Chemosensitization of IκBα-overexpressing glioblastoma towards anti-cancer agents

Abstract

Burgeoning research on gene-directed therapeutics has significant translational scope to combat multidrug resistant glioblastoma when conventional anticancer drugs cease to work alone or in combination. In the present work, a novel strategy to sensitize drug resistant glioblastoma cells (U87MG) has been proposed by overexpressing the IκBα gene, which is a cellular inhibitor of NFκB signaling pathways. The IκBα overexpressing U87MG cell line (U87-IκBα) was established by the G418 selection of IκBα transfected U87MG cells. The expression of IκBα was studied by semi-quantitative RT PCR, real time PCR and Western blot analysis. The stable cells were found to be easily sensitized by the anticancer drug 5-fluorouracil (5-FU) and an unconventional therapeutic agent curcumin nanoparticles. Cell viability assays and flow cytometry-based cell cycle studies showed dose dependent differential effects of 5-FU on U87-IκBα and U87MG cells. The expression status of various cell cycle genes was examined by real time PCR analysis. Furthermore, water soluble curcumin nanoparticles (NPs) were synthesized in the presence of poly-L-lysine and BSA to sensitize U87-IκBα cells. Results demonstrated the augmentation of the therapeutic potential of 5-FU and curcumin nanoparticles on IκBα overexpressed cells. Thus, this simple strategy offers the scope of using combination modules as a potential cancer therapeutic.

---

1. Introduction

The multiple drug resistance property of glioblastoma (brain cancer, e.g. U87MG) cells confers aggressive proliferation and differentiation along with the ability to evade the apoptotic pathway of cell death, resulting in poor response to conventional chemotherapeutics.^1,4 This demands novel therapeutics and/or strategies to overcome the challenges of poor prognosis and high mortality rates.^2,3 To overcome these challenges, detailed understanding of molecular events, such as gene expression and regulation, by various endogenous inhibitors would be a viable option because cellular events occurring with a high degree of precision govern gene expression. This provides an ample opportunity to monitor such events as an improved method of developing suitable strategies for curing several diseases including glioblastoma. For example, in the U87MG cell line, the expression of several anti-apoptotic and pro-survival genes (e.g. bcl-2, bcl-xL, survivin, etc.) relies on NFκB, which is an inducible transcription factor.^5,6 NFκB comprises five different subunits. They act as transcription factors in homo- or heterodimeric manner and bind to the κB binding site in the promoter region of target genes.^7–9 IκBα binds with the p50/p65 heterodimer (most abundant among all the NFκB dimers) in the cytoplasm and blocks its translocation into the nucleus.^10–12 Upon induction by external stimuli (e.g. TNF-α, LPS etc.), IKK-β phosphorylates IκBα, leading to its proteasome-mediated degradation. The unbound NFκB translocates into the nucleus and initiates transcription.^7–9,11,13 Thus, it may be inferred that the inhibition of NFκB would be a specific target in cancer chemotherapeutics. However, literature suggests that there are not many reports that address this issue.^11,14–17 Another crucial point is the use of small molecules, such as proteasome inhibitors or immunosuppressive agents, which very often exhibit several side effects.¹⁸ This may be addressed by using naturally occurring bioactive molecules to replace these small molecules, which eventually reduces the possibility of side effects following exposure. Curcumin (diferuloylmethane) is one of the naturally occurring bioactive molecules that have been used as a model chemosensitizing agent to kill cancer cells including U87MG.^19–21 As a potent anticancer agent, curcumin is found to regulate various transcription factors, growth factors and cytokines required for the proliferation of cancer cells.^22,23 The role of curcumin in the inhibition of pro-inflammatory transcription factor NFκB is well studied. It has been found that curcumin inhibits the constitutive activation of NFκB by blocking the G1/S phase of the cell cycle,^24–26 which in turn induces apoptosis. In addition, inhibition of NFκB increases the half-life of IκBα and modulates the inhibition of cell proliferation.^27,28 It is worth mentioning that because of its poor water solubility, curcumin lacks bioavailability and biodistribution,²⁹ which eventually limits its therapeutic index. These inherent limitations could be resolved by synthesizing curcumin NPs with a suitable surface stabilizing agent to heighten their therapeutic potential.^30,31 Glioblastoma cells (U87MG) are resistant to common anticancer drugs such as 5-fluorouracil (5-FU).^32,33 Various reports suggest that gene therapy or RNA interference increases the efficacy of chemosensitization in glioma cell lines.^34–36 Overexpression of the genes of interest inside the glioma cells and their sensitization with conventional anticancer agents are always advantageous over novel therapeutics because the molecular pathway of drug activation is known. Furthermore, different reports suggest that the overexpression of IκBα (and its different forms) sensitizes cancer cells towards common chemotherapeutics and radiation therapy.^37–39 Thus, as a proof of concept, we have constructed a wild type IκBα overexpressing U87MG cell line (herein named U87-IκBα) and tested the efficacy of 5-FU and curcumin NPs on these cells separately as well as in combination. Therefore, this approach of eliciting drug activity with the help of endogenous control, particularly to kill drug resistant cancer cell lines, will pave a new approach for cancer therapy.

Herein, the IκBα overexpressing U87MG cell line (U87-IκBα) was established and the effect of curcumin nanoconjugates and 5-FU on these cells was studied. To synthesize water soluble curcumin NPs, the biodegradable polymer polyvinyl pyrrolidone (PVP) was employed as a stabilizing agent, which was further loaded with nontoxic protein BSA via poly-L-lysine to increase stability in the cellular environment. This curcumin nanoconjugate was added to the U87-IκBα cells for higher therapeutic efficacy. In addition, 5-FU was added to the transfected cells to study the heightened therapeutic efficacy. The layout of the work is described in Scheme 1.

Scheme 1 Schematic of the generation of the U87-IκBα cell line and sensitization with 5-FU and curcumin nanoconjugates.

2. Materials and methods

2.1 Cloning of IκBα in mammalian expression vector

IκBα was cloned in the pGEM-T Easy vector (Promega) as described previously.⁴⁰ The IκBα gene was transferred from pGEM-T Easy to the pCINeo vector (Promega) by digestion with restriction enzymes followed by ligation. IκBα cloned in the pGEM-T Easy vector was digested with Eco RI (cutting site 5′ GAATTC 3′) and Spe I (cutting site 5′ ACTAGT 3′). Similarly, pCINeo was digested with Eco RI and Xba I (cutting site 5′ TCTAGA 3′). Because Spe I and Xba I have compatible cohesive ends, they share a common ligation site. Thus, after digestion, the digested product IκBα and digested linear fragments of pCINeo were gel eluted from agarose gel using a gel elution kit (Sigma, USA). The purified digested product was ligated using an NEB quick ligation kit following the manufacturer's protocol. The ligation product was transformed into the E.coli DH5α strain, and the colonies were screened by ampicillin. Then, the purified plasmids from the colonies observed on the plate were isolated and digested with Eco RI and NotI, which release the digestion products of expected size. To further confirm the cloning, the full length IκBα was amplified by PCR using purified plasmid as a template.

2.2 Establishment of IκBα overexpressing U87MG cell line

The IκBα cloned pCINeo plasmid was purified using a GenElute™ (Sigma, USA) plasmid extraction kit following the manufacturer's protocol. The purified plasmid was transfected into U87MG cells by a lipofectamine-mediated transfection method. Here, according to the manufacturer's protocol, U87MG cells were seeded in equal number in 12-well plates, and after the cells reached 90% confluency, they were treated with lipofectamine-conjugated pCINeo-IκBα plasmid. Initially, 5 μL lipofectamine and 5 μg of purified plasmid were separately incubated in serum free media for 10 min, then the diluted DNA and lipofectamine were mixed together and incubated for a maximum of 30 min, and added to the cells. After 12 h, the media was replaced by normal media with 600 μg mL⁻¹ G418 for the selection of clonal population. The selection process was carried out until there was no cell death with the replenishment of fresh drug-containing media every 3 days. Then, the RNA was isolated and the overexpression of IκBα was checked to confirm the establishment of the IκBα overexpressing U87-IκBα cell line.

2.3 Characterization of overexpression of IκBα

The overexpression of IκBα in the stable cell line was assessed by the following methods:

a Semi-quantitative RT PCR. RNA was isolated from IκBα-U87MG and U87MG cells using Trisure™ reagent (Sigma) following the manufacturer's protocol. The cDNA of IκBα-U87MG and U87MG cells were prepared using a Verso c-DNA synthesis kit (Thermo-Fischer) with the following protocol: polymerase buffer, dNTPs, RT enhancer, random hexamers, reverse transcriptase, and 1 μg total RNA were mixed and the required amount of water was added up to a total volume of 20 μL (as per the manufacturer's protocol). The c-DNA synthesis reaction was as follows: 42 °C for 30 min followed by the termination of the reaction at 72 °C. From the synthesized c-DNA, the overexpression of IκBα was detected using the forward primer 5′ ATGTTCCAGGCGGCCGAGCGCCC 3′ and the reverse primer 5′ TCATAACGTCAGACGCTGGCCTCCAAAC 3′ with 30 cycle PCR with melting at 94 °C, followed by another 94 °C for 30 s, annealing at 56 °C for 30 s and extension at 72 °C for 1 min. Then, the final extension was maintained for 5 min. The overexpression was checked by 1% agarose gel.

b Real time PCR. Real time PCR was performed for different cell cycle related genes using c-DNA from treated and untreated U87MG cells. For that purpose, the cells were seeded in 60 mm plates in equal number. After they reached 80% confluence, the cells were serum synchronized for 48 h. Thereafter, the serum free media was replaced with serum media. Within 2 h, the curcumin nano-conjugates were added to the cells and incubated for 18 h. Then, the RNA was isolated and c-DNA was synthesised from 1 μg equivalent RNA. The final concentrations of primers were as follows: β-actin (100 nM) and cyclin D1, D2, p21 and p27 (200 nM each). The primers, template (c-DNA), 2× SYBR green master mix and the required amount of water were mixed up to a final volume of 20 μL. Real time PCR was performed for each sample in triplicate in optical 8 tube strips (0.2 mL) (MicroAmp™, Applied Biosystems, Singapore). Real time PCR was carried out in an ABI 7500 Prism real time PCR machine (Applied Biosystems, USA) using the standard 2 step PCR protocol. The fold change was calculated from threshold cycle (C_t) by the following formula:⁴¹

Fold change = E^ΔΔC_t,

where E = PCR amplification efficiency and ΔΔC_t = ΔC_t,target − ΔC_t,reference. Now, ΔC_t,target = (C_t of gene of interest − C_t of housekeeping gene)_target and ΔC_t,control = ((C_t of gene of interest − C_t of housekeeping gene)_reference.

c Western blot analysis. The total protein from U87MG and IκBα-U87MG cells was collected by lysing the cells with RIPA buffer (Sigma) in ice followed by sonication (15 s) and centrifugation at 12 000×g for 30 min at 4 °C. The supernatant was collected and the total protein was quantified by Lowry's method of protein estimation. Then, an equal amount of protein was boiled with protein loading dye (2 mL 4× dye contains 1 M Tris–HCl (pH 6.8), 0.8 g SDS, 0.4 mL 100% glycerol, 160 μL 14.7 M β-mercaptoethanol, 8 mg bromophenol blue in water) and electrophoresed in 12% SDS-PAGE gel. Then, the protein was electroblotted to a PVDF membrane (pre-incubated with methanol) at 25 V constant voltage for 3 h in cooling conditions. The transfer efficiency was investigated by Ponceau S staining and blocked with blocking buffer (5% BSA in TBST) for 1 h at room temperature. Then, the membrane was incubated overnight at 4 °C with human anti-mouse IκBα antibody (BD Pharmingen) (dilution 1 : 2000) and β actin (Sigma) (dilution 1 : 4000) in blocking buffer. Subsequently, the membrane was washed 5 times with TBST (Tris buffered saline with 0.1% Tween 20) and incubated with horseradish peroxidase (HRP) conjugated goat anti-mouse polyclonal IgG secondary antibody (Sigma) in blocking buffer (1 : 5000 dilution) for 2 h at room temperature. Next, the membrane was washed 5 times with TBST and probed using a chemiluminiscence peroxidase substrate kit (Sigma) following the manufacturer's protocol in a BioradChemidoc machine.

2.4 Synthesis of curcumin nanoconjugates

Solid curcumin was dissolved in acetone at 4 mg mL⁻¹. The curcumin solution was added drop-wise to 1 mg mL⁻¹ polyvinyl pyrrolidone (PVP, molecular weight 10 000) solution (in water) at 75 °C to 80 °C under constant stirring up to a final concentration of 100 μg mL⁻¹ of curcumin. After the addition of curcumin, stirring was continued for 2–3 min, and the solution was sonicated in a probe sonicator (Hielscher, Germany) with 1 min pulse at 30% amplitude and 0.5 cycles for 5 min at room temperature under intermittent cooling. Then, the solution was centrifuged at 5000×g for 5 min at 4 °C to pellet down the larger particles. The supernatant was further centrifuged at 12 000×g for 10 min to collect the curcumin nanoparticles (NPs). The pellet was dissolved in Milli-Q water and probe sonicated to disperse the curcumin NPs. For its application on cells, the process was carried out in aseptic conditions. Following the synthesis of curcumin NPs, 0.01% (w/v) poly-L-lysine (PLL, Sigma, USA) was added to the curcumin NP solution to apply a positive charge to the NPs, and then BSA was added at a 100 μg mL⁻¹ concentration to the PLL coated curcumin NPs to stabilize them before addition.

2.5 Characterization of curcumin nanoconjugates

The synthesized curcumin NPs were characterized by the following methods:

2.5.1 UV-visible and fluorescence spectroscopy. UV-visible spectroscopic recording was performed using a LS45 spectrophotometer (Perkin-Elmer, USA) and fluorescence spectroscopy using a Fluorolog 3 (Horiba, Japan).

2.5.2 Transmission electron microscopy. The curcumin NPs were analysed using a high resolution transmission electron microscope (TEM; JEM 2100; Jeol, Peabody, MA, USA) operated at a maximum accelerating voltage of 200 keV. 7 μL of synthesized curcumin NPs were drop casted onto a carbon coated copper TEM grid for analysis, dehydrated and analysed under TEM.

2.5.3 Dynamic light scattering study. The hydrodynamic diameter of the curcumin NPs was measured by dynamic light scattering-based analysis using a Malvern ZetasizerNano ZS (Malvern, United Kingdom). The Z average size measurement was performed using a He–Ne laser (633 nm) with a scattering angle of 90°. The zeta potential was measured by the laser Doppler microelectrophoresis technique using the same instrument.

2.6 Cell viability assay

Glioblastoma cell line U87MG was cultured in Dulbecco's modified Eagle's medium (DMEM) (Sigma, USA). The U87-IκBα cells were also grown in the same media with additional 300 μg mL⁻¹ G418 (Sigma, USA) drug for maintaining the transfected cells. Cell viability tests were carried out in 96-well plates (BD biosciences) in triplicate. 5-FU treatment was carried out for 48 h and curcumin nanoconjugate treatment was carried out for 24 h. 500 μg mL⁻¹ 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Himedia, India) dissolved in PBS (10 mM, pH-7.4) was added to each well. After 3 h, the media was carefully discarded, and the purple tetrazolium salt formed due to cellular respiration was dissolved in 100 μL DMSO (SRL, India). The colorimetric measurement was performed in a multi-well plate reader (Tecan Infinite M200 PRO, Switzerland) by recording the absorbance at 570 nm and at 650 nm for background subtraction. Thus, the cell viability was measured by following equation:
where A₅₇₀ represents absorbance at 570 nm and A₆₅₀ represents absorbance at 650 nm.

2.7 Cell cycle analysis by flow cytometry

The effect of curcumin nanoconjugates on the cell cycle of U87MG and U87-IκBα was investigated by propidium iodide – (PI) (Sigma Aldrich, USA) based flow cytometry analysis. After 24 h of treatment (at IC₅₀ dose), the cells were fixed with chilled ethanol (70% v/v). The fixed cells were pelleted at 450×g at 4 °C for 6 min and washed twice with cold PBS. The fixed cells were incubated in dark for 30 min with 50 μg mL⁻¹ PI and 100 μg mL⁻¹ RNaseA (Amresco, USA) and 0.1% (v/v) Triton X-100 (Sigma, USA) in PBS. Then, 15 000 cells of each sample were analysed in a FACSCalibur cell analyzer (BD Biosciences, USA) using the FL-2 channel, and the data was subsequently analysed by ModFit™.

The effect of 5-FU upon the cell cycle of U87MG and U87-IκBα cells was verified in a slightly different manner. First, the cells were synchronized at G1 phase by incubating the cells for 48 h with serum free media, which was then replaced with media containing serum along with 5-FU. Then, the cells were fixed and processed for flow cytometry using the abovementioned protocol.

2.8 Epi fluorescence microscopy study

The cells were incubated with curcumin nanoconjugates for 12 h, then washed twice with ice cold PBS and further stained with DAPI (Sigma, USA) and ethidium bromide (EB) (Sigma, USA) before observation under an epi-fluorescent microscope (Nikon ECLIPSE, TS100, Japan). The DAPI was excited under a UV band pass filter (360/20 nm), curcumin nanoconjugates under a blue band pass filter (480/15 nm) and EB under a green band pass filter (535/20 nm) and observed at blue, green and red emissions, respectively. In addition, bis-benzimide Hoescht 33342 tri-hydrochloride dye (Sigma, USA) was used for nuclear staining purposes.

2.9 Reactive oxygen species determination

Reactive oxygen species (ROS) produced by curcumin nano-conjugates inside the U87MG and U87-IκBα cells were determined by a flow cytometry-based DCFH-DA (Sigma Aldrich, USA) assay. After the DCFH-DA enters into the live cells, its ester bond is cleaved by cellular esterases into DCFH, which produce a highly fluorescent end product upon oxidation. After treatment with curcumin nanoconjugates for 2 h, cells were washed with 10 mM PBS (pH-7.4) two times, then 10 μM DCFH-DA was added to the cells along with 2 mL DMEM and incubated for 30 min in a CO₂ incubator protected from light. Thereafter, the media was removed and cells were washed with PBS to remove the residual dye and were harvested by trypsin. Then, the cells were pelleted and washed once with PBS, then immediately analysed by FACSCalibur. The fluorescence was recorded in the FL1 channel with 15 000 cells.

2.10 Detection of apoptotic population

To determine the apoptosis-inducing effect of the curcumin nanoconjugates, the following two experiments were carried out.

2.10.1 FITC-annexin V and PI based double staining. One of the classical methods for determining apoptotic population is the double staining of the cells with FITC-conjugated Annexin V and PI (FITC Annexin V Apoptosis Detection Kit II, BD Biosciences, USA) and detection by flow cytometry. One of the early signs of cells undergoing apoptosis is the loss of integrity of the plasma membrane, where phosphotidylserine (PS) flips from the inner to the outer part of the membrane. Calcium dependent protein Annexin V has a very high affinity to PS. By exploiting this property, cells undergoing apoptosis can be quantitatively detected following the manufacturer's protocol. In brief, both U87MG and U87-IκBα cells grown in 60 mm plates were treated with curcumin nanoconjugates for 16 h. Then, the floating and attached cell populations were collected, washed with PBS, counted by Neubauer hemocytometer and then suspended in binding buffer following the manufacturer's protocol. The cells were incubated with Annexin V antibody and PI and analysed using FACS.

2.10.2 Caspase-3 based flow cytometry analysis. Caspases (cistenyl aspartate specific proteases) are a specific family of proteins, which play an important role in apoptosis. Caspases play different roles in various stages of apoptosis. Caspase-3 is commonly regarded as the effector caspase. Thus, the caspase-3 level is an important indicator of apoptosis. U87MG and U87-IκBα cells were plated in equal number (10⁵ cells per plate) in 100 mm plates. Then, the cells were left to become confluent up to 70% of the plate surface area, and were treated with curcumin nanoconjugates. After 14 h of treatment, the media was removed carefully, washed with cold PBS (10 mM, pH-7.4) and harvested with trypsin. The detached or semi attached cells were removed with DMEM containing FBS (also trypsin was neutralized), and centrifuged at 450×g for 6 min in 4 °C. The cells were counted with a hemocytometer and washed twice with cold PBS. Then, the cells were fixed with 0.1% formaldehyde in PBS in 37 °C for 10 min. After the fixing solution was removed, the cells were washed carefully with PBS to avoid losing the cells and permeabilized with 0.5% tween-20 in PBS for 10 min at room temperature under mild shaking. After 10 min, the cells were collected by centrifugation and washed with PBS two times. According to the initial count, 20 μL of antibody/10⁶ cells (as per manufacturer's instruction) were added to the samples and incubated for 30 min at room temperature in the dark. Then, the samples were immediately analysed by FACS with 15 000 cells per experiment. The data was analysed by histogram analysis using the BD Cellquest Pro™ software.

3. Results and discussion

3.1 Cloning of IκBα in pCINeo vector

The IκBα gene was cloned into the pCINeo vector, as described in the Materials and Methods section. In brief, the IκBα gene was released from the pGEM-T Easy backbone by EcoRI and SpeI digestions. The pCINeo backbone was also digested with Eco RI and Xba I. Then, the digested insert and vector were ligated. The ligated product was transformed into E. coli and plated on agar plate with ampicillin screening. The cloning was investigated by digestion with Eco RI and Not I, which generated a 970 bp fragment (Fig. 1A).

Fig. 1 Cloning and expression of cloned pCINeo-IκBα in U87MG cells. (A) Cloning of IκBα in pCINeo vector. L1: marker, L2: control pCINeo, L3: IκBα-pCINeo plasmid, L4: IκBα-pCINeo digested with EcoRI and NotI, L5: IκBα PCR product. (B) Overexpression of IκBα by semiquantitative PCR. L1: marker, L2: IκBα expression in U87-IκBα cells, L3: control U87MG, L4: β-actin expression in U87-IκBα cells, L5: β-actin in untransfected U87MG. (C) Overexpression of IκBα in transfected U87MG cells determined by real time PCR. (D) Overexpression of IκBα determined by Western blotting method. L1 – U87MG cells alone, L2 – U87-IκBα cells.

3.2 Overexpression of IκBα in U87-IκBα cells

The IκBα overexpressing U87-IκBα cell line was established by lipofectamine based transfection followed by G418 antibiotic selection, as described in the Materials and Methods section. The RNA was isolated and cDNA was synthesized from U87-IκBα and untransfected U87MG cell lines. The overexpression of full length IκBα was observed after 30 cycles of PCR using gene specific primers compared to the housekeeping β-actin as a loading control. Higher expression of IκBα in transfected cell lines as compared to untransfected U87MG cells was observed, whereas the β-actin band intensity remained unchanged (Fig. 1B).

Further, the overexpression was probed by real time PCR using gene specific real time PCR primers (ESI Table 1†). There also, almost threefold higher expression was observed by calculating the overexpression from the threshold cycle (C_t) by the Pfaffle method (Fig. 1C).

The IκBα overexpression was also confirmed at the protein level by the immunoblotting method against mouse anti-human IκBα antibody using β-actin as a loading control (Fig. 1D). HRP conjugated goat anti-mouse antibody was used as a secondary antibody.

3.3 Effect of 5-FU on U87MG and U87-IκBα cells

3.3.1 5-FU sensitization of U87MG and U87-IκBα cells. U87MG cells are known to be 5-FU resistant at an admissible range. Therefore, 5-FU was chosen to determine whether IκBα overexpression has any effect on the sensitization of U87MG cells. After treatment for 48 h at concentrations ranging from 0 μM to 100 μM, the MTT based anti-cell proliferative assay showed that U87-IκBα cells were more sensitive towards 5-FU than U87MG cells (Fig. 2A) at a longer time scale (72 h). In addition, the same trend of sensitization was observable (Fig. S4†), which unambiguously indicated that IκBα played an important role in the sensitization of U87MG cells towards 5-FU.

Fig. 2 Effect of 5-FU on U87MG and U87-IκBα cells. (A) Anti-cell proliferative effect of 5-FU on U87MG and U87-IκBα cells. All the data are represented as mean ± S.D., and statistical analysis was performed by two way ANOVA using SigmaPlot software. Statistical significances between treated samples with significant p values (<0.05) are mentioned and p < 0.001 are denoted by ***. (B) Effect of 5-fluorouracil on the cell cycle of U87MG upon 48 h treatment by flow cytometry. (C) Effect of 5-fluorouracil on the cell cycle of U87-IκBα upon 48 h treatment determined by flow cytometry.

3.3.2 Effect of 5-FU on cell cycle. The effect on the cell cycle was investigated by PI-mediated cell cycle analysis in a dose dependent manner for 48 h treatment. From the histogram analysis of each phase of the cell cycle using ModFit™ software, it is evident that 5-FU has a differential effect on U87MG cells and U87-IκBα cells with almost no sub G0 population in both the types of cells. However, with increasing 5-FU concentration, U87MG cells showed a higher number of cells in G1 phase, as compared to untreated U87MG cells (Fig. 2B).

However, interestingly, U87-IκBα cells showed a higher number of cells in G1 and S phases with diminishing G2 phase at 50 μM of 5-FU. However, at 100 μM 5-FU concentration, cells showed significant G1 phase arrest with a reduced number of cells in S phase and G2 phase (Fig. 2C). The result indicated that the overexpression of IκBα changes the cellular response towards 5-FU with increasing concentration.

3.4 Synthesis and characterization of curcumin nanoconjugates

Water soluble curcumin NPs were synthesized by a solvent evaporation method, as described in an earlier section. The formation of the NPs was confirmed by UV spectroscopy, fluorescence spectroscopy and TEM studies. The curcumin NPs showed intrinsic green emission of curcumin at 550 nm when excited at 430 nm. There was no significant difference in their emission after the addition of the poly-L-lysine (PLL) and BSA, which served as a surface stabilizing agent for the NPs (Fig. 3A). It is worth mentioning that PLL and BSA together played important roles for providing positive charge as well as the stabilization of the nanoconjugates (Fig. S2†). A surface charge for nanoparticles between −10 mV to +10 mV is ideal for cellular internalization.^46,47 The TEM image of the curcumin nanoconjugates revealed that most of the NPs were spherical in nature and the average particle size was found to be 225 ± 40 nm. The particle size distribution obtained from TEM images was calculated using Image J software, and is shown in the ESI (Fig. S1†). To substantiate the abovementioned results, the hydrodynamic diameter was determined by dynamic light scattering analysis (DLS). The hydrodynamic diameter or Z-average diameter and zeta potential of the NPs were found to be 267 ± 20 nm and 10.6 ± 3.5 mV, respectively, which indicates that the size and the surface properties of the NPs are suitable for cellular uptake.^48,49 Representative TEM images and the hydrodynamic diameter of the protein loaded particle are shown below (Fig. 3B and C).

Fig. 3 Characterization of curcumin nanoconjugates by (A) emission spectra showing the emission of curcumin at 550 nm when excited at 430 nm. (B) TEM image of the curcumin nanoconjugates. (C) DLS data showing the hydrodynamic diameter of the curcumin nanoconjugates (267 nm).

3.5 Effect of curcumin nanoconjugates on cells

3.5.1 Cell viability assay. The impact of IκBα loaded curcumin NPs was tested on U87MG cells along with curcumin nanoconjugates to elucidate the effect of curcumin NPs alone because BSA is commonly considered to be nontoxic to cells. Cells were treated with curcumin nanoconjugates, ranging from 1.87 μg mL⁻¹ (containing 60 ng mL⁻¹ of BSA) to 7.5 μg mL⁻¹ (containing 235 ng mL⁻¹ of BSA) for 24 h. Thus, the effects of the various concentrations of curcumin nanoconjugates were tested on both U87MG and U87-IκBα cell lines (Fig. 4A). Higher efficacy was found in U87-IκBα cells, which indicated the role of IκBα in the sensitization of U87MG to the curcumin nanoconjugates. Only curcumin NPs were found to have insignificant cytotoxicity (Fig. S5†).

Fig. 4 Effect of curcumin nanoconjugates on U87MG and U87-IκBα cells. (A) Anti-cell proliferative effect of curcumin nanoconjugates on U87-IκBα and U87MG cells. (B) Cell cycle analysis of U87MG and U87-IκBα cells treated with curcumin nanoconjugates for 24 h. All the data are represented as mean ± S.D. of three individual experiments and the statistical analysis was performed by two way ANOVA using SigmaPlot software. Statistical significances between treated samples with significant p values (<0.05) are mentioned and p < 0.001 are denoted by ***.

3.5.2 Effect of curcumin nanoconjugates on cell cycle. The effect of curcumin nanoconjugates on the cell cycle was studied after the cell viability assay results were obtained. The U87-IκBα cells were treated with curcumin nanoconjugates for 24 h, stained with PI, and analysed by flow cytometry with 15 000 cells for each sample. Higher numbers of cells in sub G0 population were found in curcumin nanoconjugate-treated IκBα overexpressing U87MG cells compared to the ordinary U87MG cells. In addition, for curcumin nanoconjugate-treated IκBα overexpressing cells, higher numbers of cells were found in the G1 phase with a lower number of cells in the S and G2 phases compared to untreated overexpressing cells and treated and untreated ordinary U87MG cells. Thus, the possibility of a greater amount of apoptosis of curcumin nanoconjugate-treated U87-IκBα cells emerges from the flow cytometry analysis (Fig. 4B).

3.5.3 Gene expression analysis. The expressions of cell cycle related genes, such as cyclin D1, cyclin D2, p27 and p21, were determined to establish the underlying molecular events. Both curcumin and IκBα were found to modulate the expression of cyclin D1 via the inhibition of NFκB.^42,43 The expression of cyclin D1 was found to be downregulated in curcumin nano-conjugate-treated U87MG cells compared to the untreated cells, which led to G1 phase arrest (Fig. 5A). Further, untreated U87-IκBα cells were found to express even at lower levels of cyclin D1 as a result of IκBα overexpression, which might lead to the inhibition of NFκB compared to U87MG cells (both treated and untreated). Further, the curcumin nanoconjugate-treated cells showed low cyclin D1 expression, although the difference was not significant when compared to untreated cells (Fig. 5A). Cyclin D2 is another D-type cyclin critical for G1 to S progression of the cell cycle. There is no conclusive report stating that curcumin modulates the expression of cyclin D2 in U87MG cells, although there is a report on the activation of cyclin D2 by NFκB in T cells and resting fibroblasts.⁴⁴ Here, upon treatment with curcumin nanoconjugates, more than fourfold overexpression was observed for cyclin D2 in treated ordinary U87MG cells, which indicated that the U87MG cells were undergoing proliferation and survival upon treatment, leading to higher expression of cyclin D2. However, surprisingly, in U87-IκBα cells, the cyclin D2 expression level was found to be noticeably lower (by almost twofold) compared to untreated ordinary U87MG cells. Upon treatment with curcumin nanoconjugates, cyclin D2 expression was found to be significantly low, which indicated that there was a synergistic effect of both curcumin and IκBα on the curcumin NP-mediated sensitization (Fig. 5B).

Fig. 5 Real time PCR analysis of cell cycle related genes upon treatment with curcumin nanoconjugates: (A) cyclin D1, (B) cyclin D2, (C) p27 and (D) p21. All data are represented as mean ± S.D. and the statistical analysis was performed by rank sum test followed by Student's t test using SigmaPlot software. Statistical significances between untreated control and treated samples were denoted by mentioning p values above the results or by denoting *** when p < 0.001.

The role of p21 and p27 has also been determined in the TNF-α mediated inhibition of human glioma cell proliferation.⁴⁵ The role of NFκB and curcumin mediated upregulation of p21 and p27 has also been reported.^46,47 at the protein level. Here, the expression level of p27 (Fig. 5C) and p21 (Fig. 5D) has been measured upon treatment with curcumin nanoconjugates. p27 expression was found to be higher in treated U87MG cells as compared to the untreated cells. For U87-IκBα cells, p27 expression was found to be higher in untreated cells compared to the U87MG cells. In treated cells, p27 expression was found to be significantly higher (almost three fold as compared to untreated U87MG cells and almost two fold as compared to treated U87MG and untreated U87-IκBα cells). Similarly, p21 was also found to be differentially overexpressed for both the types of treated cells compared to their corresponding untreated cells (Fig. 5D). The results indicated that cell cycle arrest in the G1 to S phase transition leading to apoptosis²⁷ is responsible for curcumin nanoconjugate-mediated sensitization of IκBα overexpressing glioma cells, which was found to be significantly higher compared to the glioma cells.

3.5.4 Microscopic analysis. Microscopic analysis was carried out on both the types of cells after treatment with curcumin nanoconjugates for 12 h, and the cells were stained with DAPI and ethidium bromide (EB). DAPI is a nuclear staining dye and EB only enters the membrane-compromised cells. The goal of the experiment was to identify live and dead cells after treatment with curcumin nanoconjugates. A higher number of EB positive cells, which are membrane compromised, were found in IκBα overexpressing U87MG cells compared to untransfected U87MG cells, which indicates that curcumin played a pro-apoptotic role in both the types of U87MG cells but more prominently in the U87-IκBα cells (Fig. 6A–H). Furthermore, the cells were stained with another nuclear staining dye, Hoescht 33342, that readily enters the cell and binds with DNA. BSA-loaded curcumin nanoconjugates were also added to the cells and the interaction of the curcumin nanoconjugates with the cells is shown after 3 h (Fig. S3†).

Fig. 6 Fluorescence microscopy image of curcumin nanoconjugate-treated and untreated U87MG and U87-IκBα cells stained with DAPI and EB. (A) Untreated U87MG cells stained with DAPI. (B) Untreated U87MG cells stained with EB. (C) Treated U87MG cells stained with DAPI. (D) Treated U87MG cells stained with EB. (E) Untreated U87-IκBα cells stained with DAPI. (F) Untreated U87-IκBα cells stained with EB. (G) Treated U87-IκBα cells stained with DAPI. (H) Treated U87-IκBα cells stained with EB. Scale bar 100 μm.

3.5.5 ROS generation study. The generation of reactive oxygen species (ROS) influences apoptotic events. The induction of apoptosis by protein loaded curcumin nanoparticles was studied in the previous section. Here, the effects of curcumin nanoconjugates upon IκBα overexpressing U87MG cells and ordinary U87MG cells have been studied by flow cytometry-based and DCFDA-based ROS measurements. It was found that upon treatment with curcumin nanoconjugates for 3 h, U87-IκBα cells showed a higher ROS generation (Fig. 7B) compared to U87MG (Fig. 7A), which played an important role in the curcumin nanoconjugate-mediated apoptosis. Only curcumin NPs were found to induce insignificant ROS in both U87M and U87-IκBα cells (Fig. S4†).

Fig. 7 Effect of curcumin nanoconjugates on U87MG and U87-IκBα cells. (A) ROS generation assay for U87MG cells. (B) ROS generation assay for U87-IκBα cells. Detection of apoptosis in U87MG cells by FITC-Annexin V and PI double staining. (C) Untreated U87MG, (D) U87MG cells treated with curcumin nanoconjugates for 12 h, (E) untreated U87-IκBα cells and (F) U87-IκBα cells treated with curcumin nanoconjugates for 12 h. Detection of apoptosis by caspase-3 assay in U87MG cells following treatment with curcumin nanoconjugates for 14 h. (G) untreated U87MG cells and (H) U87MG cells treated with curcumin nanoconjugates, (I) untreated U87-IκBα cells and (J) U87-IκBα cells treated with curcumin nanoconjugates.

3.5.6 Detection of apoptosis. In addition to cell viability assays, PI-based flow cytometry and microscopy analysis, the mode of cell death was confirmed by the Annexin V-FITC and PI based double staining method by flow cytometry. As mentioned earlier, in the early apoptosis stage, phopsphotidyl serine (PS) of the inner membrane is exposed outward, which is recognised by the FITC tagged Annexin V antibodies. Propidium iodide was also used to identify late apoptotic and necrotic cells. In flow cytometry, the curcumin nanoconjugate-treated (for 12 h) U87-IκBα cells showed a greater number of early apoptotic cells (9.12%) (Fig. 7F) compared to the treated U87MG cells (3.17%) (Fig. 7D). This result confirmed that the mode of cell death was apoptosis.

Caspase-3 is called the executioner caspase in apoptosis events. The heightened activity of caspase-3 during apoptosis is detected by FACS based caspase-3 assay. PE-conjugated anticaspase-3 antibody is used for studying the apoptosis event. The mode of cell death was reconfirmed by FACS based caspase-3 assay. Among BSA-curcumin NP-treated cells, U87-IκBα cells showed a higher number of caspase-3 positive cells (29%) (Fig. 7J) than ordinary U87MG cells (12.7%) (Fig. 7H) after 14 h of treatment. Thus, the IκBα overexpressing cells showed more sensitivity than ordinary U87MG cells towards BSA curcumin NPs.

3.6 Combined effect of 5-FU and curcumin nanoconjugates

U87MG and U87-IκBα cells were treated in combination with 5-FU and curcumin nanoconjugates. This experiment was carried out in two ways: first, the cells were treated with different concentrations of 5-FU along with a fixed concentration of curcumin nanoconjugates (5 μg mL⁻¹). It was found that in the presence of curcumin NPs, the U87-IκBα cells became more sensitized towards 5-FU (Fig. 8A). The result indicated that U87MG conferred resistance toward common anticancer drug 5-FU, even in the presence of curcumin NPs. However, IκBα overexpression sensitized U87MG significantly towards the combination therapy.

Fig. 8 Comparative study of the combined effects of 5-FU and curcumin nanoconjugates on U87MG and U87-IκBα cells. (A) Effect of 5-FU in combination with curcumin nanoconjugates (5 μg mL⁻¹). (B) Effect of curcumin nanoconjugates in combination with 5-FU (50 μM). All the data are represented as mean ± S.D. and the statistical analysis was performed by two way ANOVA using SigmaPlot software. Statistical significances between treated samples with significant p values (<0.05) are mentioned and p < 0.001 are denoted by ***.

In another combination approach, the cells were treated with different concentrations of curcumin nanoconjugates with a fixed concentration of 5-FU (50 μM). Cell viability decreased steadily in both the cell lines with increasing concentrations of curcumin nanoconjugates. It was found that both the cell lines were equally sensitized by the combination but the effect was more prominent in U87-IκBα cells (Fig. 8B).

The combination module exhibited higher cytotoxicity compared to its individual components, which could be due to the actions of 5-FU, curcumin and IKBα in tandem. Earlier reports suggest that 5-FU suppresses NFκB activity and induces apoptosis in human salivary gland cancer cells by inhibiting IKKs.^50,51 In addition, the presence of another inhibitor of NFκB, curcumin may also have contributed to a greater therapeutic effect on U87MG cells. In our study, curcumin nanoconjugates, may inhibit NFκB signalling pathways upon entering the cells,^27,30 possibly because of the known cytotoxic effect of curcumin towards cancer cells. Hence, the combination effect of 5-FU, curcumin nanoconjugates and stably expressed IκBα, which is also an inhibitor of NFκB signalling, showed heightened anti-cancer effects in U87-IκBα cells.

3.7 Higher stability of IκBα

The stability of IκBα was investigated by immunoblotting. We observed sustained expression of IκBα in U87-IκBα cells with respect to U87MG cells. Initially (0 min), the IκBα amount was higher in U87-IκBα cells, as expected, but at the next time point (40 min), the expression level of IκBα dropped further in U87-IκBα cells than in only U87MG cells. Furthermore, at 100 min, the IκBα level in transfected U87MG cells was found to be stable, whereas there was a steady decrease in the amount of IκBα for U87MG cells. After 3 h, it was found that the expression level of IκBα diminished to almost zero (Fig. 8B), whereas the amount of IκBα remained almost the same for U87-IκBα cells (Fig. 8A). The result indicated that upon treatment with curcumin nanoconjugates, the NFκB-mediated survival mechanism of cells became active resulting in the degradation of IκBα, although at a slower rate, because curcumin is an NFκB inhibitor. However, for IκBα overexpressing U87-IκBα cells, the stability of IκBα was found to have increased despite an initial drop in the amount of IκBα compared to the U87MG cells, which indicates a higher sensitization of U87-IκBα cells towards curcumin nanoconjugates (Fig. 9).

Fig. 9 Time dependent stability of IκBα in U87MG and U87-IκBα cells after treatment with curcumin nanoconjugates probed by Western blotting. (A) IκBα in U87-IκBα cells, (B) IκBα in U87MG cells, (C) β-actin as loading control in U87-IκBα cells, (D) β-actin as loading control in U87MG cells. (E) Change in the average intensity of IκBα in U87MG and U87-IκBα cells with time.

4. Conclusions

In conclusion, IκBα was cloned into mammalian expression vector pCINeo and transfected into malignant glioblastoma cell line U87MG by a lipofectamine-based method. The IκBα overexpressing U87-IκBα cell line was established by screening with antibiotic G418. The overexpression of IκBα was investigated by semiquantitive RT PCR, real time PCR and Western blotting with anti-IκBα antibodies. The cell viability assay result indicated that U87-IκBα cells are more sensitive than U87MG cells to 5-FU. A FACS-based cell cycle study using PI staining revealed that the different phases of the cell cycle were blocked upon the treatment of U87MG and U87-IκBα cells with 5-FU. These results revealed that IκBα overexpression sensitized the U87MG cells but they did not undergo apoptosis. Furthermore, curcumin nanoconjugates were administered to U87-IκBα and U87MG cells. It was found by cell viability assay that this module has a relatively greater anti-cell proliferative effect upon transfected U87MG cells. Further, the mode of cell death was microscopically examined by ethidium bromide (EB) based staining along with the intrinsic fluorescence of curcumin. A higher number of BSA-curcumin NP-treated U87-IκBα cells were found to be stained with EB, which only enters into membrane compromised cells. Further, the effects were checked by the flow cytometry assay with the following experiments: PI-based cell cycle analysis and the determination of sub G0 population (commonly regarded as dead cells), FITC-conjugated Annexin V and PI-based determination of apoptotic cells and PE conjugated caspase-3 antibody-based staining to determine the caspase-3 positive cell population (the cells undergoing apoptosis). Furthermore, the expression of some cell cycle-related genes was checked by real time PCR. Then, the combinatorial effect of 5-FU and curcumin nanoconjugates upon the U87MG and U87-IκBα cells was checked by cell viability determination, which showed that variable concentrations of curcumin nanoconjugates with a fixed concentration of 5-FU (50 μM) have greater anti-cell proliferative effects compared to different concentrations of 5-FU with a fixed (5 μg mL⁻¹) concentration of curcumin nanoconjugates. However, this combinatorial effect was higher than that of 5-FU alone. Thus, this work demonstrated that curcumin and IκBα heighten the effects of 5-FU. Furthermore, upon treatment with curcumin nanoconjugates at different time points, the half-life of IκBα was found to increase in IκBα transfected cells compared to only U87MG cells, which may have an important role in sensitizing the U87MG cells towards 5-FU or curcumin NPs. The possible mode of action of the 5-FU and curcumin nanoconjugates upon U87-IκBα cells is depicted in Scheme 2.

Scheme 2 Mode of action of 5-FU and curcumin nanoconjugates on U87-IκBα cells.

Acknowledgements

The work was supported by the Department of Biotechnology (Project nos BT/49/NE/TBP/2010 and BT/01/NE/PS/08) and Department of Electronics and Information Technology, Government of India (no. 5(9)/2012-NANO (Vol. II)). Authors acknowledge assistance from the Central Instruments Facility (CIF) and the Centre for Nanotechnology, IIT Guwahati for TEM, FACS, Real time PCR and DLS facilities.

Notes and references

1. M. Mohri, H. Nitta and J. Yamashita, J. Neuro-Oncol., 2000, 49, 105–115.
2. D. Krex, B. Klink, C. Hartmann, A. von Deimling, T. Pietsch, M. Simon, M. Sabel, J. P. Steinbach, O. Heese, G. Reifenberger, M. Weller and G. Schackert, and for the German Glioma Network, Brain, 2007, 130, 2596–2606.
3. P. Jiang, R. Mukthavavam, Y. Chao, I. Bharati, V. Fogal, S. Pastorino, X. Cong, N. Nomura, M. Gallagher, T. Abbasi, S. Vali, S. C. Pingle, M. Makale and S. Kesari, J. Transl. Med., 2014, 12, 13.
4. H. Kuriyama, K. R. Lamborn, J. R. O’Fallon, N. Iturria, T. Sebo, P. L. Schaefer, B. W. Scheithauer, J. C. Buckner, N. Kuriyama, R. B. Jenkins and M. A. Israel, J. Neuro-Oncol., 2002, 4, 179–186.
5. H. L. Pahl, Oncogene, 1999, 18, 6853–6866.
6. C. Kuntzen, F. Zazzeroni, C. G. Pham, S. Papa, C. Bubici, J. R. Knabb and G. Franzoso, Methods Mol. Biol., 2007, 399, 99–124.
7. A. S. Baldwin, J. Clin. Invest., 2001, 107, 3–6.
8. M. S. Hayden and S. Ghosh, Genes Dev., 2004, 18, 2195–2224.
9. M. S. Hayden and S. Ghosh, Cell, 2008, 132, 344–362.
10. G. Ghosh, G. V. Duyne, S. Ghosh and P. B. Sigler, Nature, 1995, 373, 303–310.
11. T. Gilmore, M.-E. Gapuzan, D. Kalaitzidis and D. Starczynowski, Cancer Lett., 2002, 181, 1–9.
12. F. Arenzana-Seisdedos, P. Turpin, M. Rodriguez, D. Thomas, R. T. Hay, J. L. Virelizier and C. Dargemont, J. Cell Sci., 1997, 110(Pt 3), 369–378.
13. P. A. Baeuerle and D. Baltimore, Science, 1988, 242, 540–546.
14. B. Kaltschmidt, C. Kaltschmidt, S. P. Hehner, W. Dröge and M. L. Schmitz, Oncogene, 1999, 18, 3213–3225.
15. C. Y. Wang, M. W. Mayo and A. S. Baldwin Jr, Science, 1996, 274, 784–787.
16. B. Haefner, Cancer Treat. Res., 2006, 130, 219–245.
17. G. Madonna, C. Ullman, G. Gentilcore, G. Palmieri and P. Ascierto, J. Transl. Med., 2012, 10, 53.
18. J. Adams, V. J. Palombella, E. A. Sausville, J. Johnson, A. Destree, D. D. Lazarus, J. Maas, C. S. Pien, S. Prakash and P. J. Elliott, Cancer Res., 1999, 59, 2615–2622.
19. S. Karmakar, N. L. Banik and S. K. Ray, Neurochem. Res., 2007, 32, 2103–2113.
20. X. Gao, D. Deeb, H. Jiang, Y. B. Liu, S. A. Dulchavsky and S. C. Gautam, J. Exp. Ther. Oncol., 2005, 5, 39–48.
21. K. M. Dhandapani, V. B. Mahesh and D. W. Brann, J. Neurochem., 2007, 102, 522–538.
22. A. Duvoix, R. Blasius, S. Delhalle, M. Schnekenburger, F. Morceau, E. Henry, M. Dicato and M. Diederich, Cancer Lett., 2005, 223, 181–190.
23. S. Singh and A. Khar, Anti-Cancer Agents Med. Chem., 2006, 6, 259–270.
24. A. C. Bharti, Blood, 2003, 101, 1053–1062.
25. T. Choudhuri, S. Pal, T. Das and G. Sa, J. Biol. Chem., 2005, 280, 20059–20068.
26. R. K. Srivastava, Q. Chen, I. Siddiqui, K. Sarva and S. Shankar, Cell Cycle, 2007, 6, 2953–2961.
27. S. Shishodia, H. M. Amin, R. Lai and B. B. Aggarwal, Biochem. Pharmacol., 2005, 70, 700–713.
28. S. Shishodia, P. Potdar, C. G. Gairola and B. B. Aggarwal, Carcinogenesis, 2003, 24, 1269–1279.
29. P. Anand, A. B. Kunnumakkara, R. A. Newman and B. B. Aggarwal, Mol. Pharm., 2007, 4, 807–818.
30. S. Bisht, G. Feldmann, S. Soni, R. Ravi, C. Karikar, A. Maitra and A. Maitra, J. Nanobiotechnol., 2007, 5, 3.
31. J. Shaikh, D. D. Ankola, V. Beniwal, D. Singh and M. N. V. R. Kumar, Eur. J. Pharm. Sci., 2009, 37, 223–230.
32. M. L. Wang, W. K. Yung, M. E. Royce, D. F. Schomer and R. L. Theriault, Am. J. Clin. Oncol., 2001, 24, 421–424.
33. S. Chockalingam and S. S. Ghosh, PLoS One, 2013, 8, e83877.
34. K. Kurozumi, T. Tamiya, Y. Ono, S. Otsuka, H. Kambara, Y. Adachi, T. Ichikawa, H. Hamada and T. Ohmoto, J. Neuro-Oncol., 2004, 66, 117–127.
35. K. Kawamura, R. Bahar, H. Namba, M. Seimiya, K. Takenaga, H. Hamada, S. Sakiyama and M. Tagawa, Int. J. Oncol., 2001, 18, 117–120.
36. K. Datta, P. Shah, T. Srivastava, S. G. Mathur, P. Chattopadhyay and S. Sinha, Cancer Gene Ther., 2004, 11, 525–531.
37. N. M. Patel, S. Nozaki, N. H. Shortle, P. Bhat-Nakshatri, T. R. Newton, S. Rice, V. Gelfanov, S. H. Boswell, R. J. Goulet, G. W. Sledge and H. Nakshatri, Oncogene, 2000, 19, 4159–4169.
38. J. Miyakoshi and K. Yagi, Br. J. Cancer, 2000, 82, 28–33.
39. R. Berger, C. Jennewein, V. Marschall, S. Karl, S. Cristofanon, L. Wagner, S. H. Vellanki, S. Hehlgans, F. Rödel, K.-M. Debatin, A. C. Ludolph and S. Fulda, Mol. Cancer Ther., 2011, 10, 1867–1875.
40. S. Banerjee, A. K. Sahoo, A. Chattopadhyay and S. S. Ghosh, RSC Adv., 2013, 3, 14123–14131.
41. M. W. Pfaffl, Nucleic Acids Res., 2001, 29, e45.
42. D. Joyce, C. Albanese, J. Steer, M. Fu, B. Bouzahzah and R. G. Pestell, Cytokine Growth Factor Rev., 2001, 12, 73–90.
43. A. Mukhopadhyay, S. Banerjee, L. J. Stafford, C. Xia, M. Liu and B. B. Aggarwal, Oncogene, 2002, 21, 8852–8861.
44. R. Iwanaga, E. Ozono, J. Fujisawa, M. A. Ikeda, N. Okamura, Y. Huang and K. Ohtani, Oncogene, 2008, 27, 5635–5642.
45. P. Kumar, A. Shiras, G. Das, J. C. Jagtap, V. Prasad and P. Shastry, Mol. Cancer, 2007, 6, 42.
46. B. B. Aggarwal, S. Banerjee, U. Bharadwaj, B. Sung, S. Shishodia and G. Sethi, Biochem. Pharmacol., 2007, 73, 1024–1032.
47. N. Hasima and B. B. Aggarwal, Curr. Med. Chem., 2014, 21, 1583–1594.
48. M. E. Davis, Mol. Pharm., 2009, 6, 659–668.
49. A. Swami, J. Shi, S. Gadde, A. R. Votruba, N. Kolishetti and O. C. Farokhzad, in Multifunctional Nanoparticles for Drug Delivery Applications, ed. S. Svenson and R. K. Prud'homme, Springer US, Boston, MA, 2012, pp. 9–29.
50. K. Aota, M. Azuma, T. Yamashita, T. Tamatani, K. Motegi, N. Ishimaru, Y. Hayashi and M. Sato, Biochem. Biophys. Res. Commun., 2000, 273, 1168–1174.
51. M. Azuma, T. Yamashita, K. Aota, T. Tamatani and M. Sato, Biochem. Biophys. Res. Commun., 2001, 282, 292–296.

---

Footnote

† Electronic supplementary information (ESI) available. See DOI: 10.1039/c4ra03994g

---