Systematic investigation of β-dicalcium silicate-based bone cements in vitro and in vivo in comparison with clinically applied calcium phosphate cement and Bio-Oss®

Abstract

Ca-silicate cements have drawn considerable attention for their potential applications in the field of bone repair due to their excellent bioactivity in vitro. Significant progress with regard to physicochemical properties and optimization of fabrication techniques of this new cement system has been achieved. However, it is unknown whether these so-called bioactive cements could efficiently repair critical-size bone defects in vivo. Herein we systematically investigated the biological performance of a β-dicalcium silicate (β-C₂S)-based bone cement in comparison with the clinically used calcium phosphate cement (CPC) and Bio-Oss®. The results indicated that β-C₂S-based cement with 25% gypsum exhibited appreciable Ca and Si release and weight loss (∼28%) in Tris buffer within the initial 7 d but then maintained a mild degradation rate during 1–4 weeks. Also, the β-C₂S-based cement extracts readily enhanced MC3T3 proliferation at a 25 mg ml⁻¹ level at 4 d and ALP expression at 50–100 mg ml⁻¹ levels at 7 d. For the β-C₂S-based group, increased mRNA levels of osteogenic genes, including Collagen I, osteocalcin, special protein 7, and runt-related transcription factor 2, were observed. In particular, histological staining and microCT reconstruction analyses demonstrated that this new cement could significantly enhance new bone regeneration in a critical-sized skull defect model in rabbits compared with CPC and Bio-Oss®. These findings suggest that β-C₂S-based biocement is a promising bone implant for bone regeneration and repair due to its excellent biological performance in vitro and in vivo.

---

1. Introduction

The increasing number of bone defects caused by trauma, inflammation and tumour resection in orthopedic and maxillofacial surgery has brought about a huge demand for bone grafting materials.^1,2 Autologous bone grafts are still considered the gold standard for skeletal reconstruction. However, donor site morbidity, obligatory graft resorption phase, and insufficient donor bone supply have limited their application.³ Due to the similarity to human bone and sufficient source from animals, heterografts or xenografts have been extensively investigated, especially cancellous bovine bone.⁴ Bio-Oss® (Geistlich, Switzerland) is a deproteinized bovine bone material, which has been reported to be highly biocompatible, resorbable, and to have long-term efficacy in various studies in vivo.⁵ However, some experimental studies showed its osteoblast proliferation and differentiation were lower than autologous bone.⁶ Some recent research has shown the material to be unpredictable in its amount of bone formation and not to be totally resorbable.⁷ Poor osteoinductive capability and low resorbability have also impacted its clinical performance.⁸

In the past two decades, reconstruction of bone defects has also been attempted with calcium phosphates (CaPs) because of their compositional similarity to natural bone mineral. In particular, calcium phosphate cements (CPCs), due to good self-setting, easy-shaping capability and biocompatibility, have been widely used as bone implants clinically.⁹ Unfortunately, a major drawback in using these self-setting materials is their lack of full biodegradability and osteoinductivity after implantation.¹⁰ In fact, previous study has shown that their degradation kinetics tend to be slow.¹¹ Therefore, it remains a challenge to develop self-setting biomaterials with expected resorbability and osteoinductivity.

In recent years, many studies have shown that silicon-containing biomaterials exhibit good bioactivity and have the potential to promote osteogenesis.^12–16 Silicate, which can be combined with ion Ca²⁺, has shown its superiority in preosseous and osseous tissue repair in vitro and vivo.^11,17–21 Many Ca-silicate ceramics have shown capability in bone regeneration.²² However, all the ceramics fabricated by these methods such as sintered or polymer foam replication have an established shape so that it is difficult to fill them to the bone defect and deliver them to form the desired shape.

β-C₂S, which is one of the main components in Portland cement and the most reactive polymorph of five polymorphs of dicalcium silicate,²³ has been applied to osteogenesis in recent years.^24,25 The self-setting property of β-C₂S-based cements is due to the progressive hydration of the SiO₄⁴⁻ ions. When they react with water, a nanoporous, amorphous calcium sulfate hemihydrate (CSH) gel is deposited on the original material, while Ca(OH)₂ crystals nucleate and grow in the available capillary pore space in the previously deposited CSH gel. As time proceeds, the CSH gels polymerize and harden. The self-setting progress of the cements is mainly attributed to the formation of a solid network, which is also associated with the increasing density and mechanical strength.²⁶ In a previous study,²⁷ β-dicalcium silicate (β-Ca₂SiO₄, β-C₂S)-based composite cements with CSH, have been demonstrated to be promising self-setting, injectable, and bioactive materials, which might solve some clinical technical problems in irregular bone defects requiring minimally invasive therapy. It was confirmed that the CSH within the composite cement will form a paste that can set and harden more rapidly than β-C₂S, which could further accelerate the solidification process of the composite cement. The setting time of the workable cement was about 15 min and showed higher compressive strength (∼32.8–37.2 MPa) than some kinds of CPCs.²⁸ In a previous study,²⁷ it was confirmed that with increasing CSH content, the setting time and injectability of the pastes decreased, while the degradation and compressive strength increased. When the ratio was between 80 : 20 and 70 : 30, the setting time could be significantly reduced to shorter than 40 min, the compressive strength still higher than 32 MPa and the injectable time was between 15 and 20 min. A ratio between 80 : 20 and 70 : 30 might make a paste affording a suitable setting time for operation in the clinic and sufficient compressive strength to support the bone defect and guide the bone ingrowth. Therefore, in this research the middle ratio 75 : 25 between 80 : 20 and 70 : 30, was selected for application in vitro and vivo. In addition, it also could induce apatite formation^29,30 in simulated physiological fluid and promote cell viability¹⁸ and has been proven to be a prospective graft for bone regeneration in previous studies.^26,27

Based on the work mentioned above, β-dicalcium silicate (β-Ca₂SiO₄, β-C₂S)-based composite cements with CSH have shown their availability for bone repair in the clinic. However, few studies have been conducted on β-C₂S in vivo so far, particularly compared with other artificial bone implants. In this regard, herein our objective is to explore the potential biological performances of this new bone cement in vivo and in vitro, in comparison with the clinically used CPC and Bio-Oss®.

2. Materials and methods

2.1 Preparation of β-C₂S composite and CPC cement

β-C₂S and CSH powders were prepared by sol–gel³¹ and hydrothermal reaction methods,³² respectively. The resultant powders were sieved to 400 mesh for further experiments. The β-C₂S/CSH mixtures with 25 wt% CSH were moistened using deionized water with a liquid-to-solid ratio of 0.6 ml g⁻¹, and then stirred into a homogeneous paste. The paste was transferred into a stainless steel mold (Ø 6 mm × 4 mm) to create test units for in vitro tests, or directly filled into the cranial bone defect in the animal model experiment. All operations were performed under sterile conditions.

CPC (Rebone Co., China) was a commercial product and has 5 g powder and one bottle of liquid per box. According to the manufacture’s instruction, the powder and liquid were mixed and stirred into a paste. The paste was also transferred into a stainless steel mold (Ø 6 mm × 4 mm) to create test units for in vitro tests, or directly filled into the cranial bone defect in the animal model experiment, as for the β-C₂S composite. All operations were performed under sterile conditions.

2.2 Degradation and ion release in vitro

The cylinder-formed β-C₂S composite and CPC test units (Ø 6 mm × 4 mm), and Bio-Oss® were soaked in 0.05 M Tris–HCl (pH = 7.4) solution at 37 °C with a surface area/volume ratio of 0.1 cm⁻¹ in tubes and maintained in a shaking water bath at 37 °C. At the preset time stage, the samples (n = 6) of all groups were retrieved respectively to measure weight loss. To measure the dry weight, all samples were dried at 85 °C for 4 h. The weight loss was calculated as follows: weight loss (%) = (W₀ − W_t)/W₀ × 100%, where W₀ was the dry weight of an initial specimen, and W_t was that of the specimen at day t. Meanwhile, the calcium and silicon concentrations and pH values in the buffers were examined using inductively coupled plasma-atomic emission spectrometry (ICP-ACE, Optima 2100) and an electrolyte-type pH meter (FE20K, Mettler Toledo).

2.3 Cell culture in vitro

To evaluate the effects of various materials on cell proliferation and differentiation, the cell viability and alkaline phosphatase (ALP) activity of MC3T3, a mouse-derived osteogenic precursor cell line (Cell Culture Center, Chinese Academy of Medical Science, China), were evaluated after the cells were cultivated with the supernatants of various materials soaked in Dulbecco’s modified eagle medium (DMEM, Gibco, USA). The various supernatants were collected as follows.

The β-C₂S-based cement, CPC, and Bio-Oss® were crushed into 100 mesh fine powders and then added to DMEM at concentrations of 6.25, 12.5, 25, 50, 100, and 200 mg ml⁻¹ respectively. After shaking in a 37 °C water bath for 48 h, the suspensions were centrifuged and the supernatants were collected and stored at 4 °C.

MC3T3 cells were cultivated with DMEM (10% fetal bovine serum (FBS, Gibco, USA)). The cells were detached with 0.25% trypsin, 0.03% ethylene diamine tetraacetic acid (EDTA, Ginuo, China) and the cell density was calculated and used at the desired density in later experiments.

2.3.1 Cell viability. For the cell proliferation assay, a 100 μl MC3T3 cell suspension with a density of 2 × 10⁴ cell per ml was added to each well of a 96-well plate and incubated for 24 h. The culture medium was then replaced with 100 μl extract, while the control group continued to be cultivated with DMEM (10% FBS). After incubation for 1, 4, and 7 d, the proliferation of MG3T3 was determined using the Cell Counting Kit-8 (CCK-8, Dojindo, Japan). Briefly, CCK-8 solution was added to 96-well plates, then the cells were incubated for 2 h, and absorbance was measured at 570 nm using an MRX Revelation 96-well multiscanner (Dynex Technologies, Chantilly, VA).

2.3.2 Determination of alkaline phosphatase (ALP) activity. For the cell differentiation assay, a 100 μl MC3T3 cell suspension with a density of 1.6 × 10⁴ cell per ml was added to each well of a 96-well plate and incubated with DMEM for 24 h. The cells were then cultivated with supernatants for 7 days, with the control group cultivated with DMEM (10% FBS). The alkaline phosphatase (ALP) activity was determined with an alkaline phosphatase assay kit (Jiancheng Bioengineering Co., Nangjing, China) according to the manufacturer’s instructions.

2.4 Skull defect repair in rabbit model

Sixteen adult New Zealand white rabbits of 2.5 to 3.0 kg in weight were used in this study, with the approval of the Ethics Committee of Zhejiang University. Surgery^33,34 was performed under general anesthesia which was achieved by intravenous injection of pentobarbital sodium (30 mg kg⁻¹, Sigma). The animal was placed in a prone position and the cranium was shaved and disinfected with povidone iodine. A longitudinal incision was made along the midline from the nasal bone to the occipital protuberance and the skin flap was elevated to expose the cranial region. Once the periosteum was removed, four circular bone defects, each of 8 mm in diameter, were created by removing the full-thick bone disc with a dental trephine bur (Fig. 1). The defects were at least 5 mm away from each other. The four circular defects were randomly filled with β-C₂S-based cement, CPC, Bio-Oss® particles or, as control, left unrepaired. After material solidification, the incision was closed by suture. The rabbits were euthanized with an injection of pentobarbital sodium overdose (120 mg kg⁻¹, Sigma) 6 or 12 weeks postoperatively. The cranial bones were harvested for histology, micro-CT scanning and RT-PCR.

Fig. 1 Construction of skull defect model and materials implantation. (A) Skull defects of a New Zealand rabbit. (B) Implanted β-C₂S composite (a), CPC (b) and Bio-Oss® (c) in the defect site. Blank (d) was the control.

2.4.1 HE staining. Samples were cut from the skull and immersed in 4% neutral buffered formalin for 48 h. After being decalcified in 5% formic acid for 14 days, the samples were dehydrated in a graded series of alcohol and embedded in paraffin. Four-millimetre-thick sections were cut perpendicular to the circular defect and stained with hematoxylin–eosin.

2.4.2 MicroCT analysis. After the samples (n = 5) were cut from the skull and fixed, MicroCT measurements were performed using a microCT system (vivaCT100, Scanco Medical, Switzerland; 80 kVp, 80 mA) and scanning parallel to the circular defect. In order to quantify the amount and quality of the newly formed bone, a circular region of interest (ROI) (8 mm diameter) based on manually traced contours was chosen to calculate the calcification volume in the bone defect area. The scanned dataset was processed and the ROI was reconstructed with MicView software.

2.4.3 Real-time polymerase chain reaction (real-time PCR) analysis. Twelve weeks postoperatively the samples (n = 3) were removed from the skull using a dental drill and frozen in liquid nitrogen. The frozen samples were ground and the total RNA was extracted using TRIzol reagent (Invitrogen) using the procedure described by the manufacturer. RNA concentration was determined by optical density at 260 nm (OD260). First strand cDNA was reverse transcribed from 1 mg of total RNA by RevertAid M-MuLV reverse transcriptase (Fermentas) according to the manufacturer’s instructions. Real-time PCR was performed on the markers of Collagen I, OCN, SP7, Runx2, with GAPDH as the housekeeping gene for normalization. The primer sequences and conditions were as listed in Table 1. Forty cycles were used to amplify all gene sequences and the comparative expression level was obtained by transforming the logarithmic values into absolute values using 2^{−ΔCT=CT(target)−CT(control)}.

Table 1 Real-time PCR primers and conditions

Gene	Primer sequences (5′ to 3′)	Size (bp)	Annealing (°C)
Rabbit OCN	GGCTCAGCCTTCGTGTCCAA	77	63
	CCCTGCCCGTCGATCAGTT
Rabbit Osterix	GGCACGAAGAAGCCATACTCTGT	163	63
	GGGAAAAGGCCGGGTAGTCAT
Rabbit RUNX2	CCCAAGCATTTCATCCCTCACT	109	63
	CATACCGAGGGACATGCCTGA
Rabbit-Col I	GCGGTGGTTACGACTTTGGTT	140	63
	AGTGAGGAGGGTCTCAATCTG
Rabbit GAPDH	CCGCCTGGAGAAAGCTGCTAA	106	63
	GACGACCTGGTCCTCGGTGTA

---

2.5 Statistical analysis

Statistical analysis was performed with one-way analysis of variance (ANOVA), using the SPSS 16.0 for Windows statistics software package. Differences were considered significant at p < 0.05.

3. Results

3.1 Degradation and ion release in vitro

Fig. 2a shows the degradation rate of the samples after being soaked in Tris–HCI solution. The β-C₂S group degraded markedly in the initial 7 days and significantly higher than the other two groups during the whole test period (p < 0.05). All groups showed an alkaline-to-acidic pH transition (Fig. 2b). However, the pH level of the β-C₂S composites group changed least (p < 0.05).

Fig. 2 (a) Degradation of three groups in Tris–HCI solution after soaking for 1, 4, 7, 14, 21, 28 d. (b) The pH value of the Tris–HCI solution after soaking for 1, 4, 7, 14, 21, 28 d (FE20K, Mettler Toledo). *p < 0.05.

The cumulative Ca²⁺ and Si⁴⁺ release of the three composites in Tris–HCl is shown in Fig. 3. A burst release of Ca²⁺ was observed in the initial seven days in the β-C₂S group and then the release continued in a mild way. During the whole test period, significantly more Ca²⁺ was released with the β-C₂S group than with the other two groups (p < 0.01) (Fig. 3a). Si⁴⁺ release was detected only for the β-C₂S group (Fig. 3b).

Fig. 3 (a) Concentration of Ca²⁺ ions released in the Tris–HCI solution after soaking for 1, 4, 7, 14, 21, 28 d (ICP-ACE, Optima 2100), *p < 0.05. (b) Concentration of Si⁴⁺ ions released in the Tris–HCI solution after soaking for 1, 4, 7, 14, 21, 28 d (ICP-ACE, Optima 2100).

3.2 Cell culture analysis in vitro

3.2.1 Cell viability evaluation. Fig. 4 shows the viability of MC3T3 cells after incubation in the extracts of three powders for 1, 4, 7 d. On the first day, there was no difference in MC3T3 viability among the groups (p > 0.05) (Fig. 4a).

Fig. 4 Cell proliferation in the presence of the dissolution extracts of the cements after culturing for different periods. (a) 1 day; (b) 4 days; (c) 7 days. *Significant difference between the β-C₂S composite and the others, *p < 0.05, **p < 0.01.

On day 4, the viability of MC3T3 cells cultured in extracts of the β-C₂S group was significantly higher than that of the others at the concentrations of 12.5 mg ml⁻¹ (p < 0.05) and 25 mg ml⁻¹ (p < 0.01), and significantly higher than that of the Bio-Oss® group and negative control at the concentrations of 50 mg ml⁻¹ (p < 0.01) (Fig. 4b).

On day 7, the viability of MC3T3 cells cultured in extracts of the β-C₂S group was significantly higher than that of the other groups at the concentrations of 12.5, 25 mg ml⁻¹ (p < 0.01) and 50 mg ml⁻¹ (p < 0.05) (Fig. 4c).

3.2.2 Alkaline phosphatase (ALP) activity evaluation. Fig. 5 shows the ALP activity of MC3T3 cells after incubation in the extracts of three powders for 7 d. On day 7, the ALP activity of MC3T3 cells cultured in extracts of the β-C₂S group was significantly higher than that of the other groups at the concentrations of 50 and 100 mg ml⁻¹ (p < 0.05).

Fig. 5 ALP activity of MC3T3 cells in the presence of the dissolution extracts of the cements after culturing for 7 days. *Significant difference between the β-C₂S composite and the others, *p < 0.05.

3.3 In vivo evaluation of skull defect repair

3.3.1 Histological observation. Fig. 6 shows the histological staining with HE in rabbit skull defects at 6 and 12 weeks. Fig. 6A–F show the interfaces of the newly formed bone and the residual materials. Fig. 6G–H show the interfaces of the defects in blank controls. It can be observed that all groups showed absorption of materials while the newly formed bone was around the materials. At both 6 and 12 weeks, the blank control was invaded by thin and loosely organized connective fibrous tissue and no new bone was observed (Fig. 6G and H). The β-C₂S group (Fig. 6A) showed a large amount of trabecular bone and bone marrow was seen in the intertrabecular region at 6 weeks. The residual material could be seen next to the bone and the bone ingrowth was observed in the interface of bone and residual material (Fig. 6A). By the twelfth week, the trabecular region had become thicker and the bone marrow area had shrunk. The residual material of β-C₂S was less than at 6 weeks. The CPC group showed a small irregular shaped new bone area within the implant at 6 weeks and the new bone area became larger at 12 weeks. The new bone formation was over the residual material edges of CPC. But there was still a larger area of residual material than that of β-C₂S. The Bio-Oss® group showed a small irregular shaped new bone area attached to the implant and bone marrow was seen in the newly formed bone at 6 weeks. By the twelfth week, the trabecular area had become a little thicker and the bone marrow area had shrunk. However, the Bio-Oss® group had hardly absorbed. It could be seen that β-C₂S degraded faster than the other two and there was more mature and quantitative bone formed.

Fig. 6 Histological staining with HE in rabbit skull defects. NB: new bone; BM: bone marrow; F: fibrous.

3.3.2 MicroCT analysis. Both six weeks and twelve weeks after the cranial critical size bone defect was filled with various materials, the Bio-Oss® group demonstrated the highest calcification volume in the defect area, followed by the β-C₂S group and then the CPC group, while the control group showed the lowest (p < 0.01) (Fig. 7). It is worth mentioning that the most significant increase of calcification volume from six weeks to twelve weeks postoperatively was observed in the β-C₂S group (p < 0.01).

Fig. 7 Bone regeneration in rabbit skull defects after implantation. (A) Quantitative analysis of calcification volume by micro-CT. *p < 0.05, **p < 0.01, compared with CPC; ^#p < 0.05, ^##p < 0.01, compared with Bio-Oss®. (B) 3D micro-CT reconstructed views of skull defects at 6 and 12 weeks.

3.3.3 mRNA expression by real-time polymerase chain reaction (real-time PCR). As was shown by RT-PCR in Fig. 8, the β-C₂S composite group possessed significantly higher mRNA expression of osteogenic genes Collagen I, OCN, SP7 and Runx2 than those of the other two (p < 0.01) at the time of 12 weeks after bone defect repair.

Fig. 8 Collagen I, OCN, SP7, Runx2 mRNA expression by real-time PCR of four groups after 12 weeks implantation. *p < 0.05, **p < 0.01, compared with CPC; ^#p < 0.05, ^##p < 0.01, compared with Bio-Oss®.

4. Discussion

For an ideal bone substitute, an implantation material should have an appropriate absorbability rate, good osteoconduction and osteoinductivity. In this study, the degradation and ion release of the three materials were investigated and compared to each other. The β-C₂S composite showed faster degradation in vitro (Fig. 2a) and in vivo (Fig. 6) than the other two. Greater Ca²⁺ release and the only material to show Si⁴⁺ release were observed for the β-C₂S group in vitro. Higher cell viability and ALP activity of β-C₂S group were also seen in cell culture in vitro. Meanwhile, more new bone formation was observed by histology and micro-radiography reconstruction analyses and increased mRNA levels of osteogenic gene expression were detected by RT-PCR in vivo. The different performances of the three groups may have contributed to the different material properties of the three grafts.

It is well-recognized that bone grafts should degrade gradually to provide enough space for the newly formed bone to grow in.³⁵ Based on the results from the degradation in vitro, the β-C₂S group degraded significantly faster than the other two in the initial 7 d and continued to degrade in the next 3 weeks while the other two nearly stopped degrading (Fig. 2a). This is because β-C₂S has a significantly higher solubility than the main components Ca₃(PO₄)₂ of CPC and Ca₁₀(PO₄)₆(OH)₂ of Bio-Oss®. What is more, as mentioned above, the ratio of CSH could change the degradation of the composites and the solubility of CSH is also higher than that of β-C₂S. The fast degradation in the initial 7 days might be due to the fast degradation of CSH which accounted for twenty-five percent in the composite. The fast degradation of CSH may lead to the formation of macropores within the cement during the degradation period in vivo, which could improve the osteointegration of the cement.^27,36 The CSH played the role of pore former in this process. This process made the β-C₂S composite become a good scaffold material to support more new bone ingrowth than the other two. It is reported that with the degradation, the ion exchange of Ca²⁺ released from the bone grafts with H⁺ in solution makes the pH value of the microenvironment in β-C₂S increase and a higher pH of the solution might be propitious to the application of the β-C₂S composite in the clinic.³⁷ In our previous study,³² with increasing ratio of CSH, the pH value could be adjusted to be lower and stable around the value of 7. In this research, all the soaking solutions showed an alkaline to acidic pH transition, but the pH values of the β-C₂S group showed the minimum change and were the most close to the pH value of body fluid (7.35–7.45; Fig. 2b). This could afford a stable microenvironment for cell metabolism and function.³⁸

In vitro cell–material interaction is a standard criterion for evaluating biomaterials. It has been observed that the ionic products of β-C₂S may enhance differentiation and proliferation of osteoblasts.³⁹ From the evidence of this research, CCK-8, ALP activity analyses indicated that the β-C₂S composites could facilitate cell proliferation and enhance the ALP activity secreted by the cells (Fig. 4 and 5). It can be seen that, at the middle concentrations 12–50 mg ml⁻¹, β-C₂S showed its superiority with respect to the other two. This might also be related to the ion concentration and it could be speculated that the number of ions in the extracts increased with concentration and took effect gradually. But over-rich ion concentrations might cause an inhibition effect on the cells. This result was consist with a previous study.⁴⁰ Alkaline phosphatase activity is one of the most widely used markers of osteogenic differentiation in the literature and it is considered a necessary prerequisite for the onset of mineralization.⁴¹ ALP has been proposed to have a dual role as an initiator of mineral formation: firstly, it generates P_i, a raw material for calcium phosphates, by hydrolyzing various substrates. But most importantly, it decreases the level of pyrophosphate, a known inhibitor of mineralization, by catalyzing its degradation.⁴² The more the bone materials degrade, the more Ca²⁺ ions are released from the bone grafts. In our experiment period, the higher ALP activity might be caused by the higher levels of Ca²⁺ ion release from the β-C₂S composites, since research has confirmed that Ca²⁺ ions can stimulate MC3T3 cells with ALP activity.⁴³ In addition, the RT-PCR analyses further supported that the newly formed bone tissue of the β-C₂S group achieved the highest osteogenic gene expression (Fig. 8). Previous investigations reported that Ca²⁺, Si⁴⁺ could activate osteogenic gene expression⁴⁴ as well as the activity of catalytic protein⁴⁵ and stimulate osteogenic differentiation of bone marrow-derived stromal cells.⁴⁶ The higher release levels of Ca²⁺ ions and the only instance of Si⁴⁺ ions release seen with the β-C₂S composites (Fig. 3) might be the reason for higher osteogenic gene expression. The results support the β-C₂S composite being conductive to osteogenic differentiation at the protein level.

It was observed using microCT that the β-C₂S group exhibited greater bone volume than the CPC group at 6 weeks and 12 weeks (Fig. 7). It is worth mentioning that the β-C₂S group showed the highest increase in new bone formation from 6 to 12 weeks. Although the Bio-Oss® group exhibited the highest bone volume in each time period, it exhibited the lowest increase in new bone formation from 6 to 12 weeks. Also, the newly formed bone volume observed in HE was smaller than that in the β-C₂S and CPC groups at both 6 and 12 weeks and most of the interspace between the grafts was surrounded by fibrous tissues (Fig. 6). It can be inferred that the highest bone volume displayed by the Bio-Oss® group in microCT might be due to the microCT recognizing the anorganic bovine bone as part of the whole bone volume. Therefore, the newly formed bone tissue in Bio-Oss® might be the lowest among the three grafts. The Bio-Oss® grafts occupied the bone defect but the progress of osseointegration between the grafts was pretty slow.

The good bone regeneration ability of the β-C₂S group in vivo might be attributed to a series of biochemical reactions occurring at the interface of the material and host bone whereby a layer of bone-like apatite forms on the interface.^22,47 For Si-containing materials, these reactions are included^11,22: (1) Ca²⁺ ions released from degrading materials and Si–OH groups forming on the surface of the materials; (2) Ca²⁺ and PO³⁻ ions being absorbed from body fluids forming an amorphous Ca–P deposit on the surface of materials, followed by formation of a crystallized Ca–P (apatite) phase; (3) a matrix is produced stimulating the formation of new bone tissue. The Si–OH groups on the silicate cement surface provide favorable sites for HA nucleation and trigger the formation of apatite layers, which could support osteoblastic differentiation and lead to bone bonding. This effect of Si-containing materials has been confirmed by studies in SBF (Simulated Body Fluid) before.^44,48 Our previous investigation also suggested that Si⁴⁺ release can induce CHA (carbonate hydroxylapatite) deposition on β-C₂S paste.²⁶ Moreover, calcite, which is the product of hydration-derived basic calcium hydroxide, displayed favorable biocompatibility and bone adaption.⁴⁹ These results confirmed that, compared with Bio-Oss® and CPC, β-C₂S composite can persistently promote bone formation and has favorable osteoinductivity in bone generation.

Based on the present study, the fast degradation, stable pH value of the microenvironment, high concentration of ions effect and greater and mature bone regeneration in skull defects in vivo have revealed the superiority of β-C₂S composite in osteogenic differentiation and orthotopic osteoregeneration when compared to the present clinical bone grafts. β-C₂S composite has the potential to be applied as a substitute for bone regeneration. However, how the β-C₂S composite affects the progress of bone regeneration remains unknown, and further studies are still needed.

5. Conclusion

This research presents for the first time that β-C₂S composite is superior in bone regeneration in vivo and vitro to CPC and Bio-Oss®, which are widely used in the clinic. The obtained results clearly demonstrated that the β-C₂S composite not only shows faster degradation and higher ion release of Ca²⁺, Si⁴⁺ but also can stimulate cell proliferation and enhance alkaline phosphatase activity in in vitro tests. Furthermore, the significance of the mRNA of osteogenic genes and bone volume in skull defect repair confirm its superiority to the conventional bone grafts. The β-C₂S composite, which has both biocompatibility and osteoinductivity, can be a promising self-setting substitute for bone regeneration.

Conflict of interest

The authors declare no competing financial interest.

Acknowledgements

This research has been supported by research grants from the National Natural Science Foundation of China (30901686, 81171687, 81301326, 81200768), the Natural Science Foundation of Zhejiang Provincial (LQ14H060003, LY15H140005).

References

1. P. Ducheyne, R. L. Mauck and D. H. Smith, Biomaterials in the repair of sports injuries, Nat. Mater., 2012, 11(8), 652–654.
2. L. L. Hench and J. M. Polak, Third-generation biomedical materials, Science, 2002, 295(5557), 1014–1017.
3. R. R. Throndson and S. B. Sexton, Grafting mandibular third molar extraction sites: a comparison of bioactive glass to a nongrafted site, Oral Surg., Oral Med., Oral Pathol., Oral Radiol. Endodontol., 2002, 94(4), 413–419.
4. M. Barbeck, S. E. Udeabor, J. Lorenz, A. Kubesch, J. Choukroun and R. A. Sader, et al., Induction of multinucleated giant cells in response to small sized bovine bone substitute (Bio-Oss) results in an enhanced early implantation bed vascularization, Ann. Oral. Maxillofac. Surg., 2014, 4(2), 150–157.
5. K. A. Schlegel, G. Fichtner, S. Schultze-Mosgau and J. Wiltfang, Histologic findings in sinus augmentation with autogenous bone chips versus a bovine bone substitute, Int. J. Oral Maxillofac. Implants, 2003, 18(1), 53–58.
6. D. Turhani, M. Weissenbock, E. Watzinger, K. Yerit, B. Cvikl and R. Ewers, et al., In vitro study of adherent mandibular osteoblast-like cells on carrier materials, Int. J. Oral Maxillofac. Surg., 2005, 34(5), 543–550.
7. A. Skoglund, P. Hising and C. Young, A clinical and histologic examination in humans of the osseous response to implanted natural bone mineral, Int. J. Oral Maxillofac. Implants, 1997, 12(2), 194–199.
8. J. B. Huh, J. J. Yang, K. H. Choi, J. H. Bae, J. Y. Lee and S. E. Kim, et al., Effect of rhBMP-2 immobilized anorganic bovine bone matrix on bone regeneration, Int. J. Mol. Sci., 2015, 16(7), 16034–16052.
9. R. Cancedda, P. Giannoni and M. Mastrogiacomo, A tissue engineering approach to bone repair in large animal models and in clinical practice, Biomaterials, 2007, 28(29), 4240–4250.
10. J. Lu, M. Descamps, J. Dejou, G. Koubi, P. Hardouin and J. Lemaitre, et al., The biodegradation mechanism of calcium phosphate biomaterials in bone, J. Biomed. Mater. Res., 2002, 63(4), 408–412.
11. S. Xu, K. Lin, Z. Wang, J. Chang, L. Wang and J. Lu, et al., Reconstruction of calvarial defect of rabbits using porous calcium silicate bioactive ceramics, Biomaterials, 2008, 29(17), 2588–2596.
12. A. Hoppe, B. Jokic, D. Janackovic, T. Fey, P. Greil and S. Romeis, et al., Cobalt-releasing 1393 bioactive glass-derived scaffolds for bone tissue engineering applications, ACS Appl. Mater. Interfaces, 2014, 6(4), 2865–2877.
13. C. Wu, Z. Chen, D. Yi, J. Chang and Y. Xiao, Multidirectional effects of Sr-, Mg-, and Si-containing bioceramic coatings with high bonding strength on inflammation, osteoclastogenesis, and osteogenesis, ACS Appl. Mater. Interfaces, 2014, 6(6), 4264–4276.
14. R. Zhou, D. Wei, S. Cheng, W. Feng, Q. Du and H. Yang, et al., Structure, MC3T3-E1 cell response, and osseointegration of macroporous titanium implants covered by a bioactive microarc oxidation coating with microporous structure, ACS Appl. Mater. Interfaces, 2014, 6(7), 4797–4811.
15. F. J. Martinez-Vazquez, M. V. Cabanas, J. L. Paris, D. Lozano and M. Vallet-Regi, Fabrication of novel Si-doped hydroxyapatite/gelatine scaffolds by rapid prototyping for drug delivery and bone regeneration, Acta Biomater., 2015, 15, 200–209.
16. M. Shi, Y. Zhou, J. Shao, Z. Chen, B. Song and J. Chang, et al., Stimulation of osteogenesis and angiogenesis of hBMSCs by delivering Si ions and functional drug from mesoporous silica nanospheres, Acta Biomater., 2015, 21, 178–189.
17. W. Zhao, J. Wang, W. Zhai, Z. Wang and J. Chang, The self-setting properties and in vitro bioactivity of tricalcium silicate, Biomaterials, 2005, 26(31), 6113–6121.
18. D. Correa, A. Almirall, R. Garcia-Carrodeguas, L. A. dos Santos, A. H. de Aza and J. Parra, et al., Beta-dicalcium silicate-based cement: synthesis, characterization and in vitro bioactivity and biocompatibility studies, J. Biomed. Mater. Res., Part A, 2014, 102(10), 3693–3703.
19. X. Yang, M. Liu, Y. Zhao, H. Jia, S. Xu and X. Li, et al., Rational design and fabrication of a β-dicalcium silicate-based multifunctional cement with potential for root canal filling treatment, J. Mater. Chem. B, 2014, 2(24), 3830.
20. A. A. Eid, K. A. Hussein, L. N. Niu, G. H. Li, I. Watanabe and M. Al-Shabrawey, et al., Effects of tricalcium silicate cements on osteogenic differentiation of human bone marrow-derived mesenchymal stem cells in vitro, Acta Biomater., 2014, 10(7), 3327–3334.
21. M. Lin, L. Zhang, J. C. Wang, X. Y. Chen, X. Y. Yang and W. G. Cui, et al., Novel highly bioactive and biodegradable gypsum/calcium silicate composite bone cements: from physicochemical characteristics to in vivo aspects, J. Mater. Chem. B, 2014, 2(14), 2030–2038.
22. C. Wu and J. Chang, A review of bioactive silicate ceramics, Biomed. Mater., 2013, 8(3), 032001.
23. R. Chrysafi, T. Perraki and G. Kakali, Sol–gel preparation of 2CaO center dot SiO₂, J. Eur. Ceram. Soc., 2007, 27(2–3), 1707–1710.
24. D. Correa, A. Almirall, R. G. Carrodeguas, L. A. dos Santos, A. H. de Aza and J. Parra, et al., Alpha-tricalcium phosphate cements modified with beta-dicalcium silicate and tricalcium aluminate: physicochemical characterization, in vitro bioactivity and cytotoxicity, J. Biomed. Mater. Res., Part B, 2015, 103(1), 72–83.
25. X. Wang, J. Ye, Y. Wang and L. Chen, Self-setting properties of a beta-dicalcium silicate reinforced calcium phosphate cement, J. Biomed. Mater. Res., Part B, 2007, 82B(1), 93–99.
26. Z. Gou, J. Chang, W. Zhai and J. Wang, Study on the self-setting property and the in vitro bioactivity of beta-Ca₂SiO₄, J. Biomed. Mater. Res., Part B, 2005, 73B(2), 244–251.
27. Z. Huan, J. Chang and X. H. Huang, Self-setting properties and in vitro bioactivity of Ca₂SiO₄/CaSO₄·1/2H₂O composite bone cement, J. Biomed. Mater. Res., Part B, 2008, 87B(2), 387–394.
28. C. Pittet and J. Lemaitre, Mechanical characterization of brushite cements: a Mohr circles’ approach, J. Biomed. Mater. Res., 2000, 53(6), 769–780.
29. X. Liu, S. Tao and C. Ding, Bioactivity of plasma sprayed dicalcium silicate coatings, Biomaterials, 2002, 23(3), 963–968.
30. T. Kokubo, H. Kushitani, S. Sakka, T. Kitsugi and T. Yamamuro, Solutions able to reproduce in vivo surface-structure changes in bioactive glass-ceramic A-W, J. Biomed. Mater. Res., 1990, 24(6), 721–734.
31. Z. G. Gou and J. Chang, Synthesis and in vitro bioactivity of dicalcium silicate powders, J. Eur. Ceram. Soc., 2004, 24(1), 93–99.
32. J. Wang, L. Zhang, X. Sun, X. Chen, K. Xie and M. Lin, et al., Preparation and in vitro evaluation of strontium-doped calcium silicate/gypsum bioactive bone cement, Biomed. Mater., 2014, 9(4), 045002.
33. H. Behnia, A. Khojasteh, M. T. Kiani, A. Khoshzaban, F. Mashhadi Abbas and M. Bashtar, et al., Bone regeneration with a combination of nanocrystalline hydroxyapatite silica gel, platelet-rich growth factor, and mesenchymal stem cells: a histologic study in rabbit calvaria, Oral Surg., Oral Med., Oral Pathol. Oral Radiol., 2013, 115(2), e7–15.
34. H. P. Lim, A. E. Mercado-Pagan, K. D. Yun, S. S. Kang, T. H. Choi and J. Bishop, et al., The effect of rhBMP-2 and PRP delivery by biodegradable beta-tricalcium phosphate scaffolds on new bone formation in a non-through rabbit cranial defect model, J. Mater. Sci.: Mater. Med., 2013, 24(8), 1895–1903.
35. H. Hao, N. Amizuka, K. Oda, N. Fujii, H. Ohnishi and A. Okada, et al., A histological evaluation on self-setting alpha-tricalcium phosphate applied in the rat bone cavity, Biomaterials, 2004, 25(3), 431–442.
36. S. W. Choi, Y. Zhang and Y. Xia, Three-dimensional scaffolds for tissue engineering: the importance of uniformity in pore size and structure, Langmuir, 2010, 26(24), 19001–19006.
37. E. Fernandez, M. D. Vlad, M. M. Gel, J. Lopez, R. Torres and J. V. Cauich, et al., Modulation of porosity in apatitic cements by the use of alpha-tricalcium phosphate–calcium sulphate dihydrate mixtures, Biomaterials, 2005, 26(17), 3395–3404.
38. N. Zhang, J. A. Molenda, J. H. Fournelle, W. L. Murphy and N. Sahai, Effects of pseudowollastonite (CaSiO₃) bioceramic on in vitro activity of human mesenchymal stem cells, Biomaterials, 2010, 31(30), 7653–7665.
39. J. Sun, J. Li, X. Liu, L. Wei, G. Wang and F. Meng, Proliferation and gene expression of osteoblasts cultured in DMEM containing the ionic products of dicalcium silicate coating, Biomed. Pharmacother., 2009, 63(9), 650–657.
40. Y. Shen, S. Yang, J. Liu, H. Xu, Z. Shi and Z. Lin, et al., Engineering scaffolds integrated with calcium sulfate and oyster shell for enhanced bone tissue regeneration, ACS Appl. Mater. Interfaces, 2014, 6(15), 12177–12188.
41. O. Tsigkou, J. R. Jones, J. M. Polak and M. M. Stevens, Differentiation of fetal osteoblasts and formation of mineralized bone nodules by 45S5 Bioglass conditioned medium in the absence of osteogenic supplements, Biomaterials, 2009, 30(21), 3542–3550.
42. J. L. Millan, The role of phosphatases in the initiation of skeletal mineralization, Calcif. Tissue Int., 2013, 93(4), 299–306.
43. A. Lazary, B. Balla, J. P. Kosa, K. Bacsi, Z. Nagy and I. Takacs, et al., Effect of gypsum on proliferation and differentiation of MC3T3-E1 mouse osteoblastic cells, Biomaterials, 2007, 28(3), 393–399.
44. W. Liu, W. Peng, Y. Zhu and J. Chang, Physicochemical properties and in vitro biocompatibility of a hydraulic calcium silicate/tricalcium aluminate cement for endodontic use, J. Biomed. Mater. Res., Part B, 2012, 100B(5), 1257–1263.
45. X. Dong, Q. Wang, T. Wu and H. Pan, Understanding adsorption–desorption dynamics of BMP-2 on hydroxyapatite (001) surface, Biophys. J., 2007, 93(3), 750–759.
46. E. K. Park, Y. E. Lee, J. Y. Choi, S. H. Oh, H. I. Shin and K. H. Kim, et al., Cellular biocompatibility and stimulatory effects of calcium metaphosphate on osteoblastic differentiation of human bone marrow-derived stromal cells, Biomaterials, 2004, 25(17), 3403–3411.
47. X. Liu, Y. Xie, C. Ding and P. K. Chu, Early apatite deposition and osteoblast growth on plasma-sprayed dicalcium silicate coating, J. Biomed. Mater. Res., Part A, 2005, 74A(3), 356–365.
48. S. J. Ding, M. Y. Shie and C. Y. Wang, Novel fast-setting calcium silicate bone cements with high bioactivity and enhanced osteogenesis in vitro, J. Mater. Chem., 2009, 19(8), 1183–1190.
49. Y. Fujita, T. Yamamuro, T. Nakamura, S. Kotani, C. Ohtsuki and T. Kokubo, The bonding behavior of calcite to bone, J. Biomed. Mater. Res., 1991, 25(8), 991–1003.

---

Footnote

† These authors contributed equally to this work.

---