Evaluation of laser-induced graphene for skeletal muscle tissue engineering applications

Abstract

This study explores the potential of laser-induced graphene (LIG) as a conductive, biocompatible material for musculoskeletal tissue engineering applications. Using laser irradiation, polyimide (PI) substrates were transformed into highly graphitic, porous LIG with a distinct fibril morphology and surface topography. Characterization analyses, including Raman spectroscopy and X-ray diffraction (XRD), confirmed the graphitic nature of LIG, while electrical conductivity measurements indicated a value of 5.8 ± 0.2 S cm⁻¹, with the surface demonstrating hydrophobicity (contact angle of 95.3° ± 1.9°). Biocompatibility tests using the C2C12 myoblast cell line showed high cell viability and alignment along the laser-induced pattern of LIG, an attribute essential for muscle tissue engineering. Cells cultured on LIG demonstrated progressive proliferation and expression of myogenic markers under reduced serum conditions, indicating the ability of LIG to support myogenic differentiation. These findings highlight LIG as a promising biomaterial that combines bioelectrical functionality with structural support, offering new avenues for developing advanced microsystems interacting with cells, leading to novel tissue engineering solutions for muscle repair and regeneration.

---

1. Introduction

Graphene and its derivatives have attracted significant interest in the biomedical field, particularly for musculoskeletal tissue regeneration, due to their outstanding physicochemical properties, including mechanical properties, electrical conductivity, and biocompatibility.^1–3 These attributes make graphene an excellent candidate for developing scaffolds that not only support cellular growth but also enhance the bioelectrical signaling essential for tissue repair. In musculoskeletal tissue repair, graphene can provide the structural integrity and biochemical environment needed for the regeneration of bone, muscle, and cartilage.^2–4

However, the nanoscale nature of graphene materials presents challenges for direct scaffold fabrication, necessitating embedding graphene materials within a polymeric, ceramic, or metallic matrix to enable scaffold formation.^3,5 Additionally, nanoscale graphene has been reported to have cytotoxic activities, inducing cell death through cell membrane rupture or alterations in cell metabolism upon internalization,^6,7 requiring careful design and control when using graphene for biomedical applications. The need for graphene composites also introduces fabrication challenges, as achieving adequate structural scale and resolution is crucial for optimizing tissue regeneration. Furthermore, these composites often contain low graphene loading, which can dilute the intrinsic bioactive properties of graphene due to the influence of the host matrix. Conventional synthesis methods for graphene nanomaterials are also limited by high costs and the need for complex infrastructures, making them less accessible for scalable applications.

In recent years, laser-induced graphitization has emerged as a promising, facile, and cost-effective technique for synthesizing graphene materials. This method has gained popularity in fabricating graphene-based devices due to its rapid processing, scalability, and the ability to create customizable designs. Laser-induced graphene (LIG) is produced by converting polymeric precursors into a graphene-rich, porous carbon network through a photo-thermochemical reaction triggered by laser irradiation.^8–10 This process can be achieved under ambient conditions, allowing LIG to be directly patterned into diverse 2D geometries using standard laser engraving machines. Although polyimide is the most common precursor substrate, various other polymeric materials have also been explored, broadening the versatility of LIG. Due to its conductive, high surface-area structure and straightforward synthesis, LIG has been widely utilized in electronic applications, including sensors, actuators, and energy storage devices.^11–14

Despite its growing applications, the interaction of LIG with living cells and tissues, especially within the field of tissue engineering, remains underexplored. With its electrical conductivity and flexibility, LIG holds promise as a biomaterial, particularly for cardiac and skeletal muscle tissue, where electrical and mechanical properties play crucial roles in normal physiological functions. In this research, we characterized the resulting LIG material produced on polyimide sheets and evaluated for the first time the suitability of unmodified laser-induced graphene as a scaffold for skeletal muscle tissue engineering applications. This approach aims to support the development of a novel type of LIG-based scaffolds with optimal biological, mechanical, and electrical performance while avoiding the need for additional post-processing or manufacturing techniques typically required to generate graphene-based multi-material composites.

2. Experimental

2.1. Fabrication of LIG samples

The fabrication process of LIG material included the irradiation of an infrared CO₂ laser beam (wavelength = 10.6 μm, beam width at the focus = 120 μm) on commercially available polyimide sheets (Kapton™ HN by DuPont; thickness: 125 ± 13 μm) using a laser engraving machine (ULS Versa Laser 3.50). The laser treatment was conducted in engraving mode. The optimal parameters for the laser engraving included a speed of 15.6 cm s⁻¹, a power of 4.8 W, and a pulse rate of 1000 pulses per inch (PPI).

2.2. Characterization

The surface morphology of the LIG samples was examined using field emission scanning electron microscopy (FESEM; Apreo 2S LoVac, ThermoFisher Scientific). The surface topology of LIG was characterized by using a chromatic white light interferometer (Contour GT-K 3D Optical Microscope, Bruker, Germany). The water contact angle of the LIG surface was measured using a drop shape analyzer (Model: DSA25E, Kruss, Germany). The electrical conductivity of the LIG sample was characterized by measuring the sheet resistance and conductivity using a home-built four-point probe set-up and a digit multimeter (HAMEG HM8112-3 6½-digit precision multimeter).

X-ray diffraction (XRD) was performed using a PANalytical Empyrean setup with Cu-Kα radiation (λ = 1.54 Å) at room temperature. Raman spectroscopy of the LIG samples was conducted using a Renishaw inVia micro-Raman spectrometer with a laser wavelength of 532 nm (2.33 eV). The Raman spectrum of LIG was analyzed by deconvoluting the peaks with Lorentz peak fitting in OriginPro software (OriginLab Corporation, USA), which also provided the area under each peak. The crystallite size (L_a) of the LIG material was determined using the Tuinstra and Koenig equation, as adapted by Cançado et al.¹⁵ This method relates L_a to the laser wavelength (λ) and the integrated area ratio (A_D/A_G) of the D-band to G-band, as shown in eqn (1).

2.3. Cell culture experiments

2.3.1 Cell culture. Mouse C2C12 myoblast cells (CLS, cat. number 400476) were cultured in a complete culture medium consisting of DMEM high glucose (Gibco) supplemented with 10% fetal bovine serum (FBS, Corning) and 1% of antibiotic/antimycotic (Biowest). Cells were expanded at 37 °C, 5% CO₂ in a humidified atmosphere with media changes every 2–3 days. Around 80% of sub-confluent cells were collected using TrypLE™ express enzyme (Thermo Fisher) and seeded on samples according to the experiment. Cellular experiments were performed on LIG samples obtained from laser engraving of the entire area (1 × 1 cm²) of the precursor PI sheet. For comparison, an untreated PI sheet was also used for cell experiments as control samples. A checkerboard pattern with repeated PI and LIG regions featuring each square of 0.5 × 0.5 cm² area (sample name: PI-LIG), as shown in Fig. 1a, was also used for direct side-by-side comparison of cell growth on different materials, particularly for imaging. All samples were sterilized under UV light for 15 min per side, cleaned in 70% ethanol, and incubated with a complete culture medium for 1–2 h before cell seeding.

Fig. 1 (a) Schematic of the selective laser scribing process on polyimide sheets for fabricating LIG substrate and a digital photograph of the fabricated LIG-based substrate. The scale bar in the digital photograph is 5 mm. (b) SEM image of the precursor of polyimide substrate from the area (i) in (a), demonstrating a smooth surface texture. (c) SEM image of the LIG material obtained after the laser engraving from the area (ii) in figure (a). (d) High-magnification SEM image of the LIG substrate of the rectangular area highlighted in (c), illustrating its highly porous nature. (e) Surface topology of LIG material obtained from optical profilometry. (f) A height plot obtained by scanning along the LIG surface, showing the surface topography of LIG material.

2.3.2 Cell viability. Mouse C2C12 myoblasts were seeded on samples mentioned above and incubated in a complete culture medium at 37 °C. After 24 h, cell viability was evaluated using the live/dead viability/cytotoxicity kit (Thermo Fisher). Briefly, cells were washed in DPBS with Ca and Mg (Gibco) and incubated in a solution of 4 μM of ethidium homodimer-1 and 2 μM calcein AM (Invitrogen) in DPBS for 20 min at 37 °C. Cells were then washed in DPBS and immediately imaged using a FluoView FV3000 confocal laser scanning microscope (Olympus LS). Images from LIG and PI areas were taken from 3 material samples and the total number of alive and dead cells was quantified using Fiji software v.1.53t from at least 5 different images.

2.3.3 Cellular metabolic activity. Mouse C2C12 myoblasts were seeded on PI, LIG, and PI-LIG samples and cultured in a complete culture medium at 37 °C. Cells seeded on a plastic tissue culture plate were used as a control. After 1, 3, and 6 days of culture, cell activity was quantified using the resazurin cell viability assay (LabBox). Briefly, a 10% resazurin solution was prepared in a complete cell culture medium and added to the cell culture. After 3 h of incubation at 37 °C and 5% CO₂, the resazurin solution was transferred into a 96-well plate, and the fluorescence (E_x: 540 nm/E_m: 590 nm) was measured in an Infinite 200 Pro microplate reader (TECAN). Cells were washed with warm DPBS (Gibco) and incubated in fresh cell culture medium until the next measurement or media change. Results are shown as mean ± SD of a total of 6 replicates per condition.

2.3.4 Skeletal muscle differentiation. To induce myogenic differentiation of C2C12, cells were seeded on PI, LIG, and PI-LIG samples and cultured in DMEM high glucose with 5% FBS at 37 °C. After 6 days of culture in reduced serum conditions, cells were fixed in 4% paraformaldehyde (Thermo Fisher) for 15 min, permeabilized in 0.5% Triton X-100 (Sigma) for 10 min, and incubated with 5% bovine serum albumin (BSA) solution for 1 h. Samples were then incubated with a primary antibody against Myosin (1/40, Invitrogen PA5-31466) in 1% BSA for 1 h at RT (room temperature) and a secondary antibody conjugated with Alexa Fluor™ 488 (1/1000, Invitrogen A21206). DAPI (4′,6-diamidino-2-phenylindole, Invitrogen) was used as nuclear counterstaining, and images were acquired using a FluoView FV3000 confocal laser scanning microscope (Olympus LS). Cell orientation was analyzed using the directionality plugin in Fiji software v.1.53t from 3 different images.

After confocal imaging, samples were dried in increasing ethanol concentrations (30%, 50%, 70%, 90%, and 100%) for 10 min each, as well as in hexamethyldisilazane (HDMS, Fisher Scientific) solutions in ethanol (33%, 50%, 66% and 100%). SEM of the cell-seeded materials was performed using an Apreo 2S LoVac scanning electron microscope (Thermo Fisher Scientific) in high vacuum mode and at an operating voltage of 5 kV. To avoid any charging effect during SEM, the samples were coated with 25 nm gold using sputtering with a voltage of 25 V, a current of 30 mA, and a deposition time of 120 min.

2.3.5 Gene expression. C2C12 cells were seeded on PI and LIG samples (1 × 1 cm) and cultured in DMEM high glucose with 5% FBS for 6 days, while cells cultured in tissue culture plates with 10% (control) or 5% FBS (diff. media) were used as negative and positive controls for differentiation respectively. Cells were then lysed and homogenized, and RNA was isolated following RNeasy® Mini Kit (Qiagen) instructions. RNA purity and quantity were evaluated using a NanoQuant Plate in an Infinite 200 Pro microplate reader (TECAN). The same amount of RNA was used for reverse transcription following instructions from QuantiTect reverse transcription kit (Qiagen). The real-time PCR was performed using the RealQ Plus 2× master mix green (Isogen) in a StepOnePlus™ real-time PCR system (Applied Biosystems). Primers used are listed in Table 1 and were purchased from Integrated DNA Technologies (IDT). After activation of the polymerase at 95 °C for 15 min, 40 cycles of denaturation-extension were performed at 95 °C for 20 s and 60 °C for 1 min, followed by melting curve analysis. The results were analyzed by the ΔΔCt method using GAPDH as a housekeeping gene.

Table 1 Primers used for RT-qPCR

Gene	Forward primer	Reverse primer
MYH1	CTGGATCTTGCGGAATTTGG	GGACAAACTGCAATCAAAGGTC
Desmin	GCTGACAACCTCTCCATCC	TCAACCTTCCTATCCAGACCT
MyoD	GACACAGCCGCACTCTT	GCTCTGATGGCATGATGGAT
Myogenin	GACCGAACTCCAGTGCATT	CTTGCTCAGCTCCCTCAAC
GAPDH	AATGGTGAAGGTCGGTGTG	GTGGAGTCATACTGGAACATGTAG

---

2.4 Statistical analysis

Origin software v.2021 was used for analysis and graphic design. Results are expressed as average ± standard deviation (SD). Multiple groups were compared using one-way ANOVA with Tuckey's post-hoc test. The value of p < 0.05 was considered statistically significant (*).

3. Results

Laser irradiation induced the in situ transformation of the PI substrate to LIG material through spontaneous photo-thermochemical decomposition.^16,17Fig. 1a illustrates a schematic representation of the laser-irradiation process, whereas the inset depicts an example of the fabricated LIG material with a checkerboard patterning. The precursor polyimide sheet featured a smooth surface texture, as shown in Fig. 1(b). In comparison, the LIG exhibited a highly porous and fibril morphology (Fig. 1c), with a wide range of pore sizes, from tens of nanometers to several micrometers, as estimated from the SEM images. The material also featured a directional linear pattern, which was yielded by the directionality of the laser engraving. High magnification SEM images further showed a more fibril morphology, as shown in Fig. 1d, which is also consistent with previous literature.^13,18–20 The porous and fibril network of the material also led to an uneven surface topology, as quantified by white light profilometry (Fig. 1e). This uneven nature is further emphasized in line scanning over the LIG surface, as presented in Fig. 1f, which yielded a surface roughness (R_a) of 3.4 ± 3.7 μm. The high standard deviation in the R_a value can be attributed to the sudden drops in LIG thickness, which represented the larger pores formed during the rapid conversion of PI into LIG and were also observed in the SEM images (Fig. 1c and d). The thickness of LIG was around 25 μm, as evaluated from the profilometry.

The carbon material produced through the laser engraving process was highly graphitic, as signified by Raman spectra and XRD diffractogram (Fig. 2). Fig. 2a presents the Raman spectra of the LIG material, exhibiting three prominent peaks located at approximately 1345 cm⁻¹, 1580 cm⁻¹, and 2690 cm⁻¹, corresponding to the D-band, G-band, and 2D-band, respectively.²¹ The D-band, appearing at 1345 cm⁻¹, is associated with a structural disorder in the hexagonal carbon rings and is linked to the A_1g breathing mode at the K-point.^22,23 The G-band, at 1580 cm⁻¹, results from the bond stretching of sp² carbon atoms within both hexagonal rings and linear chains, originating from the E_2g phonon mode at the Γ-point. The attributes of the characteristic peaks are presented in Table 1. The sharp peak of the G-band indicates the presence of highly graphitic carbon. Furthermore, a sharp peak of the 2D band, appearing at 2690 cm⁻¹ suggested the formation of stacked multi-layer graphene. However, the sharp D-peak indicated that the formed graphene layers in LIG were highly disordered. The two smaller peaks, identified as D + D′′ at 2445 cm⁻¹ and D + D′ at 2915 cm⁻¹, also arose from this disorder.²⁴ The intensity ratio (I_D/I_G) and area ratio (A_D/A_G) of D and G-band are typically considered as the degree of graphitization. These ratios for our LIG material were measured to be 0.95 and 1.05, respectively, suggesting a turbostratic arrangement of the graphene layers. These Raman peaks agree with previously published reports on PI-derived LIG material.^8,10,25 The in-plane crystallite size (L_a), as calculated from the area ratio of the Raman spectra, was 18.32 nm.

Fig. 2 (a) Raman spectra and (b) XRD pattern of the LIG material derived from polyimide sheet. (c) Demonstration of the electrically conductive nature of LIG through the example of LED. The left shows the LED not lighting up when LIG is not connected, whereas connecting LIG lights up the LED. (d) The water contact angle (WCA) of the precursor polyimide sheet (top) and LIG material (bottom).

Fig. 2b depicts the X-ray diffractogram of LIG material, highlighting the characteristic peak at 2θ = 25.6°, which can be assigned to the (002). The strong presence of this peak supports the highly graphitic nature of LIG.²⁶ Another characteristic reflection around 42.5° can be observed due to the (101) plane. Other peaks at 2θ = 22° and 36° can be assigned to the underneath polyimide film.²⁷

The electrically conductive nature of the LIG film was demonstrated by a facile LED bulb experiment, as shown in Fig. 2c. When the circuit was open, the bulb was off. When the circuit was closed through the LIG film, the bulb lit up, showing the good electrical conductivity of LIG. The electrical conductivity of the LIG film was measured to be 5.8 ± 0.2 S cm⁻¹, as presented in Table 2. The water contact angle (WCA) of the LIG film was 95.3° ± 1.9° (Fig. 2d), depicting its hydrophobic nature. In comparison, the precursor PI film showed a hydrophilic characteristic, featuring a WCA of 74.8° ± 0.5°.

Table 2 Different attributes obtained from the Raman spectra of LIG and other properties of LIG

Properties		Values
FWHM of Raman peaks (cm^−1)	D	68
	G	61
	2D	96
Raman intensity ratio	I D/IG	0.95
	I 2D/IG	0.56
Crystallite size, La (nm)		18.32
Electrical conductivity (S cm^−1)		5.8 ± 0.2
Water contact angle (°)		95.3° ± 1.9°

---

To evaluate the biocompatibility of the LIG material with skeletal muscle cells, the myoblast cell line C2C12 was cultured on PI-LIG samples. After 24 hours, cells showed very high viability (>95%) both on PI and LIG surfaces (Fig. 3a and b). The metabolic activity of cells was also assessed after 1, 3, and 6 days of culture on PI, LIG, or PI-LIG (Fig. 3c). Although cells on LIG and PI-LIG showed reduced cell activity as compared to control and PI material, their activity increased over time up to comparable levels after 6 days of culture, supporting the viability and proliferation of C2C12 cells on laser-induced graphene.

Fig. 3 (a) Live/dead confocal images of C2C12 cells cultured on PI-LIG samples for 24 h. From left to right: DIC image, alive cells (green), dead cells (red), and merged image. Scale bar: 200 μm. (b) Quantification of cell viability from fluorescent live/dead images. (c) Cellular metabolic activity of C2C12 cells cultured on tissue culture plates (control), PI, LIG, or PI-LIG surfaces for 6 days. * indicates significant differences to control condition, while + indicates differences among groups (one-way ANOVA).

C2C12 myoblasts have the ability to undergo myogenic differentiation under reduced serum conditions. Thus, cells were cultured on PI-LIG samples in culture media with a 5% content in serum for 6 days. Under these conditions, cells showed expression of myosin, the major motor protein involved in muscle contraction, both on PI and LIG surfaces. To validate the differentiation of skeletal muscle cells on LIG samples, the expression of the myogenic markers Desmin, MyoD, MYH1, and Myogenin was evaluated on PI and LIG samples by RT-qPCR. As shown in Fig. 4, culturing cells in reduced serum conditions successfully induced the expression of the different myogenic markers both on PI and LIG samples as compared to the control, supporting the differentiation of C2C12 myoblast cells on these substrates. Interestingly, the expression levels of Desmin and MyoD, early markers of myogenic differentiation, on LIG samples were comparable to those observed on tissue culture plates (diff. media), while MYH1 and Myogenin, late myogenesis markers, showed lower expression on LIG samples as compared to cells cultured on PI or tissue culture plates, which may indicate a delay in myogenic maturation on LIG samples.

Fig. 4 Gene expression of C2C12 differentiated on tissue culture plates (diff. media) PI or LIG samples and compared to undifferentiated cells (control).

Even though both PI and LIG samples exhibited good myogenic differentiation, a clear difference in the cell orientation and arrangements was observed on these substrates. As shown in Fig. 5a and b, most cells tended to accumulate in PI regions, probably because of their flat nature and lower height with respect to LIG, which slightly protrudes from the surface of PI. However, the myosin⁺-skeletal muscle cells on LIG showed an alignment along the tracks of laser engraving, whereas no particular directionality of the cells was observed on the PI substrate. The SEM images of the cells on LIG (Fig. 5c) further emphasized the alignment of the cells, which also featured the characteristic elongated shape of skeletal muscle cells, as presented in Fig. 5d. The directionality of the cells on LIG compared to PI was additionally quantified and presented in Fig. 5e and f.

Fig. 5 (a and b) confocal images of C2C12 cells cultured and differentiated on LIG samples for 6 days. Green represents myosin, and cyan indicates cell nuclei. The corresponding DIC images are in the inset of (a) and (b), where the black region indicates LIG and the white part corresponds to PI. The DIC images in the inset have the same scale bar as the corresponding confocal image. (c and d) SEM images of C2C12 cells on the LIG surface, emphasizing the alignment of the cells on the LIG surface. Orientation analysis from confocal fluorescent images on (e) PI and (f) LIG. The vertical axis indicates the amount of structures in a given orientation (arbitrary units).

4. Discussion

Laser irradiation on the PI substrate with optimized conditions resulted in the instantaneous photo-thermochemical decomposition of the substrate, leading to the formation of highly porous and highly graphitic carbon material. The nature of the carbon material depends on the amount of energy driven through the laser irradiation: under-irradiation results in no alternation to the substrate, whereas overexposure of the laser beam leads to ablation of the material.¹⁰ The laser engraving parameters used in this study were optimized to produce high-yield graphitic carbon without damaging the underneath polymeric substrate. The effect of different parameters has already been reported in our previous publications.^10,25 When a polymeric film is irradiated by a CO₂ laser beam, the localized temperature can reach up to ∼2500 °C due to minimal dissipation of the photothermal energy owing to the short pulses of the beam.¹⁶ At this highly localized temperature, chemical bonds in polyimide, specifically C=O, C–O, and N–C bonds, break down, followed by volatilizing some molecular fragments and releasing gases such as CO, CO₂, and nitrogen-containing compounds. The remaining aromatic structures within the material undergo reorganization, driven by the high temperatures and pressures.^9,13 This process facilitates the rearrangement of carbon atoms into a highly ordered, hexagonal lattice, ultimately forming graphene structures. Such a highly graphitic nature of our LIG material is supported by the Raman spectra (Fig. 2a) and XRD pattern (Fig. 2b), which contributed to the good electrical conductivity of our material. Furthermore, the rapid disintegration of the precursor polyimide and escape of volatile byproducts resulted in a transformation of smooth PI film into a highly porous LIG material, leading to the rough and fibril surface topology, as shown in Fig. 1b and c. The emergence of such rough, porous, and fibril surface features also influenced the wettability of the material. In particular, the smooth nature of the pristine PI film exhibited hydrophilic behavior, allowing better water spreading. The transformation into LIG material introduced micro/nanoscale surface heterogeneity. Combined with the graphitic behavior of LIG, the surface roughness made the LIG surface more resistant to water spreading, resulting in a hydrophobic material.

Indeed, the surface roughness and porosity of graphene derivatives are considered one of the driving forces for the enhanced cellular behavior of cells and have already been associated with myogenic differentiation thanks to the increased adsorption of serum proteins.²⁸ The differences observed in the cell densities on LIG and PI surfaces could be attributed to the surface properties of the materials (Fig. 3a and 5a, b). The pristine PI sheet was relatively smooth and hydrophilic, facilitating better initial cell adhesion and spreading. In contrast, the rough and hydrophobic surface of LIG might have reduced initial cell attachment. Furthermore, the surface features, specifically the protruding fiber-like structures, might have created physical hindrances towards cell attachment and migrations. Despite these, C2C12 myoblasts showed very high viability, proliferation, and myogenic differentiation on the LIG material. A recent work from Wang et al. has already shown the potential use of laser-induced graphene materials as scaffolds for bone tissue engineering applications.²⁹ Nevertheless, and as with most graphene-based scaffolds, the improved biological performance is achieved by combining LIG with collagen and polycaprolactone. In our work, we demonstrated for the first time that this novel kind of graphene-based material can be directly employed for tissue engineering applications without the need for further coatings, blending, or modifications that could make the manufacturing process difficult. Additionally, skeletal muscle tissue engineering scaffolds usually aim to mimic the final architecture of the tissue, which consists of a highly organized structure comprised of long parallel aligned myotubes. For this reason, many researchers are introducing micro- and nanopatterns in tissue engineering scaffolds to promote the alignment of skeletal muscle cells, critical for cell function and tissue development.^30–32 Due to the anisotropy generated by laser engraving during manufacturing, LIG scaffolds allow to guide the orientation of cells in a very simple and cost-effective way, achieving skeletal muscle alignment without the need for post-processing patterning. Regarding the myogenic differentiation of cells, it is important to note that the experiments in this work were performed without electrical stimulation, which can significantly enhance myoblast differentiation on graphene substrates.³³ Thus, due to the conductive nature of LIG scaffolds, electrical stimulation may further contribute to the additional maturation of skeletal muscle cells towards later stages of differentiation.

Despite the research performed in recent years regarding developing LIG for healthcare and biomedical applications, the health risks and toxicity of these novel materials are barely explored.³⁴ In general, graphene's adverse effects are determined by its physicochemical properties, which include shape, size, dimensions, or composition, and it is thus very difficult to extrapolate the extensive testing of other graphene materials to LIG. Some experiments on zebrafish embryos have suggested that LIG has minimal effects on development, unlike other types of graphene materials,³⁵ but further studies like this one are essential to provide new results on the toxicity and safety of LIG materials, thus helping to advance the use of LIG for tissue engineering and healthcare applications. Furthermore, the directionality of C2C12 cells observed during the cell culture experiments signifies the potential applicability of LIG materials beyond musculoskeletal tissue regeneration. The ability to pattern LIG tracks could be utilized to design advanced patterning systems for cell cultures, allowing for precise control over the spatial distribution of aligned cells and their orientations, which is critical for tissues with anisotropic properties and can lead to the development of advanced systems like biohybrid actuators or robotic elements.^36,37

Additionally, the patternability and electrical conductivity of LIG make it an ideal candidate for integrating into bio-MEMS (biological microelectromechanical systems) and lab-on-a-chip platforms. These technologies use precise microfabrication techniques and electrically active surfaces to mimic biological processes in vitro, enabling high-throughput screening, drug testing, and disease modeling. The ability to fabricate LIG directly on polymeric substrates through laser scribing also facilitates the development of cost-effective and scalable lab- and organ-on-a-chip devices with customizable surface properties.^38,39 Furthermore, the inherent conductivity of LIG could enhance the functionality of such devices, enabling real-time electrical stimulation or monitoring of cellular behavior, such as electrophysiological responses.⁴⁰

5. Conclusion

To summarize, this study demonstrates the potential of laser-induced graphene (LIG) as a conductive, biocompatible material for musculoskeletal tissue engineering. Through laser irradiation, polyimide substrates were transformed into highly graphitic, porous LIG with distinct fibril morphology and surface topography. The fabricated LIG substrate also exhibited good electrical conductivity and hydrophobic surface properties. Our experiments for evaluating the interaction between skeletal muscle cells and LIG demonstrate that C2C12 myoblasts adhered well to LIG surfaces and also aligned along the LIG's laser-induced pattern, an attribute essential for muscle tissue engineering. Cells showed high viability and proliferation over time on LIG surfaces. Furthermore, the expression of myogenic markers demonstrated the capability of LIG to support myogenic differentiation, which could be influenced by the electrical conductivity of LIG and directional patterning. Although late-stage differentiation was observed to progress more slowly on LIG than on PI, these results indicate that with further optimization, LIG scaffolds could offer both bioelectrical functionality and mechanical compatibility for muscle repair and regeneration. This work underscores the viability of LIG as a scaffold material, pointing toward new pathways for developing advanced tissue-engineered solutions for musculoskeletal repair. Furthermore, the directionality of cells demonstrated in culture is insightful regarding potential uses of LIG for patterning cell culture systems and bio-MEMS for future lab- and organ-on-a-chip applications.

Data availability

Data are available upon request from the authors.

Conflicts of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

The authors thank Prof. Jan Korvink from the Institute of Microstructure Technology at the Karlsruhe Institute of Technology (KIT), Germany, for providing the facilities used in LIG fabrication. The authors also thank Ms Ahsana Sadaf of KIT for assisting with the white light interferometry characterization and Dr Jennifer Patterson from IMDEA Materials Institute for providing the cells for this study.

References

1. Y. Kim, G. Pagan-Diaz, L. Gapinske, Y. Kim, J. Suh, E. Solomon, J. F. Harris, S. Nam and R. Bashir, Adv. Healthc. Mater., 2020, 9, 1901137.
2. V. Palmieri, F. Sciandra, M. Bozzi, M. De Spirito and M. Papi, Front. Bioeng. Biotechnol., 2020, 8, 383.
3. G. Abd, R. S. Díaz, A. Gupta, T. H. R. Niepa, K. Mondal, S. Ramakrishna, A. Sharma, A. D. Lantada and M. Islam, MedComm: Biomater. Appl., 2024, 3, e76.
4. M. Maleki, R. Zarezadeh, M. Nouri, A. R. Sadigh, F. Pouremamali, Z. Asemi, H. S. Kafil, F. Alemi and B. Yousefi, Biomol. Concepts, 2020, 11, 182–200.
5. M. Islam, A. D. Lantada, D. Mager and J. G. Korvink, Adv. Healthc. Mater., 2022, 11, 2101834.
6. X. Pan, D. Cheng, C. Ruan, Y. Hong and C. Lin, Global Challenges, 2022, 6, 2100107.
7. L. Ou, B. Song, H. Liang, J. Liu, X. Feng, B. Deng, T. Sun and L. Shao, Part. Fibre Toxicol., 2016, 13, 57.
8. R. Ye, D. K. James and J. M. Tour, Acc. Chem. Res., 2018, 51, 1609–1620.
9. J. Lin, Z. Peng, Y. Liu, F. Ruiz-Zepeda, R. Ye, E. L. G. Samuel, M. J. Yacaman, B. I. Yakobson and J. M. Tour, Nat. Commun., 2014, 5, 5714.
10. E. R. Mamleyev, S. Heissler, A. Nefedov, P. G. Weidler, N. Nordin, V. V. Kudryashov, K. Länge, N. MacKinnon and S. Sharma, npj Flexible Electron., 2019, 3, 2.
11. J. Zhu, X. Huang and W. Song, ACS Nano, 2021, 15, 18708–18741.
12. Y. Xu, Q. Fei, M. Page, G. Zhao, Y. Ling, D. Chen and Z. Yan, Nano Res., 2021, 14, 3033–3050.
13. T. D. Le, H. Phan, S. Kwon, S. Park, Y. Jung, J. Min, B. J. Chun, H. Yoon, S. H. Ko, S. Kim and Y. Kim, Adv. Funct. Mater., 2022, 32, 2205158.
14. S. G. Jo, R. Ramkumar and J. W. Lee, ChemSusChem, 2024, 17, e202301146.
15. L. G. Cançado, K. Takai, T. Enoki, M. Endo, Y. A. Kim, H. Mizusaki, A. Jorio, L. N. Coelho, R. Magalhães-Paniago and M. A. Pimenta, Appl. Phys. Lett., 2006, 88, 163106.
16. A. Vashisth, M. Kowalik, J. C. Gerringer, C. Ashraf, A. C. T. van Duin and M. J. Green, ACS Appl. Nano Mater., 2020, 3, 1881–1890.
17. Y. Chen, J. Long, S. Zhou, D. Shi, Y. Huang, X. Chen, J. Gao, N. Zhao and C. Wong, Small Methods, 2019, 3, 1900208.
18. Z. Wan, N.-T. Nguyen, Y. Gao and Q. Li, Sustainable Mater. Technol., 2020, 25, e00205.
19. A. Ghosh, S. Kaur, G. Verma, C. Dolle, R. Azmi, S. Heissler, Y. M. Eggeler, K. Mondal, D. Mager, A. Gupta, J. G. Korvink, D.-Y. Wang, A. Sharma and M. Islam, ACS Appl. Mater. Interfaces, 2024, 16, 40313–40325.
20. S. Kaur, D. Mager, J. G. Korvink and M. Islam, Mater. Sci. Energy Technol., 2021, 4, 407–412.
21. D. B. Schuepfer, F. Badaczewski, J. M. Guerra-Castro, D. M. Hofmann, C. Heiliger, B. Smarsly and P. J. Klar, Carbon, 2020, 161, 359–372.
22. N. Shimodaira and A. Masui, J. Appl. Phys., 2002, 92, 902–909.
23. A. C. Ferrari and J. Robertson, Phys. Rev. B:Condens. Matter Mater. Phys., 2001, 64, 075414.
24. M. Couzi, J.-L. Bruneel, D. Talaga and L. Bokobza, Carbon, 2016, 107, 388–394.
25. S. Kaur, D. Mager, J. G. Korvink and M. Islam, Mater. Sci. Energy Technol., 2021, 4, 407–412.
26. A.-H. Lu, W.-C. Li, E.-L. Salabas, B. Spliethoff and F. Schüth, Chem. Mater., 2006, 18, 2086–2094.
27. K. Tian, B. Tudu and A. Tiwari, Vacuum, 2017, 146, 483–491.
28. S. H. Ku and C. B. Park, Biomaterials, 2013, 34, 2017–2023.
29. W. Wang, Y. Huang, Y. Hou, D. Meng, K. Pan, P. Bartolo and L. Li, CIRP Ann., 2024, 73, 165–168.
30. M. Yang, Q. Cheng, G. Zhou, T. Wei, S. Zhong, L. Lu, C. Yan, Y. Wang, M. Fang, M. Yang and W. Ping, ACS Appl. Bio Mater., 2024, 7, 7710–7718.
31. M. E. Carnes and G. D. Pins, J. Biomed. Mater. Res., Part B, 2020, 108, 2308–2319.
32. M. Taale, B. Schamberger, M. A. Monclus, C. Dolle, F. Taheri, D. Mager, Y. M. Eggeler, J. G. Korvink, J. M. Molina-Aldareguia, C. Selhuber-Unkel, A. D. Lantada and M. Islam, Adv. Healthc. Mater., 2024, 13, 2303485.
33. S. Ahadian, J. Ramón-Azcón, H. Chang, X. Liang, H. Kaji, H. Shiku, K. Nakajima, M. Ramalingam, H. Wu, T. Matsue and A. Khademhosseini, RSC Adv., 2014, 4, 9534.
34. T. Thaweeskulchai, K. Sakdaphetsiri and A. Schulte, Microchim. Acta, 2024, 191, 292.
35. M. d'Amora, A. Lamberti, M. Fontana and S. Giordani, J. Phys.: Mater., 2020, 3, 034008.
36. L. Ricotti, B. Trimmer, A. W. Feinberg, R. Raman, K. K. Parker, R. Bashir, M. Sitti, S. Martel, P. Dario and A. Menciassi, Sci. Rob., 2017, 2, eaaq0495.
37. L. Sun, Y. Yu, Z. Chen, F. Bian, F. Ye, L. Sun and Y. Zhao, Chem. Soc. Rev., 2020, 49, 4043–4069.
38. M. Islam, D. Keck, J. Gilmore and R. Martinez-Duarte, Micromachines, 2020, 11, 255.
39. B. Zhang, A. Korolj, B. F. L. Lai and M. Radisic, Nat. Rev. Mater., 2018, 3, 257–278.
40. S. W. Shaner, M. Islam, M. B. Kristoffersen, R. Azmi, S. Heissler, M. Ortiz-Catalan, J. G. Korvink and M. Asplund, Biosens. Bioelectron.:X, 2022, 11, 100143.

---

Footnote

† Equal contribution.

---