Cocoplum (Chrysobalanus icaco L.) anthocyanins exert anti-inflammatory activity in human colon cancer and non-malignant colon cells

Abstract

Cocoplum (Chrysobalanus icaco L.) (CP) is an anthocyanin-rich fruit found in tropical areas around the globe. CP polyphenols are associated with beneficial effects on health, including reduction of inflammation and oxidative stress. Due to its functional properties, the consumption of this fruit may be beneficial in the promotion of human health and reduce the risk for chronic diseases. The objective of this study was to assess the anti-inflammatory and anti-proliferative activities of anthocyanins extracted from CP (1.0 to 20.0 μg ml⁻¹ gallic acid equivalents [GAE]) in CCD-18Co non-malignant colonic fibroblasts and HT-29 colorectal adenocarcinoma cells. Tumor necrosis factor alpha (TNF-α, 10 ng mL⁻¹) was used to induce inflammation in CCD-18Co cells. CP anthocyanins were identified and quantified using HPLC-ESI-MSⁿ. The chemical analysis of CP extract identified delphinidin, cyanidin, petunidin and peonidin derivatives as major components. Cell proliferation was suppressed in HT-29 cells at 10.0 and 20.0 μg ml⁻¹ GAE and this was accompanied by increased intracellular ROS production as well as decreased TNF-α, IL-1β, IL-6, and NF-κB1 expressions at 20.0 μg ml⁻¹ GAE. Within the same concentration range, there was no cytotoxic effect of CP anthocyanins in CCD-18Co cells and TNF-α-induced intracellular ROS-production was decreased by 17.3%. IL-1β, IL-6 and TNF-α protein expressions were also reduced in TNF-α-treated CCD-18Co cells by CP anthocyanins at 20.0 μg ml⁻¹ GAE. These results suggest that cocoplum anthocyanins possess cancer-cytotoxic and anti-inflammatory activities in both inflamed colon and colon cancer cells.

---

1 Introduction

Inflammatory bowel disease (IBD) presents a major risk factor for colon cancer.¹ Studies indicate that IBD affects 1.5 million individuals in the USA, 2.2 million people in Europe, and many more in other countries.² The American Cancer Society estimates 134 490 new cases of colorectal cancer, responsible for 49 190 deaths in the USA in 2016.³ Although IBD and cancer have different pathogenesis, both inflammation and carcinogenesis are partially attributed to the generation of reactive oxygen species (ROS).^4,5 ROS-induced DNA damage and its consequences in cancer initiation and progression has been widely discussed.^6,7 Additionally, the upregulation of NF-κB and other inflammation biomarkers by ROS (such as hydrogen peroxide) has been identified as an initiating contributor in carcinogenesis.⁴

Several classes of non-nutrient phytochemicals, including phenolic acids, and flavonoids such as anthocyanins, have been described as anti-inflammatory agents that can modulate the expression of cytokines and decrease oxidative stress.^8,9 Therefore, there is a need to identify anti-inflammatory compounds that could be beneficial in IBD and cancer prevention, alone or in combination with current pharmacological treatments.^9,10

Anthocyanins are natural pigments responsible for the blue, red or purple color of fruits and vegetables. Anthocyanins from different sources proved to exert anti-inflammatory activity by decreasing several biomarkers (IL-6, TNF-α and IL-1β).^11–13 These compounds have also being described regarding their selective cytotoxicity to cancer cell lines.^14,15

Cocoplum (CP, Chrysobalanus icaco L.), an anthocyanin-rich fruit,¹⁶ is native to coastal regions around the globe, including the Brazilian Amazon forest. Bioactive compounds in this plant's leaf extracts were previously described as hypoglycemic,¹⁷ antiangiogenic¹⁸ and cytotoxic.¹⁹ CP trees are grown around the world, but the fruits are still underutilized. The polyphenolic profile and major other constituents of this fruit along with the in vivo antigenotoxic activities were described previously.²⁰ However, information about the anti-inflammatory activities of anthocyanins from this fruit in cancer or inflamed cells is limited.

Considering the previously reported activities of anthocyanins on inflammation and carcinogenesis, it is possible that polyphenolic compounds in this understudied fruit could be beneficial in disease prevention. This study was designed to investigate an anthocyanin-rich extract from CP on cell viability, ROS generation, and pro-inflammatory biomarkers in inflamed CCD-18Co non-malignant and HT-29 colon cancer cells.

2 Material and methods

2.1 Chemicals and reagents

Folin–Ciocalteu reagent and 2′7′-dichlorofluorescein diacetate (DCFH-DA) were purchased from Fischer Scientific (Pittsburgh, PA, USA). Tumor necrosis factor alpha (TNF-α) and resazurin solution were purchased from Sigma-Aldrich (St Louis, MO, USA). Bradford reagent, RIPA buffer and proteinase inhibitor cocktail were purchased from Bio-Rad (Hercules, CA, USA). Primers for real-time quantitative PCR (RT-qPCR) were purchased from Integrated DNA Technologies (San Diego, CA, USA) and the beads for protein expression analyses were purchased from EMD Millipore (Billerica, MA, USA). All other reagents had the highest possible purity.

2.2 Anthocyanin extraction

Anthocyanins were extracted from freeze-dried CP fruit using methanol : water (80 : 20) and C₁₈ Sep-Pack columns (Waters Corporation, Milford, MA, USA). Non-anthocyanin polyphenols (such as flavonoids and phenolic acids) were removed from the crude extract with 100% ethyl acetate; a predominantly anthocyanin fraction was collected after elution with 100% methanol containing 0.01% (v/v) HCl.^21,22 Methanol was evaporated under vacuum conditions at 35 °C and re-dissolved in 0.5 M citric acid buffer at pH 3. Total anthocyanins were quantified by differential pH spectrophotometric assay²³ and expressed as μg ml⁻¹ equivalents of cyanidin-3-glucoside. Before use in cell culture, the extract was diluted accordingly based on the total soluble polyphenol content, determined by the Folin–Ciocalteu assay²⁴ and expressed as μg ml⁻¹ gallic acid equivalents (GAE). The extracts were stored at −20 °C until use in cell culture.

2.3 Chemical analyses

CP anthocyanins were tentatively characterized by HPLC-ESI-MSⁿ using a Thermo Finnigan LCQ Deca XP Max ion trap mass spectrometer equipped with an ESI ion source run in positive ionization mode (ThermoFischer, San Jose, CA, USA).²⁵ Compounds were separated on a Phenomenex (Torrace, CA, USA) Synergi 4μ Hydro-RP 80A (2 × 150 mm) in a linear gradient of methanol with 0.1% formic acid into water with 0.1% formic acid over 30 min. Electrospray ionization was conducted with sheath gas (N₂) at 60 units per min and auxiliary gas (N₂) at 5 units per min with spray voltage at 3.3 kV, capillary temperature at 250 °C, capillary voltage at 1.5 V, and tube lens offset at 0 V. Anthocyanin extracts were also manually infused and target ions subjected to MSⁿ fragmentation to help elucidate compound identity. Quantification was then carried out on a Waters 2695 Alliance HPLC system (Waters Corp., Milford, MA) equipped with a Waters 996 photodiode array detector with separations conducted on a 250 × 4.6 mm Acclaim 120 C₁₈ column (Dionex, Sunnyvale, CA) with a C₁₈ guard column, as previously described.²² Individual anthocyanins were monitored at 520 nm and the concentrations of the compounds were calculated according to peak area against a standard curve of cyanidin-3-glucoside (Sigma-Aldrich, St Louis, MO, USA).

2.4 Cell cultures

Human non-cancer colon fibroblast CCD-18Co and colorectal adenocarcinoma HT-29 cells were obtained from ATCC (Manassas, VA, USA) and cultured using Dulbecco's Modified Eagle's Media (DMEM) supplemented with 10% (v/v) fetal bovine serum, and 1% (v/v) penicillin/streptomycin mix. Cells were maintained in an incubator at 37 °C and 5% CO₂ atmosphere. All treatments with CP anthocyanins were diluted in complete culture media immediately before use. TNF-α (10 ng mL⁻¹) was used to induce ROS generation and inflammation in CCD-18Co cultures.

2.5 Cell proliferation assay

Cell proliferation was evaluated according to the methodology described²⁶ with minor modifications. CCD-18Co and HT-29 cells (1 × 10⁴ cells per well) were seeded onto 96-well plates and incubated for 24 hours to allow cell attachment. The cultures were exposed to CP anthocyanins (1.0–20.0 μg ml⁻¹ GAE) for 48 hours, and untreated wells were also included. Resazurin solution (20 μL, Sigma-Aldrich, St Louis, MO, USA) was added to each well, and the plates were incubated for 3 hours. The fluorescence intensity was analyzed using a microplate reader (BMG Labtech Inc. Durhan, NC, USA) at 560 nm excitation and 590 nm emission. Relative cell viability was quantified with the fluorescence intensity in the control group considered as 100%. Three independent experiments were performed.

2.6 Reactive oxygen species generation (ROS) assay

CCD-18Co and HT-29 cells (5 × 10³ and 1 × 10⁴, respectively) were seeded in 96-well plates and incubated for 24 hours. The CCD-18Co cells were treated with TNF-α (10 ng mL⁻¹) for ROS induction, and all cultures were treated with CP anthocyanins (1.0–20.0 μg ml⁻¹ GAE) for 24 hours. Cells were then washed twice with PBS, incubated with 10 μM DCFH-DA for 30 minutes at 37 °C and the fluorescence intensity of each well was measured using a microplate reader (BMG Labtech Inc. Durhan, NC, USA) at 480 nm excitation and 520 nm emission. Relative ROS generation was quantified with the fluorescence intensity in the control group considered as 100%.²⁷ Three independent experiments were performed.

2.7 Quantitative RT-qPCR

CCD-18Co and HT-29 cells (1 × 10⁵ and 1.5 × 10⁵, respectively) were seeded in 12-well plates and incubated for 24 hours. Cells were treated with CP anthocyanins (5.0–20.0 μg ml⁻¹ GAE) for 4 hours. In CCD-18Co cells, 10 ng mL⁻¹ TNF-α was used to induce inflammation. Negative (culture media only) and positive (TNF-α) controls were also performed. Total RNA was isolated and purified using an RNeasy mini kit (QIAGEN, Venlo, Netherlands) according to the manufacturer's protocol. RNA quality and quantification were assessed with NanoDrop® ND-1000 (NanoDrop Technologies, Wilmington, DE, USA). cDNA synthesis was performed with a Reverse Transcription Kit (Invitrogen, Grand Island, NY, USA) according to the manufacturer's protocol. RT-qPCR reactions were performed using SYBR Green PCR MasterMix (Applied Biosystems, Foster City, CA, USA) and an ABI Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). mRNA expression of nuclear factor kappa B (NF-κB1), tumor necrosis factor alpha (TNF-α), interleukin-1 beta (IL-1β) and interleukin 6 (IL-6) were analyzed using beta actin (ACTB) as a reference gene. Primers were designed using Primer Express software (Applied Biosystems, Foster City, CA, USA) (Table 1). Each primer was selected based on its homology using NCBI-BLAST (http://blast.ncbi.nlm.nih.gov/blast.cgi); their specificity was assessed by dissociation curve analysis. The levels of transcripts were calculated relatively to the control group by 2^−ΔΔCt method.²⁸

Table 1 Human primer sequences used in mRNA analyses

Gene	Forward	Reverse
ACTB	GGACTTCGAGCAAGAGATGG	AGCACTGTGTTGGCGTACAG
NF-κB1	GCGAGAGGAGCACAGATACC	CTGATAGCCTGCTCCAGGTC
TNF-α	TCCTTCAGACACCCTCAACC	AGGCCCCAGTTTGAATTCTT
IL-1β	GGGCCTCAAGGAAAAGAATC	TTCTGCTTGAGAGGTGCTGA
IL-6	TACCCCCAGGAGAAGATTCC	TTTTCTGCCAGTGCCTCTTT

---

2.8 Multiplex bead assay

CCD-18Co and HT-29 cells (3 × 10⁵ and 2 × 10⁵, respectively) were seeded in 6-well plates and incubated for 24 hours. Cells were treated with CP anthocyanins (5.0–20.0 μg ml⁻¹ GAE) for 4 hours. In CCD-18Co cells, 10 ng mL⁻¹ TNF-α was used to induce inflammation (positive control). Cells were lysed with RIPA buffer and proteinase inhibitor cocktail (Bio-Rad, Hercules, CA, USA) for 30 minutes at 4 °C. Solid debris was removed by centrifugation (10 500g at 4 °C for 10 minutes), and total protein content was determined using Bradford reagent (Bio-Rad, Hercules, CA, USA) following the manufacturer's protocol. Protein expression assays were performed using xMAP Multiplex Assay and a human cytokine/chemokine magnetic bead panel (EMD Millipore, Billerica, MA, USA) in 96-well plates. Protein lysate (25 μg protein per well) was mixed with beads for TNF-α, IL-1β and IL-6 overnight at 4 °C. Detection antibody was added to each well, and the plates were incubated for 1 hour at room temperature. Streptavidin–phycoerythrin was added, and the plate was incubated again for 30 minutes at room temperature. After successive plate washing steps, the beads were suspended in sheath fluid and analyzed with a Luminex 200 flow cytometer using Luminex xPONENT software (Luminex Corporation, Austin, TX, USA).

2.9 Statistical analyses

All data were analyzed by one-way analysis of variance (ANOVA) with Tukey's posttest using GraphPad Prism 6.0 (GraphPad Software, La Jolla, CA, USA). Data were considered significantly different when p < 0.05.

3 Results

3.1 Anthocyanin quantification and identification

The chemical composition provides information about the molecules in the study treatment and helps discussing its biological effects in the cell lines. The CP extract contained 4586 ± 33 μg ml⁻¹ of total anthocyanins. A chromatogram of the anthocyanins in cocoplum shows six predominant anthocyanin peaks that were tentatively identified and semi-quantified based on HPLC-MS fragmentation patterns (ESI Fig. 1†). However, exact confirmation of esterified glycoside moieties or acylated organic acids could not be fully elucidated under these analytical conditions. Compounds identified included delphinidin-3-glucoside (1162 μg ml⁻¹), cyanidin 3-glucoside (382 μg ml⁻¹), petunidin 3-glucoside that coeluted with either delphinidin 3-(6′′-acetoyl) galactoside or delphinidin 3-(6′′-oxaloyl) arabinoside (1396 μg ml⁻¹), peonidin 3-glucoside (345 μg ml⁻¹), petunidin 3-(6′′-acetoyl) galactoside or petunidin 3-(6′′-oxaloyl) arabinoside (611 μg ml⁻¹) and peonidin 3-(6′′-acetoyl) glucoside or peonidin 3-(6′′-oxaloyl) arabinoside (689 μg ml⁻¹).

3.2 Cell proliferation and ROS generation assays

Cell proliferation is a measure for cytotoxicity of a study treatment, and optimally, the cytotoxicity in cancer cells is significantly higher than in non-cancer cells. CCD-18Co cell growth (Fig. 1A) did not change after 48 hours of treatment with CP anthocyanin-rich extract. However, in HT-29 cells, the extract significantly decreased the cell viability starting at 10.0 μg ml⁻¹. At 20.0 μg ml⁻¹ GAE, HT-29 cell viability was reduced by 50% (Fig. 1B; p < 0.05).

Fig. 1 Cocoplum anthocyanin-rich extract (A) did not inhibit CCD-18Co growth, but (B) decreased the cell viability of HT-29 cells. Different letters indicate significant differences between groups (p < 0.05; ANOVA-Tukey). Data are means ± SD (n = 3).

In CCD-18Co cells, TNF-α-induced ROS were decreased when treated with 20.0 μg ml⁻¹ GAE CP extract for 24 hours (Fig. 2A). In HT-29 cells, all tested CP extract concentrations (1.0–20.0 μg ml⁻¹ GAE) induced ROS generation compared to the control group (Fig. 2B).

Fig. 2 ROS generation in (A) TNF-α-challenged CCD-18Co and (B) HT-29 cells. #: Different from the TNF-α group; different letters indicate significant differences between groups (p < 0.05; ANOVA-Tukey). Data are means ± SD (n = 3).

3.3 mRNA expression

Pro-inflammatory cytokines are biomarkers used to quantify the severity of inflammation in cells. Anti-inflammatory activity is characterized by decreased expression of these molecules. The mRNA expression of NF-κB1, TNF-α, IL-1β and IL-6 in inflamed CCD-18Co colon cells and HT-29 colon cancer cells were investigated (Fig. 3). In CCD-18Co cells, treatments of 10.0 and 20.0 μg ml⁻¹ GAE of CP extract decreased the expression of NF-κB1 compared to TNF-α group. All four target genes were decreased when treated with 20.0 μg ml⁻¹ GAE CP extract in HT-29 cells.

Fig. 3 Differential mRNA expression of (A) NF-κB1, (B) TNF-α, (C) IL-1β and (D) IL-6 in TNF-α-challenged CCD-18Co and HT-29 cells. Different letters within the same cell line indicate significant differences between groups (p < 0.05; ANOVA-Tukey). Data are means ± SD (n = 3).

3.4 Protein expression

The protein expressions of TNF-α, IL-1β and IL-6 in both cell lines are shown in Fig. 4. TNF-α induced the expression of all three inflammatory biomarkers analyzed in CCD-18Co cells. In this cell line, CP extract decreased the expression of TNF-α (5.0–20.0 μg ml⁻¹ GAE), IL-1β and IL-6 (10.0–20.0 μg ml⁻¹ GAE) by up to 2.4-fold, 2.5-fold and 2.3-fold respectively. TNF-α protein was also downregulated in HT-29 cells after 20.0 μg ml⁻¹ GAE CP anthocyanin treatment.

Fig. 4 Expression of pro-inflammatory biomarkers (A) TNF-α, (B) IL-1β and (C) IL-6 in TNF-α-challenged CCD-18Co and HT-29 cells. Different letters within the same cell line indicate significant differences between groups (p < 0.05; ANOVA-Tukey). Data are means ± SD (n = 3).

4 Discussion

Overall, in this investigation, CP anthocyanins exhibited chemopreventive activities in cancer cells, while not exerting cytotoxic activities in non-cancer cells. These compounds also affected the generation of ROS and inflammation in human intestinal cells and therefore have the potential to be used in disease prevention. The concentrations of CP extract were determined based on previous investigations performed by our research group with other anthocyanin-rich fruit extracts within a physiological concentration-range.^29,30

According to previous reports, the major polyphenolic components in CP fruits (identified by HPLC-DAD-MS) are ellagic acid, petunidin and delphinidin, and all-trans-lutein.²⁰ In our investigation, CP extract showed substantial amounts of acylated anthocyanin glycosides with delphinidin, cyanidin, petunidin, or peonidin base aglycones. This extract was not cytotoxic to the non-cancer CCD-18Co cell line, but did decrease cell viability of HT-29 colon cancer cells after 20 μg ml⁻¹ GAE treatment for 48 hours by up to 49.9%. Previously, anthocyanins from Aronia meloncarpa primarily composed of cyanidin-3-galactoside exerted cytotoxicity and cell cycle blockage in HT-29 colon cancer, but not in NCM460 normal colon cells.¹⁴ Peach and plum varieties have been shown to exert selective cytotoxicity – affecting cell viability of breast cancer cells (MDA-MB-435 and MCF-7), but not MCF-10A normal breast cell lines³¹ and this has previously been demonstrated for many polyphenols.³²

Polyphenols from acai (Euterpene oleracea M.), another Amazon-native, anthocyanin-rich fruit, are described as ROS scavenging agents in lipopolysaccharide (LPS)-treated CCD-18Co cells at 1.0–5.0 ng GAE per ml.³⁰ Anthocyanins from red cabbage that contains acylated cyanidin derivatives also decrease LPS- and thrombin-induced ROS in human platelets.³³ In this investigation, the decrease in ROS generation due to CP anthocyanins may improve the antioxidant status of colon cells, since ROS are highly reactive molecules that can damage lipids, proteins and DNA,³⁴ that may lead to carcinogenesis.³⁵ In HT-29 cells, CP anthocyanin-rich extract induced ROS at all tested concentrations (1.0–20.0 μg ml⁻¹ GAE). Increased ROS levels may cause apoptosis and cell death.^36,37 Anthocyanins induce apoptosis in cancer cell lines due to increased ROS generation.^38,39 Therefore, it is possible that the increased ROS generation in HT-29 cells is at least in part responsible for the cytotoxicity observed in this cell line.

The generation of ROS can activate NF-κB through the phosphorylation of IκBα, initiating an inflammatory response.⁴⁰ In this investigation, TNF-α was used to induce inflammation in CCD-18Co cells. Inflammation was not induced in HT-29 cells since this cell line already expresses high ROS levels and inflammation. The investigated pro-inflammatory biomarkers include genes and proteins associated with colorectal cancer promotion, colitis-associated tumorigenesis, and IBD.^41–44

In colorectal cancer, NF-κB increases angiogenesis and cell proliferation, inhibits cell death, and promotes cell invasion and metastasis.⁴⁵ Elevated activity of NF-κB is also involved in cellular resistance to chemotherapy and ionizing radiation,⁴⁶ complicating cancer prognosis and treatment. NF-κB overexpression in myeloid and epithelial colonic cells is also associated with IBD.⁴³ Many drugs used to treat IBD aim to inhibit NF-κB-involved mechanisms.^47,48 In this study, NF-κB1 mRNA was downregulated at 10.0–20.0 μg ml⁻¹ GAE CP anthocyanins by up to 39%.

TNF-α, IL-1β and IL-6 are cytokines associated with both colorectal and colitis-associated tumorigenesis.^41,49 TNF-α initiates an inflammatory response, and is followed by the production of cytokines, chemokines, and adhesion molecules in the colonic endothelium.⁵⁰ TNF-α is often upregulated in colon tumorigenesis and in intestinal tissue of patients with Crohn's disease or other forms of IBD.^49,51 IL-1β is an acute pro-inflammatory cytokine that is increased in colitis-associated and other forms of gastrointestinal cancer.⁴⁹ IL-6 induces colon cancer cell proliferation, stimulating tumor growth and the proliferation of premalignant enterocytes.⁴² While this cytokine plays an important role in colitis and the pathogenic immune response, tissue regeneration process could also be modulated by IL-6.⁵² All TNF-α, IL-1β and IL-6 mRNA were downregulated after treatment with 20.0 μg ml⁻¹ GAE CP extract, and also TNF-α protein levels were decreased by this treatment.

As observed with CP in this investigation, other anthocyanin-rich fruits have been demonstrated to be anti-inflammatory by decreasing the expression of these biomarkers: acai downregulated the expression of LPS-induced NF-κB in CCD-18Co cells.³⁰ Anthocyanins from purple carrot (cyanidin derivatives) decrease the mRNA expression of IL-1β and IL-6 in LPS-induced inflammation in a co-culture of intestinal Caco-2 cells and RAW264.7 macrophages.⁵³ As CP, purple sweet potatoes are rich in acylated anthocyanins and these compounds were described to decrease the production of NO, TNF-α, NF-κB, and IL-6 in LPS-treated macrophages.⁵⁴

In this study, CP anthocyanins decreased pro-inflammatory biomarker expressions in both inflamed normal and cancer cell lines. Therefore, these compounds may have potential as chemopreventive agents in colon cancer cells, as well as in inflammatory intestinal diseases, such as IBD.

5 Conclusion

Cocoplum anthocyanins exerted selective cytotoxicity in HT-29 colon cancer cells and modulated the ROS generation and inflammation in colon cancer and inflamed normal colon cells. The results indicate the chemopreventive and anti-inflammatory effects of this fruit in intestinal cells, shown by the decrease in inflammation markers. Future mechanistic and in vivo studies should clarify the mechanisms of action and the potential of this fruit as a prospective nutraceutical in the prevention of intestinal inflammation and inflammatory diseases. Additionally, pharmacokinetic studies need to be performed in order to determine effective dose levels.

Conflicts of interest

There are no conflicts of interest to declare.

Acknowledgements

This investigation was in part funded by the São Paulo Research Foundation (FAPESP) [grant number 2011/21741-6] and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) [grant number 471700/2012-6 and 248786/2013-0].

References

1. M. Barral, A. Dohan, M. Allez, M. Boudiaf, M. Camus, V. Laurent, C. Hoeffel and P. Soyer, Gastrointestinal cancers in inflammatory bowel disease: An update with emphasis on imaging findings, Crit. Rev. Oncol. Hematol., 2016, 97, 30–46.
2. J. Cosnes, C. Gower-Rousseau, P. Seksik and A. Cortot, Epidemiology and natural history of inflammatory bowel diseases, Gastroenterology, 2011, 140, 1785–1794.
3. R. L. Siegel, K. D. Miller and A. Jemal, Cancer statistics, CA-Cancer J. Clin., 2016, 66, 7–30.
4. V. R. Winrow, P. G. Winyard, C. J. Morris and D. R. Blake, Free radicals in inflammation: second messengers and mediators of tissue destruction, Br. Med. Bull., 1993, 49, 506–522.
5. G. Waris and H. Ahsan, Reactive oxygen species: role in the development of cancer and various chronic conditions, J. Carcinog., 2006, 5, 14.
6. B. N. Ames, Dietary carcinogens and anticarcinogens. Oxygen radicals and degenerative diseases, Science, 1983, 221, 1256–1264.
7. P. Moller and H. Wallin, Adduct formation, mutagenesis and nucleotide excision repair of DNA damage produced by reactive oxygen species and lipid peroxidation product, Mutat. Res., 1998, 410, 271–290.
8. S. J. Hur, S. H. Kang, H. S. Jung, S. C. Kim, H. S. Jeon, I. H. Kim and J. D. Lee, Review of natural products actions on cytokines in inflammatory bowel disease, Nutr. Res., 2012, 32, 801–816.
9. A. M. Mileo and S. Miccadei, Polyphenols as Modulator of Oxidative Stress in Cancer Disease: New Therapeutic Strategies, Oxid Med Cell Longevity, 2016, 2016, 6475624.
10. S. J. Somani, K. P. Modi, A. S. Majumdar and B. N. Sadarani, Phytochemicals and their potential usefulness in inflammatory bowel disease, Phytother. Res., 2015, 29, 339–350.
11. J. Paixao, T. C. Dinis and L. M. Almeida, Malvidin-3-glucoside protects endothelial cells up-regulating endothelial NO synthase and inhibiting peroxynitrite-induced NF-kB activation, Chem. –Biol. Interact., 2012, 199, 192–200.
12. S. M. Poulose, D. R. Fisher, J. Larson, D. F. Bielinski, A. M. Rimando, A. N. Carey, A. G. Schauss and B. Shukitt-Hale, Anthocyanin-rich acai (Euterpe oleracea Mart.) fruit pulp fractions attenuate inflammatory stress signaling in mouse brain BV-2 microglial cells, J. Agric. Food Chem., 2012, 60, 1084–1093.
13. S. G. Lee, B. Kim, Y. Yang, T. X. Pham, Y. K. Park, J. Manatou, S. I. Koo, O. K. Chun and J. Y. Lee, Berry anthocyanins suppress the expression and secretion of proinflammatory mediators in macrophages by inhibiting nuclear translocation of NF-kappaB independent of NRF2-mediated mechanism, J. Nutr. Biochem., 2014, 25, 404–411.
14. M. Malik, C. Zhao, N. Schoene, M. M. Guisti, M. P. Moyer and B. A. Magnuson, Anthocyanin-rich extract from Aronia meloncarpa E induces a cell cycle block in colon cancer but not normal colonic cells, Nutr. Cancer, 2003, 46, 186–196.
15. C. Zhao, M. M. Giusti, M. Malik, M. P. Moyer and B. A. Magnuson, Effects of commercial anthocyanin-rich extracts on colonic cancer and nontumorigenic colonic cell growth, J. Agric. Food Chem., 2004, 52, 6122–6128.
16. E. S. de Brito, M. C. de Araujo, R. E. Alves, C. Carkeet, B. A. Clevidence and J. A. Novotny, Anthocyanins present in selected tropical fruits: acerola, jambolao, jussara, and guajiru, J. Agric. Food Chem., 2007, 55, 9389–9394.
17. J. M. Barbosa-Filho, T. H. C. Vasconcelos, A. A. Alencar, L. M. Batista, R. A. G. Oliveira, D. N. Guedes, H. S. Falcão, M. D. Moura, M. F. F. M. Diniz and J. Modesto-Filho, Plants and their active constituents from South, Central, and North America with hypoglycemic activity, Rev. Bras. Farmacogn., 2005, 15, 392–413.
18. S. Alves de Paulo, I. T. Balassiano, N. H. Silva, R. O. Castilho, M. A. C. Kaplan, M. C. Cabral and M. G. C. Carvalho, Chrysobalanus icaco L. extract for antiangiogenic potential observation, Int. J. Mol. Med., 2000, 5, 667–669.
19. J. Fernandes, R. O. Castilho, M. R. da Costa, K. Wagner-Souza, M. A. Coelho Kaplan and C. R. Gattass, Pentacyclic triterpenes from Chrysobalanaceae species: cytotoxicity on multidrug resistant and sensitive leukemia cell lines, Cancer Lett., 2003, 190, 165–169.
20. V. P. Venancio, M. C. Marques, M. R. Almeida, L. R. Mariutti, V. C. Souza, F. Barbosa, Jr., M. L. Pires Bianchi, C. M. Marzocchi-Machado, A. Z. Mercadante and L. M. Antunes, Chrysobalanus icaco L. fruits inhibit NADPH oxidase complex and protect DNA against doxorubicin-induced damage in Wistar male rats, J. Toxicol. Environ. Health, Part A, 2016, 79, 885–893.
21. L. E. Rodriguez-Saona and R. E. Wrolstad, in Current protocols in food analytical chemistry, ed. R. E. Wrolstad, John Wiley & Sons, New York, 2001, pp. Unit F.1.1.1–Unit F1.1.11.
22. P. de Aguiar Cipriano, L. Ekici, R. C. Barnes, C. Gomes and S. T. Talcott, Pre-heating and polyphenol oxidase inhibition impact on extraction of purple sweet potato anthocyanins, Food Chem., 2015, 180, 227–234.
23. J. Lee, R. W. Durst and R. E. Wrolstad, Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: collaborative study, J. AOAC Int., 2005, 88, 1269–1278.
24. V. L. Singleton and J. A. Rossi, Colorimetry of Total Phenolics with Phosphomolybdic-Phosphotungstic Acid Reagents, Am. J. Enol. Vitic., 1965, 16, 144–158.
25. L. A. Pacheco-palencia, P. Hawken and S. T. Talcott, Juice matrix composition and ascorbic acid fortification effects on the phytochemical, antioxidant and pigment stability of açai (Euterpe oleracea Mart.), Food Chem., 2007, 105, 28–35.
26. J. Wang and G. Mazza, Inhibitory effects of anthocyanins and other phenolic compounds on nitric oxide production in LPS/IFN-gamma-activated RAW 264.7 macrophages, J. Agric. Food Chem., 2002, 50, 850–857.
27. S. U. Mertens-Talcott, J. A. Bomser, C. Romero, S. T. Talcott and S. S. Percival, Ellagic acid potentiates the effect of quercetin on p21waf1/cip1, p53, and MAP-kinases without affecting intracellular generation of reactive oxygen species in vitro, J. Nutr., 2005, 135, 609–614.
28. T. D. Schmittgen and K. J. Livak, Analyzing real-time PCR data by the comparative C(T) method, Nat. Protoc., 2008, 3, 1101–1108.
29. G. D. Noratto, G. Angel-Morales, S. T. Talcott and S. U. Mertens-Talcott, Polyphenolics from acai (Euterpe oleracea Mart.) and red muscadine grape (Vitis rotundifolia) protect human umbilical vascular Endothelial cells (HUVEC) from glucose- and lipopolysaccharide (LPS)-induced inflammation and target microRNA-126, J. Agric. Food Chem., 2011, 59, 7999–8012.
30. M. M. Dias, H. S. Martino, G. Noratto, A. Roque-Andrade, P. C. Stringheta, S. Talcott, A. M. Ramos and S. U. Mertens-Talcott, Anti-inflammatory activity of polyphenolics from acai (Euterpe oleracea Martius) in intestinal myofibroblasts CCD-18Co cells, Food Funct., 2015, 6, 3249–3256.
31. M. Vizzotto, W. Porter, D. Byrne and L. Cisneros-Zevallos, Polyphenols of selected peach and plum genotypes reduce cell viability and inhibit proliferation of breast cancer cells while not affecting normal cells, Food Chem., 2014, 164, 363–370.
32. K. Sak, Cytotoxicity of dietary flavonoids on different human cancer types, Pharmacogn. Rev., 2014, 8, 122–146.
33. J. Saluk, M. Bijak, M. M. Posmyk and H. M. Zbikowska, Red cabbage anthocyanins as inhibitors of lipopolysaccharide-induced oxidative stress in blood platelets, Int. J. Biol. Macromol., 2015, 80, 702–709.
34. J. W. Baynes, Role of oxidative stress in development of complications in diabetes, Diabetes, 1991, 40, 405–412.
35. K. Linhart, H. Bartsch and H. K. Seitz, The role of reactive oxygen species (ROS) and cytochrome P-450 2E1 in the generation of carcinogenic etheno-DNA adducts, Redox Biol., 2014, 3, 56–62.
36. A. Zugic, I. Jeremic, A. Isakovic, I. Arsic, S. Savic and V. Tadic, Evaluation of Anticancer and Antioxidant Activity of a Commercially Available CO2 Supercritical Extract of Old Man's Beard (Usnea barbata), PLoS One, 2016, 11, e0146342.
37. V. Kuete, L. P. Sandjo, A. T. Mbaveng, M. Zeino and T. Efferth, Cytotoxicity of compounds from Xylopia aethiopica towards multi-factorial drug-resistant cancer cells, Phytomedicine, 2015, 22, 1247–1254.
38. M. Alhosin, A. J. Leon-Gonzalez, I. Dandache, A. Lelay, S. K. Rashid, C. Kevers, J. Pincemail, L. M. Fornecker, L. Mauvieux, R. Herbrecht and V. B. Schini-Kerth, Bilberry extract (Antho 50) selectively induces redox-sensitive caspase 3-related apoptosis in chronic lymphocytic leukemia cells by targeting the Bcl-2/Bad pathway, Sci. Rep., 2015, 5, 8996.
39. T. Sharif, M. Stambouli, B. Burrus, F. Emhemmed, I. Dandache, C. Auger, N. Etienne-Selloum, V. B. Schini-Kerth and G. Fuhrmann, The polyphenolic-rich Aronia melanocarpa juice kills teratocarcinomal cancer stem-like cells, but not their differentiated counterparts, J. Funct. Foods, 2013, 5, 1244–1252.
40. M. J. Morgan and Z. G. Liu, Crosstalk of reactive oxygen species and NF-kappaB signaling, Cell Res., 2011, 21, 103–115.
41. S. Wang, Z. Liu, L. Wang and X. Zhang, NF-kappaB signaling pathway, inflammation and colorectal cancer, Cell. Mol. Immunol., 2009, 6, 327–334.
42. C. Becker, M. C. Fantini, S. Wirtz, A. Nikolaev, H. A. Lehr, P. R. Galle, S. Rose-John and M. F. Neurath, IL-6 signaling promotes tumor growth in colorectal cancer, Cell Cycle, 2005, 4, 217–220.
43. D. C. Chung, The genetic basis of colorectal cancer: insights into critical pathways of tumorigenesis, Gastroenterology, 2000, 119, 854–865.
44. M. F. Neurath, Cytokines in inflammatory bowel disease, Nat. Rev. Immunol., 2014, 14, 329–342.
45. W. E. Naugler and M. Karin, NF-kappaB and cancer-identifying targets and mechanisms, Curr. Opin. Genet. Dev., 2008, 18, 19–26.
46. C. Y. Wang, M. W. Mayo and A. S. Baldwin, Jr., TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappaB, Science, 1996, 274, 784–787.
47. C. Wahl, S. Liptay, G. Adler and R. M. Schmid, Sulfasalazine: a potent and specific inhibitor of nuclear factor kappa B, J. Clin. Invest., 1998, 101, 1163–1174.
48. S. Majumdar and B. B. Aggarwal, Methotrexate suppresses NF-kappaB activation through inhibition of IkappaBalpha phosphorylation and degradation, J. Immunol., 2001, 167, 2911–2920.
49. B. K. Popivanova, K. Kitamura, Y. Wu, T. Kondo, T. Kagaya, S. Kaneko, M. Oshima, C. Fujii and N. Mukaida, Blocking TNF-alpha in mice reduces colorectal carcinogenesis associated with chronic colitis, J. Clin. Invest., 2008, 118, 560–570.
50. J. Terzic, S. Grivennikov, E. Karin and M. Karin, Inflammation and colon cancer, Gastroenterology, 2010, 138, 2101–2114.
51. G. Kollias, Modeling the function of tumor necrosis factor in immune pathophysiology, Autoimmun. Rev., 2004, 3(Suppl 1), S24–S25.
52. S. M. Dann, M. E. Spehlmann, D. C. Hammond, M. Iimura, K. Hase, L. J. Choi, E. Hanson and L. Eckmann, IL-6-dependent mucosal protection prevents establishment of a microbial niche for attaching/effacing lesion-forming enteric bacterial pathogens, J. Immunol., 2008, 180, 6816–6826.
53. A. Olejnik, K. Kowalska, M. Kidon, J. Czapski, J. Rychlik, M. Olkowicz and R. Dembczynski, Purple carrot anthocyanins suppress lipopolysaccharide-induced inflammation in the co-culture of intestinal Caco-2 and macrophage RAW264.7 cells, Food Funct., 2016, 7, 557–564.
54. M. Sugata, C. Y. Lin and Y. C. Shih, Anti-Inflammatory and Anticancer Activities of Taiwanese Purple-Fleshed Sweet Potatoes (Ipomoea batatas L. Lam) Extracts, BioMed Res. Int., 2015, 2015, 768093.

---

Footnote

† Electronic supplementary information (ESI) available. See DOI: 10.1039/c6fo01498d

---