems, Life Technologies, Warrington, UK) according to the manufacturer's instructions. The relative gene expression was analyzed using the −2^ΔΔCt method.

Table 1 PCR primers used in this study and the amplified products^a

Gene	Primer sequences (5′–3′)	Product length (bp)
a Abbreviations: F, forward; R, reverse.
sult1a1	GGAAGTGTCCTATGGGTCGTG (F)	112
	CCTTTTGGGGTTCTCCTTTATGTCT (R)
sult1b1	TATTCAGCCTCTTCCTGGCACCT (F)	114
	CCTTCCCTCTTTTCCCACCAACTC (R)
sult1c3	CTGAGTTTTGTATGTCCTGTGAT (F)	139
	TTGAAGGTATTCTGTTTATTTTGCG (R)
sult1e1	GGTGATGTGGAAAAATGCAAGGAGG (F)	150
	AAGGAGCTTAGCTGGCAGGTGAG (R)
sult2a1	CAGGAACGAACTGGCTGATTGA (F)	196
	AAGAGAGACTTGGAGAAAAGATGCA (R)
ugt1a1	GGGTCACTTGCCACTGAAATCTTA (F)	157
	TCTGAAGGCAGTTTATCCCACCA (R)
ugt1a5	TATGAATCTATTGCACAATGGGTCC (F)	153
	CCACAGGGAATGTATCGTAGAAAG (R)
ugt2b	TACTCCCTCCATCTTATGTGCCTGT (F)	196
	ACTTTGCTCATTGTCTCATCTACGG (R)
gapdh	CAACGGGAAACCCATCACCA (F)	96
	ACGCCAGTAGACTCCACGACAT (R)

---

2.7. Statistical analysis

The statistical differences were analyzed using one-way analysis of variance (ANOVA) by SPSS 13.0 software (Chicago, IL, USA). The results are expressed as the mean ± standard deviation (SD). The differences were considered significant at P < 0.05.

3. Results and discussion

3.1. Mass spectrometry of pure standards

In the preliminary study, 11 pure CADs standards were chosen for analysis using a Q Exactive UPLC-MS system. The results of the positive and negative ion modes were compared, and it was found that negative ion mode provided higher sensitivity for the phenolic acids of concern, as reported in the literature.²¹ The total ion chromatograms of 11 pure standards of CADs are shown in Fig. 1.

Fig. 1 Total ion chromatographs of 11 pure standards of caffeic acid derivatives (CADs). Peak 1, protocatechuic acid; peak 2, chlorogenic acid; peak 3, caffeic acid; peak 4, L-epicatechin; peak 5, epicatechin gallate; peak 6, ferulic acid; peak 7, rosmarinic acid; peak 8, lithospermic acid; peak 9, salvianolic acid B; peak 10, salvianolic acid A; peak 11, salvianolic acid C.

3.2. Detection and identification of CADs in DSC extracts

A tentative identification of the CADs compounds in DSC extracts was generated and using the optimal Q Exactive UPLC-MS/MS conditions described above, the total ion chromatograms of the DSC extracts obtained from the negative ion modes were obtained, as shown in Fig. 2A. A total of 20 components were found and identified. The CADs reference standards, CaA, salvianolic acid B (Sal B), ferulic acid, tanshinol, protocatechuic acid, chlorogenic acid, epicatechin gallate, rosmarinic acid, lithospermic acid, Sal A and Sal C mentioned before, were used as the confirmation criteria for the targeted search and identified directly by a comparison with the retention times and accurate MS. The others were deduced based on the potential elemental composition data determined from accurate mass measurements or by comparing with the literature data.^22–24 Take peak 1 to explain the analysis and identification progress. Peak 1 was eluted at a retention time of 1.68 min and showed [M − H]⁻ m/z = 197.0447. We deduced that the corresponding elemental composition was C₉H₁₀O₅. The molecular ion of peak 1 exhibited the typical product MS² ion at m/z = 135.0803 (C₈H₇O₂) in negative ion mode. On the basis of the elemental compositions of fragment ions, peak 1 was assigned to tanshinol. Because of the basic structure of CADs, polyphenolic acids usually undergo a specific neutral loss of 198 Da (tanshinol) and/or 180 Da (CaA) in the MS² spectra. The analyses of the other components were deduced and the results are listed in the Table 2.

Fig. 2 Total ion chromatograms of the danshencha (DSC) extract (A), blank rat plasma (B), plasma after the intragastric administration of DSC for 90 min (C) by Q Exactive UPLC-MS/MS in negative ion mode.

Table 2 CADs identified in the DSC extracts by Q Exactive UPLC-MS and MS/MS

No.	TR (min)	ESI^−, m/z		Predicted m/z	Diff. (ppm)	Formula	Identification
		MS	MS/MS
a Reference compounds.
1	1.68	197.0455, [M − H]^−	135.0803, [M − H − CO2 − H2O]^−	197.0445	5.58	C9H10O5	Tanshinol
2^a	2.32	353.0866, [M − H]^−	191.0553, [M − H − C9H7O3]^−	353.0878	−0.364	C16H18O9	Chlorogenic acid
			179.0340, [M − H − C7H10O5]^−
3^a	2.68	179.0340, [M − H]^−	135.0439, [M − H − CO2]^−	179.0350	0.19	C9H8O4	Caffeic acid
4^a	2.70	289.0796, [M − H]^−	245.0824, [M − H − CO2]^−	289.0718	−4.47	C15H14O6	L-Epicatechin
			179.0343, [M − H − C6H6O2]^−
			109.0281, [M − H − C9H8O4]^−
5^a	3.44	441.0827, [M − H]^−	169.0133, [M − H − C15H12O5]^−	441.0827	1.55	C22H18O10	Epicatechin gallate
6^a	3.54	193.0496, [M − H]^−	178.0262, [M − H − CH3]^−	193.0506	0.543	C10H10O4	Ferulic acid
			135.0440, [M − H − CH3 − CO2]^−
7	3.70	193.0497, [M − H]^−	178.0262, [M − H − CH3]^−	193.0506	0.232	C10H10O4	Isoferulic acid
			135.0440, [M − H − CH3 − CO2]^−
8^a	3.98	359.0772, [M − H]^−	197.0449, [M − H − C9H6O3]^−	359.0772	1.85	C18H16O8	Rosmarinic acid
			179.0340, [M − H − C9H8O4]^−
			161.0234, [M − H − C9H10O5]^−
9^a	4.06	537.1039, [M − H]^−	519.0923, [M − H − H2O]^−	537.1038	3.70	C27H22O12	Lithospermic acid
			339.0594, [M − H − C9H10O5]^−
10^a	4.21	717.1461, [M − H]^−	519.0923, [M − H − C9H10O5]^−	717.1461	1.64	C36H30O16	Salvianolic acid B
			339.0511, [M − H − C9H10O5 − C9H8O4]^−
			321.0406, [M − H − 2C9H10O5]^−
11	4.30	137.0231, [M − H]^−		137.0244	−1.46	C7H6O3	Protocatechualdehyde
12	4.32	445.0775, [M − H]^−	269.0455, [M − H − C6H8O6]^−	445.0776	2.342	C21H18O11	Baicalin
			174.9551, [M − H − C6H8O6 − C6H7O]^−
13^a	4.49	493.1140, [M − H]^−	295.0642, [M − H − C9H10O5]^−	493.1140	3.70	C26H22O10	Salvianolic acid A
14	4.59	717.1469, [M − H]^−	699.1238, [M − H − H2O]^−	717.1461	2.63	C36H30O16	Salvianolic acid E
			519.1045, [M − H − C9H10O5]^−
			321.0935, [M − H − 2C9H10O5]^−
15	4.99	459.0933, [M − H]^−	283.1702, [M − H − C6H8O6]^−	459.0933	2.40	C22H20O11	Wogonoside
16^a	5.09	491.0987, [M − H]^−	293.0543, [M − H − C9H10O5]^−	491.0984	3.00	C26H20O10	Salvianolic acid C
17	5.73	269.0458, [M − H]^−	251.0926, [M − H − H2O]^−	269.0455	4.34	C15H10O5	Baicalein
			175.0237, [M − H − C6H6O]^−
18	5.76	717.1461, [M − H]^−	519.0923, [M − H − C9H10O5]^−	717.1461	1.78	C36H30O16	Salvianolic acid L
			339.0511, [M − H − C9H10O5 − C9H8O4]^−
			321.0406, [M − H − 2C9H10O5]^−
19	6.75	313.0716, [M − H]^−	269.0456, [M − H − CO2]^−	313.0718	2.95	C17H14O6	Salvianolic acid F
			179.0340, [M − H − C8H6O2]^−
20	6.96	417.0817, [M − H]^−	399.0672, [M − H − H2O]^−	417.0827	2.43	C20H18O10	Salvianolic acid D
			219.0498, [M − H − C9H10O5]^−

---

3.3. Analysis of CADs and metabolites in rat plasma after oral administration of DSC extracts

The total ion chromatograms of the control rat plasma (Fig. 2B) with the dosed rat plasma (Fig. 2C) were processed and compared, 28 peaks were observed in the dosed rat plasma that did not appear in the control plasma. Among the 28 peaks, 15 peaks (peaks 1–17 in Table 2) were indicated as the prototype components of DSC by a comparison with the chromatograms of the DSC extracts. Without the corresponding reference standards, the metabolites were automatically forwarded for general unknown screening by SIEVE software or a comparison with the literature data.^25,26 The results from the comparison would offer new components and identifications as metabolites in the plasma after the oral administration of DSC. The compound, M1 and M2, which both produced a similar fragment ion at m/z 153.0193 (C₇H₆O₄), was assigned to the same protocatechuic acid skeleton and substituted by sulfate and glucuronic acid. This indicated that M1 was a sulfate conjugated product of protocatechuic acid and M2 was a protocatechuic acid-O-glucuronide (Fig. 3A). Compounds M3 and M4 were the sulfate and glucuronide of protocatechuic aldehyde (Fig. 3A). M5 was identified as protocatechuic acid by a comparison with the reference standards. The following components M6, M7, M8, and M9 were speculated using the same means (Fig. 3B and C). M10 and M13 were suggested to be the methyl and glucuronide of tanshinol because of the loss of CH₃ and C₆H₈O₆ and both produced a fragment ion at m/z 197.9139 (Fig. 3D). Owing to the similar characteristic loss of methyl it exhibited, M11 was found to be monomethyl lithospermate and the M12 was assigned to ethyl lithospermate because its [M − H]⁻ ions showed a loss of C₂H₅ and produced a fragment ion at m/z 519.1034 (Fig. 3E). In addition, the metabolites usually showed the characteristic fragment ions at m/z = 179.0341 and 179.9139 as well as other monomer fragment ions formed by neutral losses of 80 Da (SO₃), 15 Da (CH₃) and/or 180 Da (C₆H₁₂O₆). The above show that methylation, sulfation and glucuronidation are their main metabolic ways. The proposed results of the metabolites are shown in Table 3.

Fig. 3 Proposed metabolic pathway for protocatechualdehyde (A), ferulic acid or isoferulic acid (B), caffeic acid (C), tanshinol (D) and lithospermate (E).

Table 3 CADs metabolites identified in rat plasma after oral administration of the DSC extracts by Q Exactive UPLC-MS and MS/MS

No.	TR (min)	ESI^−, m/z		Predicted m/z	Diff. (ppm)	Formula	Identification
		MS	MS/MS
M1	0.89	232.9755, [M − H]^−	153.0193, [M − H − SO3]^−	232.9761	0.60	C7H6O7S	Protocatechuic acid sulfate
M2	1.66	329.0517, [M − H]^−	153.0186, [M − H − C6H8O6]^−	329.0514	4.09	C13H14O10	Protocatechuic acid-O-glucuronide
M3	1.71	216.9800, [M − H]^−	137.0231, [M − H − SO3]^−	216.9812	−0.48	C7H6O6S	Protocatechuic aldehyde sulfate
M4	1.81	313.0562, [M − H]^−	137.0231, [M − H − C6H8O6]^−	313.0565	2.49	C13H14O9	Protocatechuic aldehyde glucuronide
M5	1.86	153.0182, [M − H]^−	135.0075, [M − H − H2O]^−	153.0193	−0.491	C7H6O4	Protocatechuic acid
			109.0281, [M − H − CO2]^−
M6	2.08/2.65	369.0829, [M − H]^−	193.0499, [M − H − C6H8O6]^−	369.0827	3.51	C16H18O10	Ferulic acid 4-O-glucuronide or isoferulic acid 4-O-glucuronide
			178.0263, [M − H − C6H8O6 − CH3]^−
			113.0230, [M − H − C10H10O4 − CO2 − H2O]^−
M7	2.32	355.0670, [M − H]^−	179.0340, [M − H − C6H8O6]^−	355.0671	5.76	C15H16O10	Caffeic acid 3-O-glucuronide or caffeic acid 4-O-glucuronide
			135.0439, [M − H − C6H8O6 − CO2]^−
M8	2.34/3.37	273.0062, [M − H]^−	193.0499, [M − H − SO3]^−	273.0074	−0.44	C10H10O7S	Ferulic acid 4-sulfate or isoferulic acid 3-sulfate
			178.0263, [M − H − SO3 − CH3]^−
M9	2.60	258.9910, [M − H]^−	179.0341, [M − H − SO3]^−	258.9918	1.27	C9H8O7S	Caffeic acid 3-sulfate or caffeic acid 4-sulfate
			135.0439, [M − H − SO3 − CO2]^−
M10	3.71	211.0612, [M − H]^−	197.9139, [M − H − CH3]^−	211.0612	1.61	C10H12O5	Methyl tanshinol
M11	4.87	551.1195, [M − H]^−	537.1037, [M − H − CH3]^−	551.1195	3.44	C28H24O12	Monomethyl lithospermate
			313.0713, [M − H − C9H10O5]^−
M12	6.33	565.1330, [M − H]^−	547.1205, [M − H − H2O]^−	565.1351	1.89	C29H26O12	Ethyl lithospermate
			519.1032, [M − H − H2O − C2H5]^−
			467.0907, [M − H − C9H10O5]^−
M13	6.84	373.0929, [M − H]^−	197.0448, [M − H − C6H8O6]^−	373.0929	3.60	C19H18O8	Glucuronide of tanshinol

---

3.4. Effects of danshencha (DSC) on the mRNA expression of sulfotransferases (SULTs) and UDP-glucuronosyltransferases (UGTs)

The metabolites of the DSC extracts were mainly sulfates and glucuronides of the prototype compounds (Table 3). This provided information that the phase II metabolism, especially sulfation and glucuronidation, occurred in the rat liver after oral administration of the CADs extracts. As expressed mainly in the male rat liver, five SULTs (SULT1A1, SULT1B1, SULT1C3, SULT1E1 and SULT2A1) and three UGTs (UGT1A1, UGT1A5 and UGT2B) were chosen to evaluate the sulfation and glucuronidation of DSC in the liver interstitial at the molecular level.^27,28 In contrast to the control group, SULT1A1, SULT1B1, UGT1A5, and UGT2B were up-regulated in the group after oral administration of the DSC extracts (Fig. 4A). These results were further confirmed by real-time PCR (Fig. 4B). The expression of SULT1A1 and SULT1B1 were induced significantly in the gavage group (P < 0.001). These results suggest that ULT1A1, SULT1B1, UGT1A5, and UGT2B contribute to the phase II metabolism of DSC extracts.

Fig. 4 Effects of danshencha (DSC) on the mRNA expression of sulfotransferases (SULTs) and UDP-glucuronosyltransferases (UGTs). The expression of SULT1A1, SULT1B1, SULT1C3, SULT1E1, SULT2A1, UGT1A1, UGT1A5 and UGT2B in male rat liver were detected by RT-PCR (A). The expression of SULT1A1, SULT1B1, UGT1A1, and UGT2B in the male rat liver was detected by quantitative real-time PCR (B). The data is expressed as the mean ± SD of three independent experiments with triplicate samples. ***P < 0.001, compared with control group (ctrl).

4. Conclusion

The present study demonstrated for the first time, the feasibility of the Q Exactive UPLC-MS/MS approach for the rapid and reliable characterization of the ingredients of CADs and the metabolites of DSC. This finding helped to reveal the possible metabolic process of CADs in male rats. UGTs and SULTs might be involved in the phase II metabolism of CADs, especially SULT1A1 and SULT1B1. The present study may serve as a useful reference to the rapid discovery, global characterization and metabolic process of the constituents in rat plasma after the oral administration of other herbal medicines.

Conflict of interest

The authors declare that they have no competing or financial interests.

Acknowledgements

This work was supported by the Natural Science Foundations of China (81072338, 81473020 and 81402667) and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (2010).

References

1. R. Yang, L. Chang, B. Y. Guo, Y. W. Wang, Y. L. Wang, X. Jin, S. Y. Liu and Y. J. Li, J. Evidence-Based Complementary Altern. Med., 2014, 2014, 256268.
2. T. Yang, D. P. Shen, Q. L. Wang, Y. Y. Tao and C. H. Liu, J. Ethnopharmacol., 2013, 148, 691–700.
3. X. Chen, J. Guo, J. Bao, J. Lu and Y. Wang, Med. Res. Rev., 2014, 34, 768–794.
4. C. S. Yang, G. Chen and Q. Wu, Journal of Traditional and Complementary Medicine, 2014, 4, 17–23.
5. N. Santesso and E. Manheimer, Global Advances in Health and Medicine, 2014, 3, 66–67.
6. Y. Lu and L. Y. Foo, Phytochemistry, 2002, 59, 117–140.
7. J. Zhao, Z. Zhang, J. Dai, L. Wang, C. Zhang, Y. Ye and L. Li, RSC Adv., 2014, 4, 43057–43063.
8. R. Li, S. Cao, J. Dai, L. Wang, L. Li, Y. Wang, W. Yin and Y. Ye, J. Biomed. Res., 2014, 28, 423–428.
9. Y. Yang, Y. Li, K. Wang, Y. Wang, W. Yin and L. Li, PLoS One, 2013, 8, e58915.
10. D. Zhao, D. E. Han, N. Li, Y. Lu, T. T. Li, S. Y. Yang, J. K. He and X. J. Chen, Eur. J. Mass Spectrom., 2011, 17, 395–403.
11. M. Xu, G. Fu, X. Qiao, W. Y. Wu, H. Guo, A. H. Liu, J. H. Sun and D. A. Guo, Biomed. Chromatogr., 2007, 21, 1052–1063.
12. P. A. Guy, M. Renouf, D. Barron, C. Cavin, F. Dionisi, S. Kochhar, S. Rezzi, G. Williamson and H. Steiling, J. Chromatogr. B: Anal. Technol. Biomed. Life Sci., 2009, 877, 3965–3974.
13. M. Renouf, P. A. Guy, C. Marmet, A. L. Fraering, K. Longet, J. Moulin, M. Enslen, D. Barron, F. Dionisi, C. Cavin, G. Williamson and H. Steiling, Mol. Nutr. Food Res., 2010, 54, 760–766.
14. J. Shen, K. Yang, C. Sun and M. Zheng, Acta Pharm., 2014, 64, 325–334.
15. J. Meng, Z. Yang, J. Liang, H. Zhou and S. Wu, J. Chromatogr. A, 2014, 1323, 73–81.
16. T. Wang, H. Zhang, L. Wang, Y. Jiang, L. Zhang, Y. Zhou, R. Yang, C. Ding and X. Wang, J. Chromatogr. Sci., 2014, 52, 992–998.
17. M. de la Luz Cadiz-Gurrea, S. Fernandez-Arroyo and A. Segura-Carretero, Int. J. Mol. Sci., 2014, 15, 20382–20402.
18. Y. Lv, X. Zhang, X. Liang, X. Liu, W. Dai, S. Yan and W. Zhang, J. Pharm. Biomed. Anal., 2010, 52, 155–159.
19. X. Zhao, D. H. Yang, Q. L. Zhou, F. Xu, L. Zhang, J. Liang, G. X. Liu, S. Q. Cai and X. W. Yang, Biomed. Chromatogr., 2013, 27, 720–735.
20. C. Marmet, L. Actis-Goretta, M. Renouf and F. Giuffrida, J. Pharm. Biomed. Anal., 2014, 88, 617–625.
21. F. Pellati, G. Orlandini and S. Benvenuti, J. Chromatogr. A, 2012, 1242, 43–58.
22. Z. Zhu, H. Zhang, L. Zhao, X. Dong, X. Li, Y. Chai and G. Zhang, Rapid Commun. Mass Spectrom., 2007, 21, 1855–1865.
23. A. H. Liu, H. Guo, M. Ye, Y. H. Lin, J. H. Sun, M. Xu and D. A. Guo, J. Chromatogr. A, 2007, 1161, 170–182.
24. M. Ruan, Y. Li, X. Li, J. Luo and L. Kong, J. Pharm. Biomed. Anal., 2012, 59, 184–189.
25. M. Qi, A. Xiong, P. Li, Q. Yang, L. Yang and Z. Wang, J. Chromatogr. B: Anal. Technol. Biomed. Life Sci., 2013, 940, 77–85.
26. M. Xu, Z. Zhang, G. Fu, S. Sun, J. Sun, M. Yang, A. Liu, J. Han and D. Guo, J. Chromatogr. B: Anal. Technol. Biomed. Life Sci., 2007, 856, 100–107.
27. R. T. Dunn 2nd and C. D. Klaassen, Drug Metab. Dispos., 1998, 26, 598–604.
28. M. K. Shelby, N. J. Cherrington, N. R. Vansell and C. D. Klaassen, Drug Metab. Dispos., 2003, 31, 326–333.

---

Footnote

† These authors contributed equally to this work.

---