Macroporous resin purification and characterization of flavonoids from Platycladus orientalis (L.) Franco and their effects on macrophage inflammatory response

Abstract

The flavonoids (POFs) from the leaves of Platycladus orientalis (L.) Franco were purified using six different macroporous adsorption resins including polar resins NKA-9 and ADS-F8, semi-polar resins ADS-17 and AB-8, and non-polar resins D101 and ADS-5. Among semi-polar resins, AB-8 demonstrated the best adsorption and desorption capacities with an adsorption ratio of 86% and a desorption ratio of 52%. According to the Simultaneous Thermogravimetry-Differential Scanning Calorimetry (STA/TG-DSC) analysis, POFs showed three thermally decomposed temperatures (347.6 °C, 437.5 °C and 494.8 °C). The main flavonoids in POFs were identified as esculin, amentoflavone, glabridin, and afromosin. Meanwhile, POFs in the dosage range of 25 to 400 μg mL⁻¹ showed a significant anti-inflammatory effect on lipopolysaccharide (LPS)-induced RAW 264.7 mouse macrophage cells, which could inhibit the secretion of NO, IL-6, and TNF-α through the inhibition of inflammatory-related gene expressions.

---

1. Introduction

Flavonoids belong to the subclass of polyphenols that are widely distributed in fruits and vegetables. The structures of flavonoids are characterized by two or more aromatic rings, each bearing at least one aromatic hydroxyl and connected with a heterocyclic pyran.¹ Studies reported that flavonoids possess diverse biological activities including antioxidant, anti-inflammatory, antimicrobial, antitumor, antiviral, and antithrombogenic.^2–6

Platycladus orientalis (L.) Franco, a nutritious traditional food plant, is widely cultivated all over the world.⁷ In some Asian countries, the leaves of P. orientalis are considered as good sources of healthful components and used as functional food additives. Historically, P. orientalis has been used as functional foods for the treatment of cough, gout, rheumatism, asthma, chronic bronchitis, etc.^8,9 Recently, there has been growing evidence that P. orientalis has health benefits such as antioxidative, antihyperlipidemic,¹⁰ neuroprotective, anti-aging,¹¹ and other biological activities.

The studies of P. orientalis leaves were mainly focused on the antimicrobial activity of their essential oils,¹² antifibrotic and anti-inflammatory activities of their diterpenes,¹³ and also the structural identification of some major flavonoids⁸ and polysaccharides.¹⁴ Among them, flavonoids are considered as primary bioactive ingredients of Platycladus orientalis leaves; nevertheless, rare information about the purification and biological activity of flavonoids from Platycladus orientalis leaves are available.

Inflammation can arise in many tissues in response to traumatic, infectious, post-ischemic, or autoimmune injury.¹⁵ Pro-inflammatory molecules, such as cytokine (TNF-α), leukocyte adhesion, and nitric oxide (NO) secreted by macrophage cells during inflammatory reactions, have been shown to play a crucial role in immune-inflammatory response.¹⁶ Many studies have confirmed that the inhibition of pro-inflammatory molecules could reduce the inflammation damage. J. G. found that the inhibition of TNF-α remarkably reduced the gastric damage in cirrhotic rats.¹⁷ Keyvan discovered that thalidomide pretreatment reduced the pro-inflammatory cytokines and alleviated the ethanol-induced gastric mucosal injury in a mouse model.¹⁸ The flavonoids extracted from P. orientalis leaves may also have the same activity; therefore, the antiinflammatory activity of the flavonoids was investigated using a murine RAW 264.7 cell model.

In the present study, we also investigated the purification behavior of P. orientalis flavonoids (POFs) by using six types of macroporous resins (NKA-9, ADS-F8, ADS-17, AB-8, D101, and ADS-5), and the chemical structure of POFs was characterized by STA/TG-DSC, UV-Vis, FT-IR and LC-MS assays.

The results we obtained may supply helpful information about the structure and bioactivity of the POFs, which might expand the application of POFs as a bioactive ingredient in functional foods.

2. Materials and methods

2.1 Reagents

Platycladus orientalis (L.) Franco was collected from Qingdao, Shandong province, China. Six macroporous resins including NKA-9, ADS-F8, ADS-17, AB-8, D101, and ADS-5 were obtained from Nankai Hecheng S&T Co. Ltd (Tianjin, China). Their polarities range from non-polar to strongly polar, and more specific physicochemical characteristics of these resins are shown in Table 1. The murine macrophage cell line RAW 264.7 was obtained from American Type Culture Collection (ATCC, Rockville, MD). Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), phosphate-buffered saline (PBS, pH 7.4), penicillin, and streptomycin were Gibco® brand from Thermo Fisher Scientific Inc. (Waltham, MA, USA). Afromosin, glabridin, esculin, amentoflavone, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), lipopolysaccharide (LPS), and Griess reagent were purchased from Sigma-Aldrich Co. LLC. (St Louis, MO, USA). The mouse IL-6 enzyme-linked immunosorbent assay (ELISA) kit, and the mouse TNF-α ELISA kit were acquired from Neobioscience Technology Co. Ltd (Shenzhen, China).

Table 1 Physical and chemical properties of macroporous adsorption resins

Number	Type	Surface area (m^2 g^−1)	Particle diameter (mm)	Average pore diameter (nm)	Polarity
1	NKA-9	170–250	0.30–1.25	15.5–16.5	Polar
2	ADS-F8	100–120	0.30–1.25	15.0–20.0	Polar
3	ADS-17	90–150	0.30–1.25	25.0–30.0	Semi-polar
4	AB-8	450–530	0.30–1.25	13.0–14.0	Semi-polar
5	D101	600–700	0.30–1.25	10.0–12.0	Non-polar
6	ADS-5	520–600	0.30–1.25	25.0–30.0	Non-polar

---

2.2 Pretreatment of macroporous resins

The pretreatment of macroporous resins was carried out according to the method described by Dong et al. with minor modifications.¹⁹ In order to remove the monomers and porogenic agents trapped inside the pores during the synthesis process, all the resins were first treated in absolute ethanol for 24 h, and then washed with deionized water to completely remove the ethanol. Afterwards, the resins were soaked in 1.0 M NaOH for 6 h, washed with deionized water (until the pH of the filtrate was 7.0), and again soaked in 1.0 M HCl for 6 h, and washed with deionized water (until the pH of the filtrate was 7.0) in sequence. Finally, all the resins were dried at 60 °C in an electric blast drying oven (DHG-9070A, Shanghai Shenxian Thermostatic Equipment Co. Ltd, Shanghai, China) to reach a constant weight.

2.3 Determination of the total flavonoid content

The total flavonoid content was determined by using a colorimetric method described previously.²⁰ Briefly, 0.5 mL of the P. orientalis extract or rutin standard solution was mixed with 2.5 mL of distilled water in a test tube followed by the addition of 5% (m/v) NaNO₂ solution (150 μL). After 6 min, 250 μL of 10% (m/v) AlCl₃·6H₂O solution was added and allowed to stand for another 5 min before 1.0 mL of 1.0 M NaOH was added. The mixture was brought to 5.0 mL with distilled water and mixed well. The absorbance was measured immediately against the blank at 510 nm using an ultraviolet-visible spectrophotometer (UV-1800, Shimadzu, Japan) in comparison with the standards prepared similarly with the known rutin concentrations. The results are expressed as mean ± SD for eight replications.

2.4 Static adsorption and desorption properties of macroporous resins for the purification of POFs

Six aliquots (accurately weighed 2 g) of each resin were separately added into six 100 mL flasks. The resins were first activated overnight with 95% ethanol, and then the ethanol was thoroughly washed with deionized water. Resins in each flask were soaked in 25 mL flavonoid solutions. The initial content of POF solutions was 3 mg mL⁻¹. Then the flasks were shaken by using a shaking incubator with a speed of 180 rpm at 25 °C for 60 min. After absorption equilibrium, the resins were washed twice with deionized water. Then, 20 mL of 95% ethanol was added into the flasks for desorption. The flasks were shaken by using a shaking incubator with a speed of 180 rpm at 25 °C for 60 min. After adsorption and desorption equilibrium, the solutions were filtered and the corresponding adsorption and desorption ratios of each resin were calculated using the equations below:

where C₀: the initial concentration of total flavonoids in solution (mg ml⁻¹); C_e: the equilibrium concentration of total flavonoids in solution (mg ml⁻¹); C_d: the equilibrium concentration of total flavonoids in desorption solution (mg ml⁻¹); V_d: the volume of desorption solution (ml); V_i: the volume of the solution in the flasks after adsorption (ml).

2.5 Static adsorption isotherms

To determine the absorption isotherms of AB-8, four groups of flasks containing 1 g of resin were prepared as described above. Then, 25 ml of the POF solutions at different initial flavonoids (0.135, 0.269, 0.538, 1.076, and 2.152 mg mL⁻¹) were added into the flasks. The thermostatic oscillation was then conducted at three different temperatures 25 °C, 35 °C, and 45 °C, respectively, for 120 min. After adsorption, the total flavonoids were measured and the adsorption capacity of each resin was calculated according to the following formulae:

where V₀: the initial volume of the solution added into the flask (ml); W: the weight of dried resin in each flask (g).

2.6 Column chromatography purification

The column chromatography purification of POFs on AB-8 (bed volumes 200 mL) was conducted using a glass column (2.6 cm × 40 cm). Basically, 70 mL of the crude extract from P. orientalis leaves (2.15 mg POFs per mL) was loaded onto the top of the column and kept at room temperature (25 °C) for 40 minutes to reach adsorption equilibrium. After adsorption, the desorption was conducted by using different concentrations of ethanol (40%, 60% and 80%). The constant flow rate of the mobile phase was 1 mL min⁻¹ and the elution volume was kept at 2 column volumes. The collected fraction was then concentrated using a rotary evaporator (RE52CS, Yarong Equipment Co., Shanghai, China) at 50 °C. The obtained fractions were freeze-dried in a lyophilizer (NingBo Scientz Biotechnology Co., Ltd, Ningbo, China) and stored at −20 °C for further analysis.

2.7 FT-IR analysis and surface morphology characterization of POFs

The infrared spectrum of POFs was recorded on a Fourier Transform Infrared (FT-IR) spectrometer (VERTEX 33, Bruker, USA) using KBr pellets in the infrared region of 4000–400 cm⁻¹ at a resolution of 4 cm⁻¹.

The surface morphology of POFs was observed by scanning electron microscopy (LEO, Oberkochen, Germany). The POF powders were spread on a metal wafer fixed on a specimen holder using current conducting double-sided adhesive tapes and analysed by using a Scanning Electron Microscope (SEM).

2.8 Differential scanning calorimetry and thermogravimetric analysis (DSC-TG)

Thermal DSC-TG analysis was carried out with a simultaneous thermal analyzer (NETZSCH, STA 449 F3, Germany). POFs (approximately 5 mg) were heated in Al₂O₃ crucibles. The heating was performed under static conditions in the range of 25 to 600 °C with a temperature increase rate of 10 K min⁻¹. The analysis was conducted under a pure nitrogen gas atmosphere at a flow rate of 40 mL min⁻¹. They provided ±1.0 °C precision for reading the temperature.

2.9 High performance liquid chromatography-mass spectrometry (HPLC-MS)

The LC-MS conditions for the qualitative identification of flavonoids were determined using the method of Coppin et al. with minor revision.²¹ HPLC separation was performed by using an Acclaim RSLC PALL 2.1 × 50 mm (Dionex) with the mobile phase containing gradient solvents A and B, where A was 0.1% formic acid (v/v) in distilled water and B was acetonitrile for the following gradients: 10–30% B in 10 min and 30% B in 10–20 min at a flow rate of 1.0 mL min⁻¹. The injection volume was 5 μL and the UV detection wavelength was 254 nm. The eluent was monitored by using an electrospray ion mass spectrometer (ESI-MS) in positive ion mode and scanned from m/z 50 to 2000. ESI was conducted by using a needle voltage of 3.5 kV at an optimum collision energy level of 60%.

2.10 Anti-inflammatory activity

2.10.1 Cell viability. The growth inhibitory effect of flavonoids on RAW 264.7 cells (KCLB, Seoul, Korea) was analyzed by MTT assay. The cells were cultured in 96-well plates at a density of 1 × 10⁴ cells per well. After 24 h, the cells were pretreated with 10, 100, 200 and 400 μg mL⁻¹ of POFs for 24 h at 37 °C. MTT solution was added to each well and further incubated for 3 h at 37 °C. The medium was discarded and DMSO was added to dissolve the formazan dye. The optical density was determined at 570 nm. All the experiments were carried out in triplicate.

2.10.2 Cytokine measurements. To assess the anti-inflammatory effect of POFs, the levels of proinflammatory cytokines, nitric oxide (NO), tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6) were measured. The quantity of NO produced by the cells was determined by detecting the levels of NO₂ using the Griess method (total nitrite).²² A standard curve was prepared using sodium nitrate. 100 μL of the supernatant was mixed with 100 μL of Griess reagent, the absorbance was determined at 540 nm after incubation for 10 min at room temperature. Fresh culture medium was used as blank in all experiments. The concentrations of TNF-α and IL-6 were measured by using ELISA kits (Neobioscience, Shenzhen, China). Assays were carried out according to the manufacturer's instructions. The cells (1 × 10⁵ cells per mL) were loaded onto the 96 well microplate (100 μL per well) and incubated for 24 h. Then the culture medium was replaced by a new medium with POFs and incubated for another 24 h. The cells were pretreated with antibodies for 2 h prior to stimulation with different concentrations of POFs (25, 100 and 400 μg mL⁻¹) and incubated for 24 h. LPS (1 μg mL⁻¹) was used as the positive control. After this, the supernatants of the cells were collected and the levels of TNF-α and IL-6 were measured using the mouse TNF-α ELISA kit and mouse IL-6 ELISA kit, respectively.

2.10.3 IL-6, TNF-α, and iNOS gene expression measurements. To make a thorough inquiry of the inhibition mechanism of NO, TNF-α, and IL-6 secretion, the RAW 264.7 cells were cultured for 24 h before the addition of the media containing different concentrations of POFs (25, 100 and 400 μg mL⁻¹). After another 4 h incubation, LPS (1 μg mL⁻¹) was added and the medium was incubated for another 4 h under 5% CO₂ at 37 °C. Then the macrophage cells were gathered and washed 3 times with PBS for RNA isolation and real-time polymerase chain reaction (RT-PCR) analysis. RNA was isolated from RAW264.7 macrophages using TRIzol reagent. cDNA synthesis kits (Bio-Rad) were used when 1 μg of total RNA was reverse-transcribed into cDNA. The transcription was started by incubating the tube at 25 °C for 5 min and at 42 °C for 30 min. Then the reaction was stopped by heating the tube at 85 °C for 5 min. After reverse transcription, the PCR was performed in the same way as previously described.¹⁴ The sequences of the PCR primer are listed below: iNOS (forward: CGGCAAACATGACTTCAGGC, reverse: GCACATCAAAGCGGCCATAG), IL-6 (forward: TACTCGGCAAACCTAGTGCG, reverse: GTGTCCCAACATTCATATTGTCAGT), and TNF-α (forward: GGGGATTATGGCTCAGGGTC, reverse: CGAGGCTCCAGTGAATTCGG).

2.11 Statistical analysis

All of the assays were carried out in triplicate. The data were analyzed using SPSS 19.0 software (IBM Corporation, New York, USA). One-way analysis of variance (ANOVA) was performed to determine the significance of the main effects. Significant differences (P < 0.05) between means were identified by least significant difference (LSD) procedures.

3 Results and discussion

3.1 Screening of macroporous resins for POF purification

Macroporous resins can be used for the absorption of organic constituents due to their hydrophobic properties.²³ The adsorption capacity of macroporous resins not only correlates with the physical and chemical properties of the adsorbent, but also with the size and chemical features of the adsorbed substance.²⁴ To effectively enrich the POFs, the optimum type of macroporous resin was screened. First, the properties of six resins were compared in terms of their adsorption and desorption capacities. As shown in Fig. 1, among the selected resins, AB-8 resin showed the highest adsorption and desorption capacity towards POFs. The adsorption and desorption ratios of D101 and ADS-5 were relatively low though both of them have higher surface areas. This result indicated that an appropriate surface area and resin size were both crucial for POF purification. Taking adsorption and desorption ratios into account, AB-8 resin was considered to be the most appropriate resin for POF purification among the tested resins.

Fig. 1 Static adsorption and desorption results based on the total POF content in different types of macroporous resins. The results were expressed as mean ± S.D. (n = 3). The mean values were considered significantly different when p < 0.05.

3.2 Adsorption isotherms for POFs and static/dynamic adsorption and desorption kinetics of AB-8 resin

Equilibrium adsorption isotherms were obtained by soaking the resin in an aqueous solution of P. orientalis leaves extract at different concentrations and temperatures. Fig. 2A shows the adsorption isotherm of AB-8 for different concentrations of POFs. With the increase of the initial concentration of total flavonoids, the equilibrium adsorption capacity of AB-8 increased and reached 35 mg POFs per g resin at an initial concentration of 2.152 mg mL⁻¹. The adsorption capacity decreased with the increase of temperature and reached the minimum at 45 °C, indicating that this process was an exothermic process.²⁵ Therefore, the ideal adsorption temperature and concentration for separation of POFs were selected as 25 °C and 2.152 mg mL⁻¹.

Fig. 2 Adsorption isotherm, static adsorption and desorption kinetics, and the dynamic desorption curves of POFs by the AB-8 resin. (A) Adsorption isotherm for POFs on AB-8, C_e and Q_e are the adsorption equilibrium concentration and adsorption capacity of AB-8 respectively; (B) static adsorption curves; (C) static desorption curves; (D) dynamic desorption curves of POFs using different ethanol concentrations (v/v) at 1.0 mL min⁻¹.

To further explore the adsorption and desorption mechanism of AB-8 resin, tests for static adsorption and desorption were conducted. As seen in Fig. 2B, the adsorption capacity of AB-8 increased rapidly in the first 20 min. After this, the increase in the rate of adsorption slowed down and reached equilibrium in 40 min. Meanwhile, the desorption of POFs was complete within 10 min (Fig. 2C). These results indicated that AB-8 was a rapid adsorption and desorption resin.²⁶ The adsorption and desorption behaviors of AB-8 towards POFs were similar to the previous study on phlorotannins’ separation using macroporous resins.²⁷ The dynamic adsorption and desorption of AB-8 were performed and accomplished within 40 min. After adsorption, the test of dynamic desorption was conducted utilising different concentrations (40%, 60%, and 80%; v/v) of ethanol solutions. As seen in Fig. 2D, strong polar chemical compounds as well as other non-adsorbed fractions such as some water-soluble proteins and macromolecular polysaccharides were thoroughly washed out and the POF-rich fraction was collected by the elution of 2 column volumes of 40% aqueous ethanol.

3.3 Thermostability analysis of POFs

The thermal stability of POFs was investigated by DSC-TG analysis (30–600 °C). As shown in Fig. 3A, the thermal decomposition of POFs occurred in four well-differentiated steps (Table 2). The initial weight loss was recorded from 25.0 to 126.9 °C, which was regarded as the evaporation of the physically adsorbed water content in POFs. When the temperature reached 136.6 °C, the second degradation was observed with a major weight loss of 50.59%. The third stage of decomposition was recorded for the range of 372.8 to 460.4 °C with a weight loss of 23.48%. The last dissociation was beyond 460.4 °C. Above 600 °C, only 1.18% solid residue remained. Therefore, the decomposition of POFs processed four remarkable stages: (1) the desorption of physically adsorbed water; (2) the removal of structural water; (3) the disaggregation and the spallation of C–O and C–C bonds in the ring units; and (4) the formation of polynuclear aromatic and graphitic carbon structures.²⁸ Generally, the commercially sterile temperature to kill the most heat resistant microorganisms ranges from 110–121 °C in the food industry. The high thermostability of POFs enables them to act as potential candidates for practical use as functional components.

Fig. 3 (A) Thermal gravimetric and differential scanning calorimetric analysis of POFs; (B) FT-IR spectrum of POFs; (C) SEM photomicrograph of POFs.

Table 2 Temperature intervals, weight loss and T_d of region I, II, III and IV for POFs

Region	T (°C)	T d (°C)	V q (%)
T: the temperature of each decomposition stage. Td: the peak value of enthalpy changes. Vq: the quality variation.
I	25.0–126.9	68.5	8.12
II	136.6–372.8	319.6	50.59
III	372.8–460.4	438.7	23.48
IV	460.4–599.3	494.8	16.96
Residual mass (%)	1.18

---

3.4 FT-IR spectrum analysis and surface morphology of POFs

The FT-IR spectrum of POFs is shown in Fig. 3B. The wide and strong band at about 3385.63 cm⁻¹ indicated the original adsorption of the associated hydroxyl of POFs (3600–3200 cm⁻¹). The peak at 2935.52 cm⁻¹ may be due to the stretching vibration of aliphatic and aromatic C–H groups (2950–2850 cm⁻¹).²⁹ The adsorption peak at about 1653.89 cm⁻¹ was attributed to the C=O stretching vibration (1680–1620 cm⁻¹).³⁰ The adsorption peak around 1267.88 cm⁻¹ was associated with the C–O stretching vibration.³¹ The adsorption peaks of the deformation vibration of the C–C bands in the flavonoids were found around 1075.46 cm⁻¹ and 1032.39 cm⁻¹.³² Conceptually, these bands were divided into two kinds of vibrational directions: a benzene ring vibration mode was considered as the vibrations parallel with regard to the molecular axis, while a C=O vibration mode was considered to be the vibrations perpendicular to the molecular axis of POFs. Therefore, the determination of the orientation of each molecule was possible by quantifying the intensity ratios of these bands.³³ The surface morphology of POFs was observed by SEM. As shown in Fig. 3C, it could be seen clearly that POFs showed a special alveolate appearance.

3.5 HPLC-MS analysis

A reversed-phase separation was conducted by a linear universal gradient method and the MS assay was performed with an ESI source in negative ion mode. Four flavonoid compounds (K1–K4) were identified by generating the molecular formula based on accurate mass measurements of the [M − H]⁻ ion (Fig. 4A) and the fragmentation pattern according to the literature for the MS spectra of these flavonoids previously reported. The HPLC spectrogram of the four standard substances (Fig. 4B) confirmed the speculation.

Fig. 4 The MS spectra (A) and the HPLC chromatogram (254 nm) (B) of flavonoids from Platycladus orientalis (L.) Franco (POFs) and four standard substances K1, K2, K3, and K4.

The typical mass spectrum peak at m/z 297.1 [M − H]⁻ in negative ion mode was identified as afromosin (compound K1) with a molecular formula C₁₇H₁₄O₅, and this result was in keeping with the identification of afromosin in Licorice and Scutellariae by analysing liquid chromatography with mass spectrometry.³⁴ In compound K2, the mass spectrum data showed a molecular ion peak at m/z 322.9 [M − 2H]²⁻, which suggested that the molecular formula of this compound was C₂₀H₂₀O₄; all these data indicated that compound K2 was glabridin. Glabridin has been identified in Allamanda cathartica.³⁵ The molecular peak detected at m/z 339.2 [M − H]⁻ suggested that the compound with the molecular formula C₁₅H₁₆O₉ is known as esculin (compound K3). Esculin has been reported in other plants such as Rusci rhizoma by parallel LC-MS evaporative light scattering detection.³⁶ The mass spectrum of the peak detected at m/z 537.0 [M − H]⁻ suggested that it is amentoflavone (compound K4) which possesses a molecular formula C₃₀H₁₈O₁₀. This conclusion was supported by the mass spectrum at m/z 375.0541 [M − H − 162]⁻ which is in agreement with the study of Martínez-Las Heras et al.³⁷ The results were confirmed by the HPLC method and the existence of esculin and glabridin in P. orientalis leaves was first reported in the present study.

3.6 Effects of POFs on macrophage inflammatory response

3.6.1 Cytotoxicity of POFs on murine RAW 264.7 cells. Macrophages play an important role in the innate and acquired immunity, which could eliminate pathogens, and secrete chemokines to induce the innate and adaptive immunity. The cytotoxic effect of POFs on macrophages was determined by MTT assay. Fig. 5A shows the cell viability of RAW 264.7 cells, no significant changes in cell viability were found after the treatment with POFs for 24 h. The results indicated that the selected doses of POFs (10 to 400 μg mL⁻¹) have no cytotoxic effect on macrophages of RAW 264.7 cells. Therefore, the concentrations of POFs ranging from 10 to 400 μg mL⁻¹ were chosen for further studies on the anti-inflammatory effects.

Fig. 5 Effect of different concentrations of POFs on RAW 264.7 cells. (A) Cell viability of the RAW 264.7 cells; (B) macrophage NO secretion; (C) macrophage TNF-α secretion; (D) macrophage IL-6 secretion; (E) mRNA expression of TNF-α; (F) mRNA expression of IL-6; (G) mRNA expression of iNOS. Data are expressed with respect to control non-treated cells. The results were expressed as mean ± S.D. (n = 3). The mean values were considered significantly different when p < 0.05.

3.6.2 Effect of POFs on LPS-induced overproduction of NO in RAW 264.7 cells. Macrophages express a large number of pattern recognition receptors, and they can be activated directly by pathogens associated with molecular patterns or their products. Murine macrophage-like RAW 264.7 cells are commonly used for the research of anti-inflammatory response.³² NO is known to be a pro-inflammatory mediator and is produced from arginine after the activation of iNOS and it is an important substance involved in immune regulation and defense.³⁸ The level of macrophage NO enhanced remarkably to mediate inflammation when stimulated by immunomodulators such as LPS etc. The effect of POFs on macrophage NO secretion in RAW 264.7 cells after treatment with LPS (1 μg mL⁻¹) was investigated. As shown in Fig. 5B, the level of NO was significantly reduced after treatment with over 100 μg mL⁻¹ of POFs compared to the control group (treated with LPS only). The level of NO treated with 400 μg mL⁻¹ of POFs was calculated to be 61.54% of the control group. The results indicated that POFs could significantly inhibit LPS-induced oversecretion of NO in RAW 264.7 cells.

3.6.3 Effect of POFs on LPS-induced overproduction of TNF-α in RAW 264.7 cells. TNF-α is a pro-inflammatory cytokine, expressed in many brain pathologies and associated with neuronal loss.³⁹ The effect of POFs on TNF-α secretion is shown in Fig. 5C, the control cell group (treated with LPS only) secreted a large amount of TNF-α (9934 pg mL⁻¹), while in the POF treatment group, the level of TNF-α decreased in a dose-dependent manner. Zhou et al. found that trifolirhizin, a sort of flavonoid isolated from Sophora flavescens, can interfere with the transcription factor to reduce the secretion of TNF-α by inhibiting the expression of TNF-α mRNA and proteins.⁴⁰ Therefore, the inhibitory effect of POF TNF-α secretion might be due to the suppression of TNF-α related mRNA and protein expression or the activity of a TNF-α converting enzyme such as TACE.⁴¹

3.6.4 Inhibitory effect of POFs on LPS-induced macrophage IL-6 oversecretion. IL-6 is a pleiotropic cytokine that exerts both pro-inflammatory and anti-inflammatory effects depending upon its cellular context.⁴² It is a potent inflammatory cytokine that mediates a plethora of biological processes, including cell proliferation, survival, migration, invasion and antiapoptosis.⁴³ To further investigate the inhibitory effect of POFs on macrophage inflammatory response, the level of IL-6 in RAW 264.7 cells was measured after treatment with LPS and POFs. As shown in Fig. 5D, the LPS-induced oversecretion of IL-6 was significantly reduced with the increase of POF concentration. The level of IL-6 treated with 400 μg mL⁻¹ of POFs was 12 952.38 pg ml⁻¹ less than the LPS control group. This result indicated that POFs can inhibit LPS-induced IL-6 generation during the inflammatory response.

3.6.5 Inhibitory effect of POFs on the mRNA expression of iNOS, IL-6 and TNF-α. As an in vitro system, the macrophage cell model has been widely used for the study of the mechanism of inflammatory response. To investigate whether the attenuation effect of POFs on LPS-induced macrophage inflammatory response was through the regulation of the related gene expression, the transcriptional expressions of the pro-inflammatory factors iNOS, IL-6 and TNF-α in RAW 264.7 cells after treatment with LPS and POFs were measured using RT-PCR. As shown in Fig. 5E–G, POFs showed no significant effect on the gene expression of pro-inflammatory factors in control groups. Meanwhile, LPS could obviously activate the inflammation of the macrophage and up-regulate the mRNA expression of iNOS, IL-6 and TNF-α. With respect to LPS treatment, POFs (400 μg mL⁻¹) significantly inhibited the LPS-induced up-regulation of TNF-α, iNOS mRNA expression, and a slight effect on the expression of IL-6 mRNA was found after the treatment of POFs. Based on these results, the possible intracellular anti-inflammatory mechanism of POFs that attenuate LPS-induced inflammatory response might be mainly through the inhibition of related inflammatory mediators such as IRF3, PKR etc. (Fig. 6).

Fig. 6 Possible molecular mechanism of POF-induced macrophage anti-inflammation.

4 Conclusions

In the present study, the flavonoids from Platycladus orientalis (L.) Franco leaves were purified by macroporous resin and were identified to be esculin, amentoflavone, glabridin, and afromosin. DSC-TG analysis showed that POFs possessed high thermal stability with the main degradation temperature at 494.8 °C. POFs could significantly attenuate the LPS-induced macrophage inflammatory response through the inhibition of overproduction including NO, TNF-α and IL-6. Further studies revealed that the intracellular anti-inflammatory mechanism of POFs might be mainly through the inhibition of related inflammatory mediators such as IRF3, PKR, etc. Our study demonstrated that POFs could be developed as functional food candidates for the prevention and treatment of inflammation.

Acknowledgements

The authors gratefully acknowledge the Guangdong Natural Science Funds for Distinguished Young Scholars (S2013050013954), the Program for New Century Excellent Talents in University (NCET-13-0213), Guangdong Special Funding for Outstanding Young Scholars (2014TQ01N645), the Guangdong Science and Technology Planning Project (2015A010107003), Fundamental Research Funds for the Central Universities (2015PT015) and the Students Research Funding of Guangdong Province (pdjh2016b0049).

References

1. G. R. Beecher, Overview of Dietary Flavonoids: Nomenclature, Occurrence and Intake, J. Nutr., 2003, 133, 3248S–3254S.
2. R. J. Nijveldt, E. van Nood, D. E. van Hoorn, P. G. Boelens, K. van Norren and P. A. van Leeuwen, Flavonoids: a review of probable mechanisms of action and potential applications, Am. J. Clin. Nutr., 2001, 74, 418–425.
3. E. Tripoli, M. L. Guardia, S. Giammanco, D. D. Majo and M. Giammanco, Citrus flavonoids: Molecular structure, biological activity and nutritional properties: A review, Food Chem., 2007, 104, 466–479.
4. Y. Zhu, Y. Zhao, P. Wang, M. Ahmedna, C. T. Ho and S. Sang, Tea Flavanols Block Advanced Glycation of Lens Crystallins Induced by Dehydroascorbic Acid, Chem. Res. Toxicol., 2015, 28, 135–143.
5. P. Wang, H. Chen and S. Sang, Trapping Methylglyoxal by Genistein and Its Metabolites in Mice, Chem. Res. Toxicol., 2016, 29, 406–414.
6. T. Liu, X. H. Yu, E. Z. Gao, X. N. Liu, L. J. Sun, H. L. Li, P. Wang, Y. L. Zhao and Z. G. Yu, Hepatoprotective Effect of Active Constituents Isolated from Mung Beans (Phaseolus radiatus L.) in an Alcohol-Induced Liver Injury Mouse Model, J. Food Biochem., 2014, 38, 453–459.
7. H. Lei, Y. Wang, F. Liang, W. Su, Y. Feng, X. Guo and N. Wang, Composition and variability of essential oils of Platycladus orientalis growing in China, Biochem. Syst. Ecol., 2010, 38, 1000–1006.
8. Y.-H. Lu, Z.-Y. Liu, Z.-T. Wang and D.-Z. Wei, Quality evaluation of Platycladus orientalis (L.) Franco through simultaneous determination of four bioactive flavonoids by high-performance liquid chromatography, J. Pharm. Biomed., 2006, 41, 1186–1190.
9. S.-Y. Fan, H.-W. Zeng, Y.-H. Pei, L. Li, J. Ye, Y.-X. Pan, J.-G. Zhang, X. Yuan and W.-D. Zhang, The anti-inflammatory activities of an extract and compounds isolated from Platycladus orientalis (Linnaeus) Franco in vitro and ex vivo, J. Ethnopharmacol., 2012, 141, 647–652.
10. A. K. Dash, J. Mishra and D. K. Dash, Antidiabetic along with antihyperlipidemic and antioxidant activity of aqueous extract of Platycladus orientalis in streptozotocin-induced diabetic rats, Curr. Med. Res. Pract., 2014, 4, 255–262.
11. X. Yang, P. Zhang, J. Wu, S. Xiong, N. Jin and Z. Huang, The neuroprotective and lifespan-extension activities of Damnacanthus officinarum extracts in Caenorhabditis elegans, J. Ethnopharmacol., 2012, 141, 41–47.
12. M.-G. Kim and H.-S. Lee, Growth-inhibiting effects and chemical composition of essential oils extracted from Platycladus orientalis leaves and stems toward human intestinal bacteria, Food Sci. Biotechnol., 2015, 24, 427–431.
13. M. K. Lee, H. Yang, J. S. Yoon, E. J. Jeong, N. R. Ha, S. H. Sung and Y. C. Kim, Antifibrotic activity of diterpenes from Biota orientalis leaves on hepatic stellate cells, Arch. Pharmacal Res., 2008, 31, 866–871.
14. Z. Lin, W. Liao and J. Ren, Structural Characterization of a Polysaccharide Fraction from Platycladus Orientalis (L.) Franco and Its Macrophage Immunomodulatory and Anti-Hepatitis B Virus Activities, J. Agric. Food Chem., 2016, 64, 5813–5823.
15. C. Nathan, Points of control in inflammation, Nature, 2002, 420, 846–852.
16. L. Zhang, A. S. Ravipati, S. R. Koyyalamudi, S. C. Jeong, N. Reddy, P. T. Smith, J. Bartlett, K. Shanmugam, G. Münch and M. J. Wu, Antioxidant and Anti-inflammatory Activities of Selected Medicinal Plants Containing Phenolic and Flavonoid Compounds, J. Agric. Food Chem., 2011, 59, 12361–12367.
17. J. Ferraz, A. Tigley, C. Appleyard and J. Wallace, TNF-alpha contributes to the pathogenesis of ethanol-induced gastric damage in cirrhotic rats, Am. J. Physiol.: Gastrointest. Liver, 1997, 272, G809–G814.
18. K. Amirshahrokhi and A.-R. Khalili, The effect of thalidomide on ethanol-induced gastric mucosal damage in mice: involvement of inflammatory cytokines and nitric oxide, Chem.-Biol. Interact., 2015, 225, 63–69.
19. Y. Dong, M. Zhao, D. Sun-Waterhouse, M. Zhuang, H. Chen, M. Feng and L. Lin, Absorption and desorption behaviour of the flavonoids from Glycyrrhiza glabra L. leaf on macroporous adsorption resins, Food Chem., 2015, 168, 538–545.
20. V. Dewanto, X. Wu, K. K. Adom and R. H. Liu, Thermal Processing Enhances the Nutritional Value of Tomatoes by Increasing Total Antioxidant Activity, J. Agric. Food Chem., 2002, 50, 3010–3014.
21. J. P. Coppin, Y. Xu, H. Chen, M.-H. Pan, C.-T. Ho, R. Juliani, J. E. Simon and Q. Wu, Determination of flavonoids by LC/MS and anti-inflammatory activity in Moringa oleifera, J. Funct. Foods, 2013, 5, 1892–1899.
22. T.-T. Zhang, M. Wang, L. Yang, J.-G. Jiang, J.-W. Zhao and W. Zhu, Flavonoid glycosides from Rubus chingii Hu fruits display anti-inflammatory activity through suppressing MAPKs activation in macrophages, J. Funct. Foods, 2015, 18, 235–243.
23. M. Scordino, A. Di Mauro, A. Passerini and E. Maccarone, Adsorption of flavonoids on resins: cyanidin 3-glucoside, J. Agric. Food Chem., 2004, 52, 1965–1972.
24. F.-Y. Ma, M. Luo, C.-J. Zhao, C.-Y. Li, W. Wang, C.-B. Gu, Z.-F. Wei, Y.-G. Zu and Y.-J. Fu, Simple and efficient preparation of biochanin A and genistein from Dalbergia odorifera T. Chen leaves using macroporous resin followed by flash chromatography, Sep. Purif. Technol., 2013, 120, 310–318.
25. C. Liu, R. Jiao, L. Yao, Y. Zhang, Y. Lu and R. Tan, Adsorption characteristics and preparative separation of chaetominine from Aspergillus fumigatus mycelia by macroporous resin, J. Chromatogr., B, 2016, 1015, 135–141.
26. Q. Yang, M. Zhao and L. Lin, Adsorption and desorption characteristics of adlay bran free phenolics on macroporous resins, Food Chem., 2016, 194, 900–907.
27. J. Kim, M. Yoon, H. Yang, J. Jo, D. Han, Y. J. Jeon and S. Cho, Enrichment and purification of marine polyphenol phlorotannins using macroporous adsorption resins, Food Chem., 2014, 162, 135–142.
28. M. Badea, R. Olar, V. Uivarosi, D. Marinescu, V. Aldea, S. F. Barbuceanu and G. M. Nitulescu, Thermal behavior of some vanadyl complexes with flavone derivatives as potential insulin-mimetic agents, J. Therm. Anal. Calorim., 2011, 105, 559–564.
29. A. K. Satapathy, G. Gunasekaran, S. C. Sahoo, K. Amit and P. V. Rodrigues, Corrosion inhibition by Justicia gendarussa plant extract in hydrochloric acid solution, Corros. Sci., 2009, 51, 2848–2856.
30. C. D. Kanakis, P. A. Tarantilis, M. G. Polissiou, S. Diamantoglou and H. A. Tajmir-Riahi, Antioxidant flavonoids bind human serum albumin, J. Mol. Struct., 2006, 798, 69–74.
31. A. C. Moţ, R. Silaghi-Dumitrescu and C. Sârbu, Rapid and effective evaluation of the antioxidant capacity of propolis extracts using DPPH bleaching kinetic profiles, FT-IR and UV–vis spectroscopic data, J. Food Compos. Anal., 2011, 24, 516–522.
32. L.-C. Wu, N.-C. Fan, M.-H. Lin, I.-R. Chu, S.-J. Huang, C.-Y. Hu and S.-Y. Han, Anti-inflammatory Effect of Spilanthol from Spilanthes acmella on Murine Macrophage by Down-Regulating LPS-Induced Inflammatory Mediators, J. Agric. Food Chem., 2008, 56, 2341–2349.
33. M. Matsumura and N. Katayama, Molecular orientation behavior of chiral nematic liquid crystals based on the presence of blue phases using polarized microscopic FT-IR spectroscopy, J. Mol. Struct., 2016, 1116, 122–126.
34. G. Wang, X. Niu, G. Shi, X. Chen, R. Yao and F. Chen, Functionalized graphene quantum dots loaded with free radicals combined with liquid chromatography and tandem mass spectrometry to screen radical scavenging natural antioxidants from Licorice and Scutellariae, J. Sep. Sci., 2014, 37, 3641–3648.
35. K. Yamauchi, T. Mitsunaga and I. Batubara, Isolation, identification and tyrosinase inhibitory activities of the extractives from Allamanda cathartica, Nat. Resour., 2011, 2, 167.
36. P. A. Cremin and L. Zeng, High-throughput analysis of natural product compound libraries by parallel LC-MS evaporative light scattering detection, Anal. Chem., 2002, 74, 5492–5500.
37. R. Martínez-Las Heras, P. Quifer-Rada, A. Andrés and R. Lamuela-Raventós, Polyphenolic profile of persimmon leaves by high resolution mass spectrometry (LC-ESI-LTQ-Orbitrap-MS), J. Funct. Foods, 2016, 23, 370–377.
38. T.-T. Zhang, C.-L. Lu, J.-G. Jiang, M. Wang, D.-M. Wang and W. Zhu, Bioactivities and extraction optimization of crude polysaccharides from the fruits and leaves of Rubus chingii Hu, Carbohydr. Polym., 2015, 130, 307–315.
39. U. Neniskyte, A. Vilalta and G. C. Brown, Tumour necrosis factor alpha-induced neuronal loss is mediated by microglial phagocytosis, FEBS Lett., 2014, 588, 2952–2956.
40. H. Zhou, H. Lutterodt, Z. Cheng and L. Yu, Anti-inflammatory and antiproliferative activities of trifolirhizin, a flavonoid from Sophora flavescens roots, J. Agric. Food Chem., 2009, 57, 4580–4585.
41. J. C. Fernandes, J. Martel-Pelletier and J. P. Pelletier, The role of cytokines in osteoarthritis pathophysiology, Biorheology, 2002, 39, 237–246.
42. J. J. Babon, L. N. Varghese and N. A. Nicola, Inhibition of IL-6 family cytokines by SOCS3, Semin. Immunol., 2014, 26, 13–19.
43. X. Liu, J. Wang, H. Wang, G. Yin, Y. Liu, X. Lei and M. Xiang, REG3A accelerates pancreatic cancer cell growth under IL-6-associated inflammatory condition: Involvement of a REG3A-JAK2/STAT3 positive feedback loop, Cancer Lett., 2015, 362, 45–60.

---